DsRNA insecticide for preventing and treating thrips and preparation method of dsRNA insecticide
By preparing dsRNA insecticide, targeting the thrips gene, and using nanocarrier suspension or lyophilized powder, the problems of poor chemical prevention and control effects and environmental pollution are solved, and effective prevention and control of thrips are achieved.
Patent Information
- Application Number
- CN202510457947.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-11
- Publication Date
- 2025-07-29
AI Technical Summary
The existing chemical prevention and control methods are not effective against thrips and have drug resistance and environmental pollution problems. We need to find green and pollution-free prevention and control methods.
Using dsRNA pesticides, by preparing double-stranded RNA structures containing sense strands and antisense strands, using nanocarrier suspensions or lyophilized powders, targeting specific genes of thrips, resulting in degradation of their gene expression and affecting growth and development.
It significantly reduces the expression level of thrips related genes and leads to individual death, providing an effective theory and application basis for thrips prevention and treatment.
Smart Images

Figure CN120384077A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a dsRNA insecticide for thrips control and a preparation method thereof, belonging to the fields of biotechnology and agricultural applications. Background Art
[0002] Thrips is a general term for insects in the order Thysanoptera. The larvae are white, yellow or orange, and the adults are yellow, brown or black. They have a miscellaneous diet and cause great harm to crops. Currently, more than 500 kinds of plants are known to be damaged by them, including chili peppers, tomatoes, carrots, onions, kidney beans, strawberries, peas, etc. The insect feeds on the sap of various parts of the plant with a rasping-sucking mouthpart, resulting in petal discoloration, leaf wrinkling, and scars on the stems and fruits. In severe cases, the whole plant wilts. At the same time, it also spreads various viruses including Tomato spotted wilt virus.
[0003] Due to the tiny body of thrips, strong thigmotaxis, and often living in hidden places such as flowers and buds, and its short life cycle, large egg production, and often laying eggs inside plant tissues, it is very difficult to control thrips chemically. Currently, chemical control is still the main method in thrips control work. However, with the long-term and large-scale use of various chemical agents, thrips have gradually shown a high level of drug resistance. The overuse of chemical agents has caused serious environmental pollution, threatened human health and damaged the agricultural ecological balance. Therefore, in agricultural production practice, there is an urgent need for green and pollution-free prevention and control methods.
[0004] In recent years, RNA interference technology (RNAi) has gradually received attention in the field of plant protection, and this technology is also considered to be one of the most potential pest control methods. RNAi is induced by specific double-stranded RNA, resulting in the degradation of target messenger RNA. This method has achieved remarkable results in the biological control of some insects. For example, in the control study of the brown planthopper, the mortality rate of the brown planthopper reached 41.11% after interfering with the NlNPF gene by dsRNA; by using the cuticle dropping method to interfere with the synapsin gene of the cotton aphid, the mortality rate of the cotton aphid increased rapidly. The mortality rate at 4 days was 72%. In the treatment group with the addition of the nanocarrier SPc, the mortality rate at 2 days was 60-70%, and the mortality rate at 4 days was 92%.
[0005] An invention patent application with publication number CN116445475A discloses an RNAi primer set, recombinant expression vector, transformant, kit, and method for regulating western flower thrips. This invention randomly designed a large number of RNAi primers to form an RNAi primer pool, from which three primer pairs were verified and screened. Transgenic experiments confirmed that the recombinant expression vectors formed by the amplification products of these three primer pairs, when transformed into target plants, significantly reduced the egg laying rate and hatching rate of western flower thrips feeding on the plants, effectively regulating the population of western flower thrips. However, the gene fragments involved in the three primer pairs provided in this invention are kept confidential, making it unclear which genes are silenced, and further, the mechanism of insect mortality is unclear. Summary of the invention
[0006] In view of the problems raised in the background art, the present invention provides a dsRNA insecticide for controlling thrips.
[0007] The technical solutions of the present invention for solving the above problems are as follows:
[0008] A dsRNA insecticide for controlling thrips, comprising a preparation containing dsRNA as an active ingredient, wherein the dsRNA is a double-stranded RNA structure comprising a sense strand and an antisense strand; the nucleotide sequence of the sense strand is shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.11.
[0009] Preferably, the antisense chain nucleotide sequences corresponding to the sense chain nucleotide sequences SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 and SEQ ID NO.11 are shown as SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.10 and SEQ ID NO.12 respectively.
[0010] As a preferred embodiment of the above technical solution, the insecticide is a liquid preparation prepared by loading the dsRNA with a nanocarrier suspension.
[0011] As another preferred embodiment of the above technical solution, the insecticide is prepared by loading the dsRNA with a nanocarrier suspension to form a liquid preparation, and then freeze-drying to obtain a lyophilized powder.
[0012] As another preferred embodiment of the above technical solution, the insecticide is prepared by loading the dsRNA with a nanocarrier suspension to form a liquid preparation, and then preparing water-dispersible granules through a granulation process.
[0013] As a preferred embodiment of the above technical solution, the nanocarrier is MON-NH2.
[0014] As a preferred embodiment of the above technical solution, the dsRNA is loaded with a nanocarrier suspension, specifically, MON-NH2 is first dissolved in ddH2O or DEPC water to prepare a nanocarrier suspension, and then the DEPC aqueous solution of dsRNA is added to the nanocarrier suspension.
