Application of composition in preparation of medicine for treating breast tumor

Abstract

The invention relates to application of a composition in preparation of drugs for treating breast tumors. The composition is a composition of a substance for inhibiting PSMD14 gene expression and unsaturated fatty acid, the substance for inhibiting PSMD14 gene expression is a substance for reducing the PSMD14 gene expression quantity by using specific shRNA (short hairpin ribonucleic acid) of a PSMD14 gene, and the unsaturated fatty acid can be arachidonic acid. Experiments prove that by inhibiting the expression of the PSMD14 gene and combining with unsaturated fatty acid, the death of breast tumor cells can be promoted, the growth of tumors can be inhibited, and the tumor formation speed of mice can be delayed. The application shows that the growth of the TNBC transplanted tumor can be inhibited by reducing the content of the PSMD14, the growth of the TNBC transplanted tumor can be further inhibited after the unsaturated fatty acid is added, the PSMD14 can be used as a potential target spot for treating TNBC patients, and a new non-surgical treatment scheme is provided for treating breast tumors.

Description

Technical field:

[0001] The present invention relates to the field of biomedicine, and in particular to an application of a composition of a substance for inhibiting PSMD14 gene expression and unsaturated fatty acids in the preparation of a drug for treating breast tumors. Background technology:

[0002] Breast cancer is the most common malignant tumor in women and the second leading cause of cancer-related death worldwide. Published reports show that there will be an estimated 287,850 new cases of breast cancer in 2022 (31%), and its estimated deaths account for 15% of new cases of breast cancer. Among all breast cancer subtypes, triple-negative breast cancer (TNBC) has the worst prognosis and overall survival (OS). Therefore, it is of great significance to further clarify the molecular mechanism of the occurrence and development of TNBC.

[0003] TNBC refers to breast cancer that is negative for ER, PR, and HER2 receptors, accounting for about 15% to 20% of the total breast cancer population. Compared with other subtypes, it has the characteristics of "low differentiation, strong invasiveness, high recurrence rate, and poor overall prognosis". Because the tumor lacks the corresponding receptors, patients cannot benefit from endocrine therapy and HER2 targeted therapy, and current treatment options are relatively limited, mainly a combination of surgery and chemotherapy. The clinical treatment effect of most patients is not ideal, and recurrence and metastasis are prone to occur during treatment, which seriously affects the patient's survival prognosis. Therefore, clarifying the molecular regulatory mechanism of TNBC invasion and metastasis provides a new theoretical basis and molecular targets for the treatment of TNBC, which will help improve the treatment dilemma of TNBC. Summary of the invention:

[0004] 1. Technical issues to be resolved

[0005] In view of the above background, the present invention provides an application of a composition in the preparation of a drug for treating breast tumors, wherein the composition is a composition of a substance that inhibits the expression of the PSMD14 gene and unsaturated fatty acids. The present invention proves through experiments that inhibiting the expression of the PSMD14 gene combined with unsaturated fatty acids can promote the death of breast tumor cells, inhibit tumor growth, and delay the rate of tumor formation in mice. It shows that the reduction of PSMD14 content can inhibit the growth of TNBC transplanted tumors, and the addition of unsaturated fatty acids can further inhibit the growth of TNBC transplanted tumors, proving that PSMD14 can be used as a potential target for the treatment of TNBC patients, opening up broader prospects for non-surgical treatment of breast tumors.

[0006] (II) Technical solution

[0007] In order to solve the above technical problems, the present invention provides an application of a composition in the preparation of a drug for treating breast tumors, wherein the composition is a composition of a substance that inhibits the expression of the PSMD14 gene and an unsaturated fatty acid, and the substance that inhibits the expression of the PSMD14 gene is a substance that utilizes a specific shRNA of the PSMD14 gene to reduce the expression amount of the PSMD14 gene.

