Application of pdia1 as drug screening target in preparation of medicine for treating ulcerative colitis

Abstract

The application belongs to the technical field of PDIA1, and particularly relates to application of PDIA1 as a drug screening target in preparation of a drug for treating ulcerative colitis. The technical problem to be solved by the application is to provide a new molecular target for recovery of an intestinal epithelial barrier in ulcerative colitis. The expression level of PDIA1 in epithelial cells of ulcerative colitis patients is higher than that of healthy people, and inhibition of PDIA1 can effectively improve the symptoms of ulcerative colitis. The application provides a new idea for further research on the mechanism of recovery of an intestinal epithelial barrier and medical use of PDIA1.

Description

Technical Field

[0001] The present invention relates to PDIA1, and in particular to the application of PDIA1 as a drug screening target in the preparation of drugs for treating ulcerative colitis. Background Art

[0002] The clinical treatment dilemma of ulcerative colitis is the severe lack of therapeutic targets that target epithelial barrier restoration. Ulcerative colitis (UC) is a chronic inflammatory disease occurring in the rectal and colonic mucosa, characterized by complex etiology, frequent relapses, and difficulty in curing. UC patients are reported to occur in all age groups, with no gender difference in incidence. Symptoms of UC include diarrhea, abdominal pain, and rectal bleeding, characterized by relapsing and remission of mucosal inflammation. UC is progressive and destructive, leading to a variety of complications, including strictures, ulcers, fistulas, extraintestinal manifestations, and inflammation-related polyps and cancers. The intestinal barrier is composed of an immune barrier formed by intestinal immune cells, a mechanical barrier formed by intestinal epithelial cells, a chemical barrier primarily composed of mucins in the mucus layer, and a biological barrier formed by the normal intestinal microbiota. Patients with UC exhibit significant alterations in tight junction function, ultrastructure, and protein composition. Clinically, intestinal permeability is a sensitive prognostic indicator for relapse in patients with quiescent disease. Therefore, restoring intestinal barrier function is a strong potential therapeutic target for UC, but currently no clinical treatment has been developed that can effectively protect the intestinal epithelial barrier. Therefore, therapeutic targets targeting epithelial barrier restoration are crucial for the treatment of ulcerative colitis. Summary of the Invention

[0003] Purpose of the invention:

[0004] The technical problem addressed by this invention is to provide a new molecular target for epithelial barrier restoration in ulcerative colitis. PDIA1 is expressed at higher levels in the intestinal epithelial cells of patients with ulcerative colitis than in healthy controls. Inhibiting PDIA1 can effectively improve ulcerative colitis symptoms. This invention provides new insights for further research into the mechanisms of intestinal epithelial barrier restoration and the medical applications of PDIA1.

[0005] The present invention aims to provide the application of PDIA1 in the diagnosis and drug screening of ulcerative colitis, so as to solve the problem of the lack of therapeutic drugs for intestinal epithelial barrier restoration in the existing drugs for treating ulcerative colitis.

[0006] Technical Solution

[0007] The use of PDIA1 as a drug screening target or PDIA1 itself in the preparation of drugs for the treatment of ulcerative colitis.

[0008] Application of PDIA1 in the preparation of diagnostic reagents for ulcerative colitis

[0009] The application is characterized in that the drug is CCF642, an inhibitor of PDIA1.

[0010]

[0011] CCF642

[0012] The application is characterized in that the drug is AAV2-PDIA1.

[0013] Furthermore, the use of the PDIA1 in the preparation of a method for diagnosing ulcerative colitis is characterized in that both the transcription level and the protein expression level of the PDIA1 are increased in the disease state of ulcerative colitis.

[0014] Furthermore, the use of PDIA1 in the preparation of a drug for treating ulcerative colitis is characterized in that the drug is the PDIA1 inhibitor CCF642 and adeno-associated virus; and the nucleic acid molecule is AAV2-PDIA1.