[0015] As a preferred embodiment of the above technical solution, the liquid preparation comprises the following components in parts by mass:
[0016]
[0017] As another preferred embodiment of the above technical solution, the liquid preparation comprises the following components in parts by mass:
[0018]
[0019] As another preferred embodiment of the above technical solution, the water dispersible granules contain the following raw materials in parts by mass:
[0020]
[0021] Another object of the present invention is to provide a method for preparing the water dispersible granules.
[0022] A method for preparing a dsRNA insecticide for controlling thrips comprises the following steps:
[0023] S1. Disperse MON-NH2 nanoparticles in DEPC water to prepare a premix, sonicate (40 kHz, 10-15 min) to eliminate agglomeration, add 0.1-0.5 wt% sodium dodecyl sulfate solution, and stir at low speed (≤1000 rpm) to prevent reagglomeration of the nanoparticles; prepare a solution of dsRNA in DEPC water; and pass diatomaceous earth through a 100-200 mesh sieve.
[0024] S2. Mixing the MON-NH2 nanoparticle premix after the pretreatment in step S1 with the dsRNA solution, utilizing the electrostatic binding between the amino groups on the surface of MON-NH2 and the phosphate backbone of the dsRNA, centrifuging and washing the mixture (6,000-9,000 rpm, 10-15 min); the mass ratio of MON-NH2 to dsRNA is 3:1-10:1;
[0025] S3. Sodium lignin sulfonate, sodium carboxymethyl cellulose, sodium lauryl sulfate, and diatomaceous earth were mixed in a high-speed mixer according to the proportions. After mixing, the mixture was sprayed with a solution of MON-NH2 nanoparticles loaded with dsRNA and stirred at a low speed (≤1000 rpm) for 5 to 15 minutes.
[0026] S4. Use an extrusion granulator or a rocking granulator for granulation, and control the temperature ≤ 40°C;
[0027] S5. Use a fluidized bed dryer or a boiling dryer to dry the obtained pellets;
[0028] S5. Remove the coarse particles with D > 500 μm and the fine powder with D < 200 μm through a sieve, and retain the uniform particles, so that D 50 = 200 - 400 μm, and the angle of repose ≤ 35°, ensuring fluidity.
[0029] As an optimization of the above technical solution, the preparation method of the dsRNA includes the following steps:
[0030] S1. Extract the total RNA of thrips, and use a reverse transcription kit to synthesize the first-strand cDNA;
[0031] S2. Use the first-strand cDNA as a template to amplify the gene fragment;
[0032] S3. Perform agarose gel electrophoresis on the amplified gene fragment, and then purify and recover it;
[0033] S4. Connect the purified and recovered product into an expression vector, then transform it into Escherichia coli competent cells, and then culture the competent cells, and pick positive single colonies for detection;
[0034] S5. Extract the plasmid after the detection result passes;
[0035] S6. Use the extracted plasmid as a template for PCR amplification, then perform agarose gel electrophoresis, and then purify and recover it;
[0036] S7. Use the product obtained by purification and recovery in step S6 and a transcription kit to synthesize the dsRNA of the thrips actin coding gene interference sequence;
[0037] In steps S2 and S6, the primer sets for amplifying the gene fragment are selected from the nucleic acid sequences shown in the following groups:
[0038] 1). SEQ ID NO.13 and SEQ ID NO.14;
[0039] 2). SEQ ID NO.15 and SEQ ID NO.16;
[0040] 3). SEQ ID NO.17 and SEQ ID NO.18;
[0041] 4). SEQ ID NO.19 and SEQ ID NO.20;
[0042] 5), SEQ ID NO.21 and SEQ ID NO.22;
[0043] 6), SEQ ID NO.23 and SEQ ID NO.24.
[0044] In summary, the present invention has the following beneficial effects:
[0045] The present invention has confirmed that the use of dsRNA (dsACT1, dsACT2, dsVATB1, dsVATB2, dsVATB3, dsVATB4) can cause the degradation of messenger RNA of related genes in thrips and reduce the expression level of related genes; the results of indoor tests and field efficacy tests together show that when thrips feed on dsRNA, it affects growth and development and further causes individual death. This achievement has laid a good theoretical and application foundation for the control of thrips. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] 图1 It is the agarose gel electrophoresis pattern of colony PCR of Escherichia coli DH5α carrying puc18-recombinant plasmid in Example 1;
[0047] 图2 It is the agarose gel electrophoresis pattern of amplification products of ACT1, ACT2, VATB1, VATB2, VATB3, VATB4 and EGFP in Example 2;
[0048] 图3 It is the agarose gel electrophoresis pattern of double-stranded RNA synthesized by T7 kit in Example 2;
[0049] 图4 It is the agarose gel electrophoresis pattern of the target gene and the L4440 plasmid after double digestion in Example 4;
[0050] 图5 It is the agarose gel electrophoresis pattern of colony PCR of Escherichia coli HT115 carrying L4440-recombinant plasmid (ACT gene);
[0051] 图6 It is the agarose gel electrophoresis pattern of colony PCR of Escherichia coli HT115 carrying L4440-recombinant plasmid (VATB gene);
[0052] 图7 It is the product electrophoresis pattern of Escherichia coli fermenting to produce dsRNA;
[0053] 图8 It is the gene expression statistical chart of Frankliniella intonsa feeding on dsRNA for 3 days in Example 3;
[0054] 图9 This is a statistical graph showing the population mortality of Frankliniella intonsa and Frankliniella occidentalis after feeding on dsRNA for 3 days in Example 3;
[0055] 图10 This is a statistical chart of the mortality of flower thrips (Frankliniella intonsa) after feeding on cowpea sprayed with insecticide for 3 days indoors;
[0056] 图11 Figure 2 shows the mortality statistics of flower thrips (Frankliniella intonsa) and palm thrips (Thrips palmi) in the field after feeding on crops sprayed with insecticides for 8 days. DETAILED DESCRIPTION
[0057] Source of experimental materials:
[0058] Trizol: purchased from Thermo Fisher Scientific;
[0059] PrimeScript TMII 1st Strand cDNA Synthesis Kit: purchased from Bio-Technology Co., Ltd.