[0008] Furthermore, the substance that utilizes the specific shRNA of the PSMD14 gene to reduce the expression amount of the PSMD14 gene is the shRNA that can specifically reduce the expression amount of the PSMD14 gene, or the expression cassette that can express the shRNA, or the recombinant vector containing the expression cassette, or the cell line containing the recombinant vector.

[0009] Furthermore, the nucleotide sequence of the shRNA is shown in SEQ ID NO: 1 and SEQ ID NO: 2, specifically:

[0010] The PSMD14 shRNA positive strand sequence is:

[0011] CCGGCTTCGAATCTGGGTCACTTAACTCGAGTTAAGTGACCCAGATTCG AAGTTTTTG;

[0012] The reverse strand sequence of PSMD14 shRNA is:

[0013] AATTCAAAAACTTCGAATCTGGGTCACTTAACTCGAGTTAAGTGACCCA GATTCGAAG.

[0014] Furthermore, the vector is a viral vector and / or a plasmid, the viral vector is specifically a lentivirus, and the plasmid is a pLKO.1puro vector.

[0015] Furthermore, the unsaturated fatty acid may be arachidonic acid AA.

[0016] Furthermore, the composition also includes a GSH peroxidase 4 inhibitor RSL3. When the substance that inhibits PSMD14 gene expression is a cell infected with sh-PSMD14 virus, the mass ratio of the sh-PSMD14 virus contained in the composition, the arachidonic acid AA and the RSL3 is 1:3:3.

[0017] Furthermore, the breast tumor may be triple-negative breast cancer, and the specific types of triple-negative breast cancer cells are MDA-MB-231, BT-549 or HCC1973.

[0018] The application of the substance inhibiting the expression of PSMD14 gene in preparing unsaturated fatty acids for incubating breast tumor cells.

[0019] In the above applications, the treatment and / or prevention of breast tumors can be embodied in reducing the activity of breast tumor cells and / or delaying the growth of breast tumors in animals.

[0020] The animal may be a mammal, and the mammal may be a human or a mouse. In one embodiment of the present invention, the mouse is an immunodeficient mouse Balb / c nude. The animal models involved include tumor xenograft models, patient-derived tumor xenograft models (PDX) and tumor organoid models (PDO).

[0021] The present invention also provides the use of the composition in preparing any of the following products:

[0022] X1. Inhibit the growth of breast tumor cells;

[0023] X2, inhibiting the tumorigenicity of breast tumor cells;

[0024] X3. Reduce the viability of breast tumor cells;

[0025] X4. Reduce the self-renewal ability of breast tumor cells.

[0026] The tumorigenicity can be reflected in the ability of the breast tumor cell sphere formation (including tumor xenograft model, PDX model and PDO model). In the above application, the breast tumor cell can be a triple-negative breast cancer cell. The triple-negative breast cancer cell can be MDA-MB-231, BT-549 or HCC1973.

[0027] The use of the substance that inhibits the content and / or activity of PSMD14 in the preparation of unsaturated fatty acids for incubating breast tumor cells also falls within the protection scope of the present invention.

[0028] In the present invention, PSMD14 is a protein encoded by the PSMD14 gene (NCBI ID: 10213, updated on November 3, 2024).

[0029] The breast tumor may be a mammalian breast tumor. Both the breast tumor cells and the triple-negative breast cancer cells may be mammalian cells. The mammal may be a human or a mouse. In one embodiment of the present invention, the mouse is an immunodeficient mouse Balb / c nude.

[0030] (III) Beneficial effects

[0031] The beneficial effects of the present invention are as follows: the present invention found that knocking down the PSMD14 gene combined with unsaturated fatty acids can promote the death of breast tumor cells, inhibit tumor growth, and delay the rate of tumor formation in mice. This indicates that the reduction of PSMD14 content can inhibit the growth of TNBC transplanted tumors, and the addition of unsaturated fatty acids can further inhibit the growth of TNBC transplanted tumors, proving that PSMD14 can be used as a potential target for the treatment of TNBC patients, providing a new approach for the treatment of breast tumors. Description of the drawings:

[0032] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below.

[0033] Figure 1 The expression of PSMD14 was detected by WB and IHC, including:

[0034] A shows the expression of PSMD14 detected in cancer and adjacent tissues of TNBC samples;

[0035] B is the detection of PSMD14 expression in TNBC cells;

[0036] C is the expression of PSMD14 in cancer and adjacent tissues of TNBC samples detected by IHC;

[0037] D is the expression of PSMD14 protein detected by WB after PSMD14 was knocked out in MDA-MB-231 and BT-549;

[0038] E: WB detection of PSMD14 protein expression after overexpression of PSMD14 in MDA-MB-231 and BT-549.

[0039] Figure 2 Knockdown of the PSMD14 gene combined with unsaturated fatty acids can promote the death of breast tumor cells. Among them:

[0040] A shows the response of xenografts expressing vector or sh-PSMD14 to PBS or RSL3 / AA treatment, showing xenograft tumors in each group (n=4);

[0041] B: Tumor volume was measured twice a week and growth curve was drawn;

[0042] C: The tumor weights of the four groups were analyzed.

[0043] Figure 3 OPA plus AA supplementation induced synthetic lethality in PSMD14-overexpressing triple-negative cancer PDXs and PDOs.

[0044] A is a graphic illustration of the PSMD14-overexpressing TNBC PDX and PDO mouse models.

[0045] B: Xenograft tumors were collected from PDX mice treated with OPA, AA / RSL3, OPA combined with AA / RSL3, and vehicle control.

[0046] C: The tumor volume of PDX mice was monitored every three days, and the tumor growth curve was plotted.

[0047] D: Tumors of PDX mice were extracted and weighed.

[0048] E: Tumor sections of PDX mice were stained with anti-Ki-67, anti-p-AKT, and anti-p-MTOR antibodies by IHC (scale bar = 20 μm).

[0049] F, Quantification of Ki-67, p-AKT, and p-MTOR positive staining in PDX tumors.

[0050] G depicts the main phenotypes of TNBC organoids treated with OPA, AA / RSL3, OPA and AA / RSSL3 combined, and vehicle control.

[0051] H is after the specified treatment described in (G), the cells were purified by CellTiter- 3D cell viability assay to detect the viability of organoids.

[0052] I is the quantification of Ki-67 positive staining in organoids.

[0053] J is histological and immunohistochemical images showing the organization and status of proliferation markers (Ki-67) in organoids after the indicated treatments described in (G) (scale bar = 50 μm).

[0054] In the above figures and descriptions, OPA is a substance that inhibits the content and / or activity of PSMD14; RSL3 is a ferroptosis inducer. Specific implementation method:

[0055] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0056] The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art and do not constitute a limitation of the present invention in any way. The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out in accordance with the techniques or conditions described in the literature in the art or in accordance with the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. The quantitative tests in the following examples were all repeated three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0057] MDA-MB-231, BT-549, and HCC1973 in the following examples are all recorded in the literature (LRPPRC promotes glycolysis by stabilising LDHA mRNA and its knockdown plus glutamine inhibitor induces synthetic lethality via m6 A modification in triple-negative breast cancer. Clin Transl Med. 2024Feb; 14(2): e1583. doi: 10.1002 / ctm2.1583) (Figure 2 G and H on page 9), which can be obtained by the public from the applicant. These biological materials are only used to repeat the relevant experiments of the present invention and cannot be used for other purposes. MDA-MB-231, BT-549, and HCC1973 are all tumor cells isolated from tumor tissues of different breast cancer patients, and they also have the ability of self-renewal, unlimited proliferation, and tumorigenesis.