[0060] ApexHF HSDNA Polymerase: purchased from Acre Biotechnology Co., Ltd.
[0061] SteadyPure DNA gel extraction kit: purchased from Acryl Biotechnology Co., Ltd.
[0062] TranscriptAid T7 High Yield Transcription Kit: purchased from Thermo Fisher Scientific;
[0063] Mir-X™ miRNA First-Strand Synthesis Kit: purchased from Bio-Rad Biotechnology Co., Ltd.;
[0064] Fluorescence quantitative PCR instrument: purchased from Bio-Rad, model 184-5096;
[0065] L4440 plasmid was purchased from Shanghai Newpro Biotechnology Co., Ltd.;
[0066] HT115 competent cells were purchased from Qingke Biotechnology Co., Ltd.;
[0067] The primers involved in the examples were all commissioned to be synthesized by Youkang Biotechnology Co., Ltd.
[0068] The present invention will be further illustrated by the following implementation cases, but the present invention is not limited thereto. In the examples, %, unless otherwise specified, are all mass percentages; in the quantitative tests of the examples, three repeated experiments are set, and the results are averaged.
[0069] Example 1
[0070] Thrips gene cloning
[0071] Select 50 western flower thrips, extract total RNA using the Trizol method, and synthesize the first-strand cDNA using a reverse transcription kit. The reverse transcription kit is:
[0072] OneStep gDNA Removal and cDNA Synthesis SuperMix (Transgen, Beijing, China).
[0073] Design primers (SEQ ID NO.13 - SEQ ID NO.24) according to the thrips target genes ACT1, ACT2, VATB1, VATB2, VATB3, VATB4.
[0074] SEQ ID NO.13 ACT1-F GCAGGGCAGAGGCTATACAT SEQ ID NO.14 ACT1-R GCGGTGGTGACGAAAGAGTA SEQ ID NO.15 ACT2-F CCTGGACTTCGAGCAGGAAA SEQ ID NO.16 ACT2-R AGTTGGTCCACGACACACAAA SEQ ID NO.17 VATB1-F ATTCTCCGCACTCCTGTGTC SEQ ID NO.18 VATB1-R TTCGCACTGGTATGCAAGGA SEQ ID NO.19 VATB2-F GGTTACATGTACACCGATTTG SEQ ID NO.20 VATB2-R AGTTACCTTGGGAAATAAAGTTT SEQ ID NO.21 VATB3-F GAACGTATCCCAGCCAACG SEQ ID NO.22 VATB3-R CTGAGTGCAGATGCTTGGGT SEQ ID NO.23 VATB4-F CTGTTGCTTCACTTCTGGCG SEQ ID NO.24 VATB4-R TGCACTCTGAACACAGCACT
[0075] Using the first-strand cDNA as a template, and the above primers, the complete fragments of the target genes are obtained by PCR amplification. The PCR reaction system is:
[0076]
[0077] The PCR reaction procedure is: 95°C for 2 min; then 95°C for 30 s, 62°C for 20 s, 72°C for 1 min, cycling 40 times; finally 72°C for 10 min.
[0078] Perform 1% agarose gel electrophoresis on the PCR products; use
[0079] Gel DNA Extraction Mini Kit (Vazyme, Nanjing, China) kit to purify and recover the target products, ligate the purified and recovered products into the puc18 vector (Takara, Dalian, China), and then transform them into Escherichia coli DH5α competent cells (Transgene, Beijing, China), and culture them overnight on a medium with 100 mg / mL Amp resistance.
[0080] Pick positive single colonies for PCR bacterial detection, and the results are as 图1 shown. 图1The figure shows the colony PCR agarose gel electrophoresis map of Escherichia coli DH5α carrying recombinant plasmids puc18-EGFP, puc18-ACT1, puc18-ACT2, puc18-VATB1, puc18-VATB2, puc18-VATB3, and puc18-VATB4. From 图1 it can be seen that the bands are bright, clear, and there are no smear bands; indicating good product specificity and high concentration.
[0081] Plasmids were extracted from the cultured genetically engineered bacteria according to the Plasmid Mini Kit (Vazyme, Nanjing, China) kit, diluted 10-fold as templates, and reserved for use.