[0058] sh-PSMD14#1, sh-PSMD14#2, and sh-PSMD14#3 as well as the PSMD14 overexpression plasmid were synthesized by GenePharma (China);

[0059] PSMD14(12059-1-AP,1:1000,Proteintech),

[0060] p-AKT(66444-1-Ig,1:1000,Proteintech),

[0061] p-mTOR(67778-1-Ig,1:1000,Proteintech),

[0062] β-actin (8457S, 1:1000, CST),

[0063] Ki67(27309-1-AP,1:200,Proteintech).

[0064] Secondary antibody: Rabbit secondary antibody AffiniPure Goat Anti-Rabbit IgG (H+L), Jackson ImmunoResearch (Cat. No. 111-005-003); Mouse secondary antibody

[0065] AffiniPure GoatAnti-Mouse IgG (H+L), Jackson ImmunoResearch (Cat. No. 115-005-003).

[0066] Example 1: PSMD14 gene knockdown combined with unsaturated fatty acids can inhibit the progression of TNBC

[0067] 1. Detection of PSDM14 expression in TNBC

[0068] (1) Collection of cancer and adjacent tissue specimens from TNBC patients

[0069] (2) Western blot assay to detect the expression level of PSMD14 in cancer and adjacent normal specimens of TNBC patients. Figure 1 A), the primary antibodies used were PSMD14 antibody and β-actin antibody, and the secondary antibody was AffiniPure Goat Anti-Rabbit (or Anti-Mouse) IgG (H+L).

[0070] (3) IHC detection of PSMD14 expression levels in cancer and adjacent normal specimens of TNBC patients ( Figure 1 C)

[0071] (4) Western blot assay to detect the expression level of PSMD14 in TNBC cells Figure 1 B), the primary antibodies used were PSMD14 antibody and β-actin antibody, and the secondary antibody was AffiniPure Goat Anti-Rabbit (or Anti-Mouse) IgG (H+L).

[0072] 2. PSMD14 gene knockdown

[0073] Knockdown of PSMD14 gene using pLKO.1puro-shPSMD14

[0074] The PSMD14 gene was knocked out in MDA-MB-231 and BT-549 cells using the pLKO.1puro-shPSMD14 induction knockdown method. The specific steps are as follows:

[0075] (1) Construction of pLKO.1puro-shPSMD14 plasmid

[0076] 1) Design and synthesize PSMD14 shRNA primer sequences. According to the shRNA sequences provided by the Public TRC Portal and the Sigma website, select the PSMD14 shRNA interference sequence that is specific to the PSMD14 gene and is verified to be suitable for the pLKO.1-puro (Addgene, Catalog No. #21915) vector. Send the designed PSMD14 shRNA sequence to Invitrogen for synthesis. The primer sequences are shown in Table 1:

[0077] Table 1. PSMD14 shRNA primer sequences

[0078]

[0079]

[0080] 2) PSMD14 shRNA primer annealing The primers synthesized by the company were diluted with water to a final concentration of 10 μmol / L, and then annealed. The annealing system is shown in Table 2:

[0081] Table 2. PSMD14 shRNA annealing system

[0082] Element Volume / μL Upstream primer F 5 Downstream primer R 5 0.5mol / LNaCl 6 ddH2O 24 Total volume 40

[0083] The mixed annealing system was placed in a 95°C water bath and heated for 10 min. The water bath was then closed to allow the temperature to slowly drop to room temperature. The annealing product was stored in a refrigerator at 4°C.

[0084] 3) Enzyme digestion of pLKO.1-puro empty vector

[0085] pLKO.1-puro was double-digested with EcoRⅠ and AgeⅠ to recover the pLKO.1-puro vector backbone.

[0086] 4) Connect

[0087] The pLKO.1-puro vector backbone obtained in step (3) and the three groups of annealing products obtained in step (2) were connected, and the recombinant vectors with correct sequences were recorded as pLKO.1puro-shPSMD14#1, pLKO.1puro-shPSMD14#2, and pLKO.1puro-shPSMD14#3 (the vectors without annealing products were recorded as the corresponding pLKO.1puro-shNC).

[0088] (2) Virus packaging

[0089] 1.5×10 HEK293 cells were inoculated in a 10 cm culture dish 24 h in advance, and the lentiviral packaging plasmids psPAX2 (5 μg) and pCI-VSVG (5 μg) as well as the three successfully constructed pLKO.1puro-shPSMD14 plasmids were transfected into HEK293 cells using the calcium phosphate transfection method. The culture medium was replaced with complete medium 12 h after transfection. After 72 h of cell culture, the virus supernatant was collected, centrifuged at 3000 rpm for 3 min, and the virus supernatant was filtered with a 0.45 μm filter. The filtered viruses (respectively denoted as shPSMD14#1, shPSMD14#2, shPSMD14#3 viruses, and the control group was denoted as shNC virus) were collected and stored at -80°C.

[0090] (3) Verify knockdown / knockout effects after infection and screening

[0091] 1.5×10 TNBC (MDA-MB-31 or BT-549) were inoculated in a 10 cm culture dish, 5 mL of supernatant containing shPSMD14 virus (or shNC virus) was added, and then the dish was filled up to 10 mL with complete culture medium. After the cells were cultured in an incubator for 48 h, the cells were digested with Accutase (trypsin) into single cells, and the cells were resuspended in complete culture medium containing 1 μg / mL of puromycin for screening, and the screened positive cells were continued to be cultured. The transfected cells were labeled as MDA-MB-231-shPSMD14#1 and BT-549-shPSMD14#1, MDA-MB-231-shPSMD14#2 and BT-549-shPSMD14#2, and the cells of the MDA-MB-231-shPSMD14#3 and BT-549-shPSMD14#3 control groups were labeled as MDA-MB-231-shN and BT-549-shNC. The expression levels of PSDM14 in MDA-MB-231-shPSMD14#1 and BT-549-shPSMD14#1, MDA-MB-231-shPSMD14#2 and BT-549-shPSMD14#2, MDA-MB-231-shPSMD14#3 and BT-549-shPSMD14#3, and MB-231-shN and BT-549-shNC were detected by WB. Figure 1 D), the experimental results showed that the expression level of PSMD14 in MDA-MB-231-shPSMD14#1 and BT-549-shPSMD14#1, MDA-MB-231-shPSMD14#2 and BT-549-shPSMD14#2 was significantly lower than that in MB-231-shN and BT-549-shNC, among which shPSMD14#2 was more obviously lower. The primary antibodies used were PSMD14 antibody and β-actin antibody, and the secondary antibody was AffiniPure Goat Anti-Rabbit (or Anti-Mouse) IgG (H+L).

[0092] 3. PSMD14 gene knockdown in vivo combined with unsaturated fatty acids for breast cancer treatment

[0093] Immunodeficient mice: Balb / c nude (Beijing Weitonglihua Experimental Animal Technology Co., Ltd.), 4 weeks old, weighing 15-17 grams.

[0094] (1) Tumor xenograft model

[0095] Sixteen mice were randomly divided into four groups:

[0096] ①sh-NC group: MDA-MB-231 cells (1×10 7 ) were injected subcutaneously into nude mice. The reference experimental group was given an equal volume of distilled water regularly;

[0097] ②sh-PSMD14 group: MDA-MB-231 cells (1×10 7 ) were injected subcutaneously into nude mice. The reference experimental group was given an equal volume of distilled water regularly;

[0098] ③sh-NC+AA / RSL3 group: MDA-MB-231 cells (1×10 7 ) was injected subcutaneously into nude mice. AA and RSL3 were dissolved in DMSO at the same time and intragastrically administered at a concentration of 0.15% for 7 consecutive days. The mass ratio of AA / RSL3 was 1:1;