[0082] Example 2
[0083] Synthesis of dsRNA
[0084] Using the reserved template from Example 1, PCR amplification was performed. The amplification primers, methods, systems, and procedures were the same as in Example 1.
[0085] After gel electrophoresis detection, the target product was recovered and purified. The detection method was referred to Example 1.
[0086] The detection results are as 图2 shown. 图2 This is the electrophoresis map of the amplified target gene fragment. From 图2 it can be seen that the bands are bright, clear, and there are no smear bands; indicating good product specificity and high concentration.
[0087] Using the recovered and purified product as a template, dsRNA was synthesized using the T7 RNAi Transcription kit (Vazyme, Nanjing, China) kit. The dsRNA synthesis reaction system was:
[0088]
[0089] Then, the samples were mixed with a pipette and incubated overnight at 37°C; the concentration was detected by Nanodrop and 1.2% agarose gel electrophoresis. After obtaining ideal results, the dsRNA was stored in an -80°C refrigerator until use. The detection results are as 图3 shown. 图3 This is the 1.2% agarose gel electrophoresis map of the synthesized dsRNA. From 图3 it can be seen that the bands are bright, clear, and there are no smear bands; indicating good product specificity and high concentration.
[0090] Example 3
[0091] RNAi interference by indoor membrane feeding method
[0092] The dsRNA used was synthesized according to the steps in Example 2. The nanomaterial MON-NH2 and dsRNA were taken. After quantitative analysis by electrophoresis gray scale, 200 μL of the insecticide was prepared according to the mass ratio of the nanocarrier MON-NH2 to dsRNA of 7:1. The final concentration of dsRNA was 50 ng / μL and the final concentration of MON-NH2 was 3500 ng / μL.
[0093] Each insecticide was dissolved in cowpea juice at a ratio of 1:1 to obtain the feeding solution.
[0094] Using the membrane feeding method, the feeding solution was added to the feeding device respectively; the feeding device was made of a 2 mL centrifuge tube. Rectangular holes of 2×1 cm were cut around the tube with an electric soldering iron, and the holes were sealed with insect-proof netting around and on the periphery with hot melt adhesive, and the top was sealed with a centrifuge tube cap; the feeding solution was separated from the adult thrips by a Parafilm membrane, and the mouthparts of the thrips could pierce the Parafilm membrane to absorb the feeding solution on the inner side of the membrane.
[0095] After three groups were continuously fed for 72 h, the thrips were collected for real-time fluorescence quantitative PCR (qPCR) experiments, and the mortality rates were counted for another three groups after continuous feeding for 72 h.
[0096] Detection of the expression of genes related to surviving thrips after 72 h of feeding
[0097] Total RNA of the surviving thrips was extracted by the Trizol method, and then the first-strand cDNA was synthesized by reverse transcription according to the kit instructions. The kit used for reverse transcription was PrimeScript TM RT reagent Kit with gDNA eraser.
[0098] Thrips 18S rRNA (GenBank accession number: XM_026420069.1) was used as the internal reference gene.
[0099] The upstream primer of the internal reference gene is shown as SEQ ID NO.25, and the downstream primer is shown as SEQ ID NO.26.
[0100] SEQ ID NO.25 18s-qF TTTTATGGTGGTGTTGTTGTGG SEQ ID NO.26 18s-qR CAAGGGCTTTGGGTAATGG
[0101] The primer sets for detecting ACT and VATB are shown as SEQ ID NO.27~SEQ ID NO.38.
[0102] SEQ ID NO.27 ACT1-qF GATCATCGCTCCCCCTGAAA SEQ ID NO.28 ACT1-qR ACATGGACTGGAAGGTGGAC SEQ ID NO.29 ACT2-qF TTCCAGCCTTCATTCGTGGG SEQ ID NO.30 ACT2-qR ACCGGACAGGACATTGTTGG SEQ ID NO.31 VATB1-qF CACGGATTTGCCTGGGACTT SEQ ID NO.32 VATB1-qR CATCAACCCGTGGTCTCGTA SEQ ID NO.33 VATB2-qF GGAGGGGCACATTCACTG SEQ ID NO.34 VATB2-qR TCCTGACTTGACGGGTTACA SEQ ID NO.35 VATB3-qF GAAACGCGCAAAAGGTATGC SEQ ID NO.36 VATB3-qR GGGCCTCAGATTGCAGTGTA SEQ ID NO.37 VATB4-qF AGTGCATCTGTGCAATCATGG SEQ ID NO.38 VATB4-qR AGCAGGTTGCACTCTGAACA
[0103] The qPCR reaction system is as follows:
[0104]
[0105] The qPCR amplification program was as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing and extension at 60°C for 34 s, for 40 cycles.
[0106] The 2-ΔΔCt method was used to analyze the relative expression of related genes in thrips after RNAi.