[0099] ④sh-PSMD14+AA / RSL3 group: MDA-MB-231 cells (1×10 7 AA and RSL3 were dissolved in DMSO and intragastrically injected into nude mice at a dosage of 50 mg kg per mouse. -1 Calculation: After 7 days of continuous treatment, the mass ratio of sh-PSMD14 virus, AA, and RSL3 in cells infected with sh-PSMD14 virus was 1:3:3;

[0100] After the above grouping treatment, the length and width of the subcutaneous tumor were recorded every four days, and the volume of the subcutaneous tumor was calculated. The tumor volume was calculated according to the formula: (length × width 2 ) / 2. After 5 weeks, the mice were euthanized, and the tumors were removed and weighed.

[0101] (2) Patient-derived tumor xenograft (PDX)

[0102] Cell Culture Preparation and Culture of Breast Cancer Organoids:

[0103] 1) Sampling: Fresh tissue samples are placed in the prepared DMEM / F12 (containing double antibody) medium, stored on ice and transported to the laboratory. Weigh and record;

[0104] 2) Mechanical cutting: Use a scalpel or ophthalmic scissors to remove fat, necrotic tissue, etc., wash with DMEM / F12 (containing double antibody) culture medium, and then cut the tumor into small pieces with a diameter of 1-3 mm;

[0105] 3) Enzymatic hydrolysis: Use a Pasteur pipette to transfer the remaining tissue fragment suspension into a 15 mL centrifuge tube, add AdDF++ medium to 10 mL, and centrifuge for recovery: 300 g, 5 min;

[0106] 4) Histochemical digestion: Resuspend the pellet with 10 mL of BCO digestion solution, transfer to a conical flask, and place in a suspension incubator at 37°C, 5% CO2, 120 rpm / min for 1-1.5 hours. Stop the enzymatic hydrolysis with serum-containing culture medium, and blow the digestion product in the conical flask with a 3 mL plastic Pasteur pipette;

[0107] 5) Filtration: Pass through 100μm and 40μm filters in sequence, recover 40-100μm cells by centrifugation at 300g for 5min for organoid culture, and cryopreserve cell pellets smaller than 40μm;

[0108] 6) Seeding: Resuspend the cell pellet in frozen-thawed BME, blow evenly, drop 40 μl / well into a 24-well plate, incubate at 37°C for 20 min, and slowly add 400 μl / well of culture medium.

[0109] Subcutaneous tumors and grouping:

[0110] Take 20 mice and transfer the cells (1×10 7 ) were injected subcutaneously into nude mice and then randomly divided into 4 groups.

[0111] ①Control group: the same volume of distilled water was given intragastrically regularly as in the experimental group;

[0112] ②OPA group: OPA was dissolved in DMSO and administered orally at a dosage of 50 mg / kg per mouse. -1 Calculation, continuous treatment for 7 days;

[0113] ③AA / RSL3 group: AA and RSL3 were dissolved in DMSO at the same time and intragastrically administered at a concentration of 0.15% for 7 consecutive days;

[0114] ④OPA+AA / RSL3 group: OPA, AA and RSL3 were dissolved in DMSO at the same time and administered intragastrically at a concentration of 1 mg / ml for 7 consecutive days;

[0115] After the above grouping treatment, the length and width of the subcutaneous tumor were recorded every 3 days, and the volume of the subcutaneous tumor was calculated according to the formula: (length × width 2 ) / 2. After 5 weeks, the mice were euthanized, and the tumors were removed and weighed ( Figure 3 A).

[0116] The above-mentioned OPA is a small molecule inhibitor of PSMD14, which was purchased from MERCK (CAS No.: 5144-89-8).

[0117] Immunohistochemistry:

[0118] The above four groups of tumors were immunohistochemically stained for Ki67, p-AKT, and p-MTOR, and scored. The antibodies used were:

[0119] Ki67 (27309-1-AP, 1:200, Proteintech), p-AKT (66444-1-Ig, 1:1000, Proteintech), p-mTOR (67778-1-Ig, 1:1000, Proteintech).