[0107] Figure 8 The figure shows the gene expression statistics of flower thrips (Frankliniella intonsa) after feeding on dsRNA for 3 days. Figure 8 As can be seen, after 72 hours of feeding with dsACT1, the expression level of Actin in thrips was significantly reduced to 0.63 times that of the control group; after feeding with dsACT2, the expression level of Actin was significantly reduced to 0.78 times that of the control group; after 72 hours of feeding with dsVATB1, the expression level of VATB was significantly reduced to 0.63 times that of the control group. After feeding with dsVATB2, the expression level of VATB was not significantly different from that of the control group. After feeding with dsVATB3, the expression level of VATB was significantly reduced to 0.71 times that of the control group; after feeding with dsVATB4, the expression level of VATB was significantly reduced to 0.64 times that of the control group. With the exception of the dsVATB2 group, there were significant differences between the experimental groups and the control group (dsEGFP). These results indicate that, with the exception of the dsVATB2 group, feeding with target gene dsRNA for 72 hours successfully knocked down the expression levels of the ACT or VATB genes in thrips.
[0108] Statistics of thrips population mortality after 72 hours of feeding
[0109] Figure 9Shown are the population mortality statistics of Frankliniella intonsa and Frankliniella occidentalis after feeding on dsRNA for 3 days. Among them, after feeding on dsACT1 for 3 days, the mortality rate of western flower thrips population increased by 33.48% compared with the control group, and the mortality rate of flower thrips population increased by 28.92% compared with the control group; after feeding on dsACT2 for 3 days, the mortality rate of western flower thrips population increased by 54.75% compared with the control group, and the mortality rate of flower thrips population increased by 39.64% compared with the control group; after feeding on dsVATB1 for 3 days, the mortality rate of western flower thrips population increased by 71.52% compared with the control group, and the mortality rate of flower thrips population increased by 46.42% compared with the control group; after feeding on dsVATB2 for 3 days, the mortality rate of western flower thrips population increased by 40.72% compared with the control group, and the mortality rate of flower thrips population increased by 51.47% compared with the control group; after feeding on dsVATB3 for 3 days, the mortality rate of western flower thrips population increased by 53.17% compared with the control group, and the mortality rate of flower thrips population increased by 14.74% compared with the control group; After 3 days, the mortality rate of western flower thrips population increased by 65.66% compared with the control group, and the mortality rate of flower thrips population increased by 55.28% compared with the control group, indicating that the mortality rate of both western flower thrips and flower thrips populations increased significantly after feeding with dsRNA.
[0110] Example 4
[0111] dsRNA bacterial expression and purification
[0112] KpnⅠ and HindⅢ restriction sites were selected on the L4440 plasmid.
[0113] The spare plasmid diluted 10 times in Example 1 was used as a template and PCR amplification was performed using primers with restriction enzyme sites.
[0114] SEQ ID NO.39 mq-ACT1-F <![CDATA[G GGTACC CGCAGGGCAGAGGCTATACAT]]> KpnⅠ SEQ ID NO.40 mq-ACT1-R <![CDATA[CC AAGCTT GGGCGGTGGTGACGAAAGAGTA]]> HindⅢ SEQ ID NO.41 mq-ACT2-F <![CDATA[G GGTACC CCCTGGACTTCGAGCAGGAAA]]> KpnⅠ SEQ ID NO.42 mq-ACT2-R <![CDATA[CC AAGCTT GGAGTTGGTCCACGACACACAAA]]> HindⅢ SEQ ID NO.43 mq-VATB1-F <![CDATA[G GGTACC CATTCTCCGCACTCCTGTGTC]]> KpnⅠ SEQ ID NO.44 mq-VATB1-R <![CDATA[CC AAGCTT GGTTCGCACTGGTATGCAAGGA]]> HindⅢ SEQ ID NO.45 mq-VATB2-F <![CDATA[G GGTACC CGGTTACATGTACACCGATTTG]]> KpnⅠ SEQ ID NO.46 mq-VATB2-R <![CDATA[CC AAGCTT GGAGTTACCTTGGGAAATAAAGTTT]]> HindⅢ SEQ ID NO.47 mq-VATB3-F <![CDATA[G GGTACC CGAAACGTATCCCAGCCAACG]]> KpnⅠ SEQ ID NO.48 mq-VATB3-R <![CDATA[CC AAGCTT GGCTGAGTGCAGATGCTTGGGGT]]> HindⅢ SEQ ID NO.49 mq-VATB4-F <![CDATA[G GGTACC CCTGTTGCTTCACTTCTGGCG]]> KpnⅠ SEQ ID NO.50 mq-VATB4-R <![CDATA[CC AAGCTT GGTGCACTCTGAACACAGCACT]]> HindⅢ
[0115] The L4440 plasmid was linearized with DNA restriction endonucleases KpnⅠ and HindⅢ.
[0116] The target gene amplification product and linearized product were recovered and purified by gel electrophoresis. Figure 4 shown.
[0117] The purified target gene fragment was ligated with the linearized vector using T4 ligase at 25°C for 60 minutes to construct a recombinant plasmid. The recombinant plasmid was then transformed into HT115 competent cells and cultured overnight on LB plates containing 50 mg / mL ampicillin and 12.5 mg / mL tetracycline hydrochloride to verify that the HT115 bacterial solution successfully expressed Actin, VATB, and EGFP. The verification results are as follows:Figure 5 and Figure 6 as shown
[0118] Inoculate the bacterial solution at a ratio of 1:50 into an LB liquid medium containing 50 mg / mL ampicillin and 12.5 mg / mL tetracycline hydrochloride, shake at 37 °C and 230 rpm for about 7 h until the OD value reaches 0.5 - 1, then add IPTG for induction expression and continue culturing under the same conditions for 8 h; extract dsRNA using the phenol-chloroform method; centrifuge at 4 °C and 7500 g (acceleration of gravity) for 5 min to collect Escherichia coli cells, carefully take out the supernatant; then suspend the cell pellet in STE buffer (Solarbio, Shanghai, China) at a ratio of 100:1, and then add the same volume of phenol / chloroform RNA extraction solution (25:24:1, pH < 5, Solarbio, Shanghai, China), vortex vigorously for 3 min, and then centrifuge at 15000 g (acceleration of gravity) at 4 °C for 15 min; after centrifugation, absorb the supernatant and transfer it to a fresh centrifuge tube, add the same volume of isopropanol as the STE buffer, vortex and mix well, precipitate and incubate at room temperature for 10 min, and then centrifuge at 12000 g (acceleration of gravity) at 4 °C for 10 min; after taking out the supernatant, wash the precipitate with 75% ethanol of the same volume as the STE buffer, and then centrifuge at 4 °C and 7500 g (acceleration of gravity) for 5 min; repeat the washing operation again; dry the precipitate at room temperature for 8 min to evaporate the remaining ethanol, and then add RNase-free to dissolve the precipitate at a ratio of 100:1, gently aspirate to obtain dsRNA; purify the dsRNA sample with DNase Ⅰ and diluted 200-fold RNase A (Transgen, Beijing, China) at a ratio of 10:1, incubate at 37 °C for 15 min and then inactivate at 65 °C in a water bath for 10 min; naturally cool to room temperature and dilute 100-fold for quantification and electrophoresis detection, and store the purified dsRNA at -80 °C to prevent its degradation. The electrophoresis detection results are as Figure 7 shown. As can be seen from Figure 7 it, the product has good specificity and high concentration.
[0119] Example 5
[0120] Indoor spraying of dsRNA
[0121] The dsRNA used was synthesized by a kit, and for details, refer to Example 2.
[0122] Weigh an appropriate amount of the nano-carrier MON-NH2 and ultrasonically disperse it in ddH2O to prepare a nano-carrier suspension. Add dsACT1 and dsEGFP to the suspension respectively so that the final concentration of dsRNA is 50 ng / μL to obtain a spraying solution. Aspirate Frankliniella intonsa into the test device. The feeding device is made of a 300 mL disposable takeout box. A circular hole with a diameter of about 6 cm is cut out at the top with an electric soldering iron, and the hole is sealed with an insect-proof net around and outside with hot melt adhesive. A cut filter paper is placed at the bottom of the box. Put the washed cowpeas in, spray 10 ml of the mixed liquid of dsRNA and the carrier in the spray tower, and after treating for 3 days, count the survival rate.
[0123] The statistical results of the spraying bioassay are as Figure 10 shown. It can be seen from Figure 10 that after spraying dsACT1 alone for 3 days, the population mortality rate of Frankliniella intonsa is 41.69%. After spraying the spraying solution prepared by mixing dsACT1 and the MON-NH2 carrier suspension for 3 days, the population mortality rate of Frankliniella intonsa is 49.97%.
[0124] Example 6
[0125] Field spraying of dsRNA
[0126] The dsRNA used is obtained by fermentation production. Specifically, it is prepared from Example 4.
[0127] Weigh an appropriate amount of the nano-carrier MON-NH2 and disperse it in ddH2O to prepare a nano-carrier suspension. Continuously stir with a glass rod for no less than 15 min. Divide the suspension into 7 portions, and add dsACT1, dsACT2, dsVATB1, dsVATB2, dsVATB3, dsVATB4 and dsEGFP to each suspension respectively so that the final concentration of each dsRNA is 500 ng / μL to obtain each spraying solution.
[0128] Test site 1, Thrips palmi on cucumber crops in Shouguang, Shandong. Before spraying, count the initial insect population. Randomly select 10 cucumber plants in each plot and count the number of thrips on the top 4 young leaves. Repeat three times. When spraying, evenly spray the liquid medicine on the front and back of the crop leaves with a sprayer, and count the survival numbers at 2d, 4d, 6d, and 8d after application respectively.
[0129] Test site 2, Frankliniella intonsa on pepper crops in Beihai, Guangxi. Before spraying, count the initial insect population. Randomly select 30 pepper flowers in each plot and count their total number. Repeat three times. When spraying, evenly spray the liquid medicine on the front and back of the crop leaves with a sprayer, and count the survival numbers at 2d, 4d, 6d, and 8d after application respectively.
[0130] The result calculation formula is as follows:
[0131]
[0132] The results of field bioassay are shown in Tables 1 - 8.