[0120] (3) Patient-derived tumor organoid (PDO)

[0121] PDO model preparation:

[0122] 1) We used a sterile brush to mechanically crush fresh, viable human or mouse breast cancer tissue.

[0123] 2) Filter the breast cancer tissue with a 100 μm filter and collect the filtrate.

[0124] 3) Filter the breast cancer tissue in reverse direction using a 40 μm filter and collect the filtrate.

[0125] 4) Centrifuge at 800 rpm / min to obtain the cell sediment, resuspend the cells in a mixture of organoid culture medium and BME in a ratio of 1:3, and seed them in a 96-well plate with 10 μl per well.

[0126] 5) Place the plate in a cell culture incubator at 37 degrees Celsius for 0.5 h and dispense organoid culture medium as needed.

[0127] 6) After the gel solidifies, add 100ul / well of organoid culture medium.

[0128] 7) The cultured tumor cells from three patients were randomly divided into four groups, with the same grouping as (2).

[0129] 8) Take photos after 7 days to detect the activity of the organoids ( Figure 3 A).

[0130] Breast cancer organoid formula: Advanced DF12500 ml, R-spondin 100ng / ml, Noggin 100ng / ml, EGF 50ng / ml, FGF1010ng / ml, FGF210 ng / ml, N-Acegglytene 25mmol / ml, Nicotinamide10mmol / ml, ProstaglandinE21μmol / ml, SB0219010μmol / ml, A8301500nmol / ml, Y2763210μmol / ml, HEPES1X, Glutanmax 1X.

[0131] Organoid Viability Assay:

[0132] CellTiter- 3D is a luminescence detection kit for detecting cell viability in 3D cell culture. The following are detailed steps for its use:

[0133] 1) Reagent preparation: CellTiter- Thaw the 3D reagent overnight at 4°C. Do not place the frozen bottle directly into a water bath to thaw, as this may cause the bottle to crack. Equilibrate the reagent to room temperature in a 22°C water bath before use, which takes approximately 30 minutes. Gently invert the bottle contents to obtain a homogenous solution. Turn on the CellTiter- Be careful when sealing the 3D reagent bottles to avoid introducing ATP contamination.

[0134] 2) Cell culture: Prepare opaque-walled multiwell plates containing microtissues and culture medium. Sample volume and microtissue characteristics (such as size, number, culture days, etc.) should be optimized according to experimental conditions.

[0135] 3) Experimental treatment: Add test compounds to the experimental wells and incubate according to the incubation protocol. Ensure that the volume of sample plus test compound is low enough so that equal volumes of reagents can be added and subsequent mixing can be performed without well-to-well contamination.

[0136] 4) Detection step: Equilibrate the plate and its contents to room temperature (22-25°C) for approximately 30 minutes. Add an equal volume of CellTiter- 3D reagent (96-well plate, add 100 μl of CellTiter- 3D reagent). Mix well contents vigorously for 5 minutes to induce cell lysis. Allow the plate to incubate for an additional 25 minutes at room temperature to stabilize the luminescent signal.

[0137] 5) Record the luminescence signal.

[0138] HE staining and immunohistochemistry:

[0139] HE staining and Ki67 immunohistochemical staining were performed on the above three groups of tumors, and the scores were calculated. The antibodies used were:

[0140] Ki67(27309-1-AP,1:200,Proteintech).

[0141] (4) Results analysis

[0142] The experimental results showed that compared with the subcutaneous tumors of MDA-MB-231 cells infected with sh-NC lentivirus, the subcutaneous tumors of MDA-MB-231 cells infected with sh-PSMD14 lentivirus had significantly reduced tumor volume and weight at 5 weeks ( Figure 2 AC). Among them, Figure 2 B proves that the anti-cancer effect of PSMD14 inhibitor combined with AA / RSL3 is significantly greater than that of using PSMD inhibitor alone, and is also significantly greater than that of using AA / RSL3 alone, proving that the combination of drugs has achieved significant therapeutic effects.

[0143] At week 5, the average tumor volume and weight in the OPA group were smaller than those in the Control group, indicating that OPA can inhibit the growth of breast cancer cells. However, the average tumor volume and weight were further reduced after the addition of arachidonic acid to OPA compared with the OPA group ( Figure 3 BD).

[0144] Microscopy was used to evaluate changes in cells after single and combined treatments in the three patient-derived PDO models. Results showed that in the OPA group, cells lost their normal shape and became shrunken, while in the combined OPA+AA / RSL3 group, condensation and cristae became more pronounced ( Figure 3 G). Similarly, the combination therapy resulted in the most significant reduction in tumor organoid cell viability ( Figure 3 H). In addition, Ki67 immunostaining of PDOs showed that Ki67 expression was significantly reduced in the OPA plus AA / RSL3 group ( Figure 3 IJ). These results indicate that knockdown of PSMD14 significantly inhibited breast tumor cell growth in the presence of AA and RSL3 supplementation.

[0145] The above results suggest that downregulation of PSMD14 expression combined with unsaturated fatty acids inhibits the growth of breast tumor cells, and PSMD14 can be used as a potential target for the treatment of TNBC patients.

[0146] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of a composition in the preparation of a drug for treating breast tumors, characterized in that: The composition comprises a composition of a substance that inhibits the expression of the PSMD14 gene and unsaturated fatty acids. The substance that inhibits the expression of the PSMD14 gene is a substance that reduces the expression amount of the PSMD14 gene by using the specific shRNA of the PSMD14 gene.

2. Use of a composition according to claim 1 in preparing a drug for treating breast tumors, characterized in that: The substance for reducing the expression of PSMD14 gene by using the specific shRNA of PSMD14 gene is shRNA that specifically reduces the expression of PSMD14 gene, or an expression cassette expressing the shRNA, or a recombinant vector containing the expression cassette, or a cell line containing the recombinant vector.

3. Use of a composition according to claim 2 in preparing a drug for treating breast tumors, characterized in that: The nucleotide sequence of the shRNA is shown in SEQ ID NO: 1 and SEQ ID NO: 2, specifically: The PSMD14 shRNA positive strand sequence is: CCGGCTTCGAATCTGGGTCACTTAACTCGAGTTAAGTGACCCAGATTCG AAGTTTTTG; The reverse strand sequence of PSMD14 shRNA is: AATTCAAAAACTTCGAATCTGGGTCACTTAACTCGAGTTAAGTGACCCA GATTCGAAG.

4. Use of a composition according to claim 2 in preparing a drug for treating breast tumors, characterized in that: The vector is a viral vector and / or a plasmid, the viral vector is specifically a lentivirus, and the plasmid is a pLKO.1puro vector.

5. Use of a composition according to claim 3 in preparing a drug for treating breast tumors, characterized in that: The unsaturated fatty acid is arachidonic acid AA.

6. Use of a composition according to claim 5 in preparing a drug for treating breast tumors, characterized in that: The composition also includes a GSH peroxidase 4 inhibitor RSL3. When the substance inhibiting the expression of the PSMD14 gene is a cell infected with the sh-PSMD14 virus, the mass ratio of the sh-PSMD14 virus contained in the composition, the arachidonic acid AA and the RSL3 is 1:3:

3.

7. Use of a composition according to claim 1 in preparing a drug for treating breast tumors, characterized in that: The breast tumor may be triple-negative breast cancer, and the specific types of triple-negative breast cancer cells are MDA-MB-231, BT-549 or HCC1973.

8. Use of the substance for inhibiting PSMD14 gene expression as claimed in claim 1 in preparing unsaturated fatty acids for incubating breast tumor cells.

Images