[0133] Table 1 Reduction rate of Thrips palmi population on cucumber leaves sprayed with dsRNA - nanoparticle carrier suspension for 2 days in Shouguang, Shandong
[0134]
[0135] Table 2 Reduction rate of Thrips palmi population on cucumber leaves sprayed with dsRNA - nanoparticle carrier suspension for 4 days in Shouguang, Shandong
[0136]
[0137] Table 3 Reduction rate of Thrips palmi population on cucumber leaves sprayed with dsRNA - nanoparticle carrier suspension for 6 days in Shouguang, Shandong
[0138]
[0139] Table 4 Reduction rate of Thrips palmi population on cucumber leaves sprayed with dsRNA - nanoparticle carrier suspension for 8 days in Shouguang, Shandong
[0140]
[0141] Table 5 Reduction rate of Frankliniella intonsa population on pepper leaves sprayed with dsRNA - nanoparticle carrier suspension for 2 days in Beihai, Guangxi
[0142]
[0143] Table 6 Reduction rate of Frankliniella intonsa population on pepper leaves sprayed with dsRNA - nanoparticle carrier suspension for 4 days in Beihai, Guangxi
[0144]
[0145] Table 7 Reduction rate of Frankliniella intonsa population on pepper leaves sprayed with dsRNA - nanoparticle carrier suspension for 6 days in Beihai, Guangxi
[0146]
[0147] Table 8 Reduction rate of the population of Frankliniella intonsa on pepper leaves in Beihai, Guangxi after spraying dsRNA nanocarrier suspension for 8 days
[0148]
[0149] As can be seen from Tables 1 - 8: Within 2 days of field treatment for Thrips palmi and Frankliniella intonsa, there was no significant difference in the statistical mortality rate compared to the control group. This indicates that the onset time of each group was relatively late and the quick-acting effect was average.
[0150] Statistical corrected control efficacy against Thrips palmi:
[0151] After 4 days, the corrected control efficacies of the two dsACT groups were 23.04% and 17.57%, and as the statistical time extended, the corrected control efficacies reached 47.33% and 46.05% on the 6th day, and 52.39% and 67.46% on the 8th day. This indicates that the quick-acting effect was average, but there was at least an 8-day persistent effect and the effect was extremely significant.
[0152] After 4 days, the corrected control efficacies of the four dsVATB groups were 18.14 - 28.28%, and as the statistical time extended, the corrected control efficacies reached 28.68 - 45.71% on the 6th day and 55.70 - 65.45% on the 8th day. This indicates that although the quick-acting effect of each group was average, there was at least an 8-day persistent effect and the effect was extremely significant.
[0153] Statistical corrected control efficacy against Frankliniella intonsa:
[0154] After 4 days, the corrected control efficacy of the dsACT1 group was 20.87%, and as the statistical time extended, the corrected control efficacy reached 39.65% on the 6th day and 46.04% on the 8th day. This indicates that the quick-acting effect was average, but there was at least an 8-day persistent effect.
[0155] After 4 days, the corrected control efficacy of the dsACT2 group was 19.64%, and as the statistical time extended, the efficacy reached 57.01% on the 6th day and dropped to 53.54% on the 8th day. This indicates that the quick-acting effect was average, but there was at least a 6 - 7-day persistent effect and the effect was extremely significant.
[0156] After 4 days, the corrected control efficacy of the dsVATB1 group was 13.16%, and as the statistical time extended, the corrected control efficacies reached 56.90% on the 6th day and 64.59% on the 8th day respectively. This indicates that for the dsVATB1 group insecticide, the quick-acting effect was average, but there was at least an 8-day persistent effect and the effect was extremely significant.
[0157] After 4 days, the corrected efficacy of the dsVATB2 group was 25.59%. As the statistical time increased, the corrected efficacy reached 55.04% on the 6th day, but dropped to 29.06% on the 8th day, indicating that the dsVATB2 insecticide lasts for about 6 to 7 days.
[0158] After 4 days, the corrected control efficacy of the dsVATB3 group was -1.21%. As the statistical time increased, the corrected control efficacy reached -27.17% on the 6th day and 41.71% on the 8th day, respectively. This indicates that the dsVATB3 group insecticide takes about 8 days to take effect.
[0159] After four days, the corrected efficacy of the dsVATB4 group was 15.91%. As statistical time increased, the corrected efficacy dropped to -22.93% on the sixth day, but rebounded and rapidly jumped to 59.76% on the eighth day. This suggests that the dsVATB4 group of insecticides may have a weak effect in the short term, but this effect is quickly overcome by the flower thrips. However, over time, this group of insecticides showed a true effect on the eighth day. This suggests that this insecticide has a long onset of action and poor rapidity of action, but its insecticidal effect is significant after the late onset of action.
[0160] Figure 11 The following is a statistical chart of the mortality of flower thrips and palm thrips populations after feeding on crops sprayed with insecticides for 8 days. Figure 11 It can be seen that the population numbers of flower thrips and palm thrips after spraying dsRNA were significantly lower than those in the control group. Among them, 8 days after spraying dsACT1, the mortality rate of palm thrips population increased by 44.38% compared with the control group, and the mortality rate of flower thrips population increased by 48.25% compared with the control group; 8 days after spraying dsACT2, the mortality rate of palm thrips population increased by 59.46% compared with the control group, and the mortality rate of flower thrips population increased by 55.75% compared with the control group; 8 days after spraying dsVATB1, the mortality rate of palm thrips population increased by 57.44% compared with the control group, and the mortality rate of flower thrips population increased by 67.16% compared with the control group; 8 days after spraying dsVATB2, the mortality rate of palm thrips population increased by 47.70% compared with the control group, and the mortality rate of flower thrips population increased by 31.27% compared with the control group; 8 days after spraying dsVATB3, the mortality rate of palm thrips population increased by 50.98% compared with the control group, and the mortality rate of flower thrips population increased by 43.92% compared with the control group; 8 days after spraying dsVATB4 After 8 days, the mortality rate of palm thrips population increased by 58.75% compared with the control group, and the mortality rate of flower thrips population increased by 61.97% compared with the control group.
[0161] In summary, when thrips feed on dsACT1, dsACT2, dsVATB1, dsVATB2, dsVATB3, and dsVATB4, the expression of the Actin gene or the VATB gene decreases, and the population mortality rate is significantly higher than that of the control group. The present invention confirms that dsACT1, dsACT2, dsVATB1, dsVATB2, dsVATB3, and dsVATB4 can be used to control western flower thrips, flower thrips, and palm thrips in the field. Furthermore, the Actin and VATB genes of western flower thrips share over 90% homology with those of Megalurothrips usitatus, indicating that the dsRNA of the present invention has application potential in controlling other thrips, including Megalurothrips usitatus.
Claims
1. A dsRNA insecticide for thrips control, characterized in that: The insecticide is a preparation with dsRNA as the active ingredient, and the dsRNA has a double-stranded RNA structure comprising a sense strand and an antisense strand; the nucleotide sequence of the sense strand is as shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.
11.
2. The dsRNA insecticide for thrips control according to claim 1, wherein: The insecticide is a liquid preparation made by loading the dsRNA with a nano-carrier suspension.
3. The dsRNA insecticide for thrips control according to claim 1, characterized in that: The insecticide is a freeze-dried powder preparation obtained by making a liquid preparation by loading the dsRNA with a nano-carrier suspension and then freeze-drying.
4. The dsRNA insecticide for thrips control according to claim 1, wherein: The insecticide is a water-dispersible granule preparation made by making a liquid preparation by loading the dsRNA with a nano-carrier suspension and then through a granulation process.
5. A dsRNA insecticide for thrips control according to claim 2 to 4, characterized in that: The nano-carrier is MON-NH2.
6. The dsRNA insecticide for thrips control according to claim 5, characterized in that: Loading the dsRNA with a nano-carrier suspension specifically involves first dissolving MON-NH2 in ddH2O or DEPC water to make a nano-carrier suspension, and then adding the DEPC aqueous solution of dsRNA to the nano-carrier suspension.
7. The dsRNA insecticide for thrips control according to claim 2, characterized in that, The liquid preparation contains the following components in parts by mass: MON-NH2 nanoparticles 5 - 15% w / v dsRNA 2 - 5% w / w Non-ionic surfactant 0.2 - 0.5 w / v 1X phosphate buffer 10 mM.
8. The dsRNA insecticide for thrips control according to claim 3, wherein The liquid preparation contains the following components in parts by mass: MON-NH2 nanoparticles 5 - 15% w / v dsRNA 2 - 5% w / w Non-ionic surfactant 0.2 - 0.5 w / v Trehalose 10 - 20% w / w 1X phosphate buffer 10 mM.
9. The dsRNA insecticide for thrips control according to claim 4, characterized in that, The water-dispersible granule preparation contains the following raw materials in parts by mass: MON-NH2 nanoparticles 5 - 15 wt% dsRNA 2 - 5 wt% Sodium lignosulfonate 4 - 6 wt% Sodium carboxymethyl cellulose 4 - 6 wt% Sodium dodecyl sulfate 3 - 5 wt% Diatomaceous earth the balance.
10. The preparation method of a dsRNA insecticide for controlling thrips according to claim 9, comprising the following steps: S1. Disperse MON-NH2 nanoparticles in DEPC water to prepare a premix, ultrasonically treat to eliminate agglomeration, add a 0.1 - 0.5 wt% sodium dodecyl sulfate solution, and stir at low speed to prevent the nanoparticles from re-agglomerating; prepare a solution of dsRNA with DEPC water; sieve the diatomaceous earth through a 100 - 200 mesh sieve; S2. Mix the MON-NH2 nanoparticle premix pretreated in step S1 with the dsRNA solution, utilize the electrostatic binding between the amino groups on the surface of MON-NH2 and the phosphate backbone of dsRNA, and centrifuge and wash after mixing; the mass ratio of MON-NH2 to dsRNA is 3:1 - 10:1; S3. Mix sodium lignosulfonate, sodium carboxymethyl cellulose, sodium dodecyl sulfate and diatomaceous earth in proportion with a high-speed mixer, and then spray the solution of MON-NH2 nanoparticles loaded with dsRNA after mixing evenly, and stir at low speed for 5 - 15 min; S4. Use an extrusion granulator or a swing granulator for granulation, and control the temperature ≤ 40°C; S5. Use a fluidized bed dryer or a flash dryer to dry the obtained pellets; S5, remove the coarse particles with D>500μm and the fine powder with D<200μm through the screening machine, retain the uniform particles, and make D 50 =200~400μm, repose angle ≤35°, ensuring fluidity.
Citation Information
Patent Citations
RNAi primer group, recombinant expression vector, transformant, kit and method for regulating and controlling Frankliniella occidentalis
CN116445475A
Cited By
Application of double-stranded RNA (Ribonucleic Acid) molecule and related biological material thereof in prevention and treatment of megalurothrips usitatus
CN122012508A