[0015] Furthermore, the use of PDIA1 in the preparation of a drug for treating ulcerative colitis is characterized in that the PDIA1 protein serves as a biomarker for intestinal epithelial barrier destruction. Beneficial effects

[0016] PDIA1, a member of the Protein Disulfide-Isomerase Family A Member 1, is an enzyme in the endoplasmic reticulum (ER) that is primarily involved in protein folding. Its structure contains multiple domains that recognize and catalyze the formation, rearrangement, and cleavage of disulfide bonds between cysteine ​​residues in proteins. As a chaperone protein, PDIA1 also prevents protein misfolding and aggregation during the folding process. It binds to unfolded or partially folded proteins and, by adjusting the state of disulfide bonds, guides them toward the correct folding pathway. Studies have linked PDIA1 to the development and progression of various diseases. In neurodegenerative diseases such as Alzheimer's disease, protein misfolding and aggregation are key pathological hallmarks. Dysfunction of PDIA1 may exacerbate protein misfolding, thereby contributing to disease progression.

[0017] Through analysis of publicly available databases, the present invention discovered and verified that PDIA1 expression is significantly elevated under the pathological conditions of ulcerative colitis. Specifically knocking out PDIA1 in intestinal epithelial cells in mice improves DSS-induced colitis in mice. Overexpressing PDIA1 in the intestinal epithelium using adeno-associated virus (AAV2-PDIA1) exacerbates DSS-induced colitis, resulting in extensive ulceration of the colonic mucosa, widespread loss of crypt architecture, and disruption of tight junctions between intestinal epithelial cells. Using a PDIA1 inhibitor, the present invention ameliorated DSS-induced colitis in mice and could be used to treat ulcerative colitis.

[0018] Specifically, compared with existing technologies, the innovation lies in:

[0019] This study, published in the journal Nature Medicine, demonstrates for the first time that PDIA1 is highly expressed in intestinal epithelial cells in the pathological state of ulcerative colitis. Knockout of PDIA1 ameliorates ulcerative colitis and restores the intestinal epithelial barrier in mice, demonstrating that PDIA1 is a potent potential therapeutic target for restoring intestinal barrier function. Currently, there are no clear target drugs for the clinical treatment of ulcerative colitis; most anti-inflammatory therapies utilize 5-ASA to control inflammation, which fails to restore the intestinal epithelial barrier. The inhibitor provided by this study significantly improves ulcerative colitis symptoms, providing new insights into the pathogenesis of ulcerative colitis and the function of the PDIA1 protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This figure shows the identification of Example 1, which shows that PDIA1 protein levels are significantly elevated during ulcerative colitis disease progression. Figures A and H represent data analysis of scRNA-seq data (SCP259); Figure I shows immunohistochemistry results from pathological sections, demonstrating that PDIA1 protein is highly expressed in intestinal epithelial cells in ulcerative colitis. Figure J shows a DAB mean area statistical plot of the immunohistochemistry results.

[0021] Figure 2 Example 2: PDIA1 is highly expressed in a DSS-induced mouse colitis model, and expression increases with worsening inflammation. A is a flowchart of the experimental design. B is a photograph of intestinal tissue from mice with acute colitis; C shows intestinal length statistics from mice with acute colitis; D is HE staining of mice with acute colitis at different time points; E is immunofluorescence staining of PDIA1 and ZO-1 proteins; F shows immunofluorescence intensity statistics for PDIA1 protein; G is Western blot analysis of the endoplasmic reticulum stress pathway.

[0022] Figure 3This is Example 3, intestinal epithelial knockdown of PDIA1 improves DSS-induced colitis in mice, where A is a flowchart of the experimental design; B is the change in body weight of mice in each group; C is the level of FD4 in serum; D is the statistics of intestinal tissue length in acute colitis model mice; E is a photograph of intestinal tissue in acute colitis model mice; F is HE staining of acute colitis mice in different groups; G is Alcian blue staining; H is Western blot analysis of intestinal epithelial tight junction proteins; I is qRT-PCR detection of mRNA levels of endoplasmic reticulum stress pathways Xbp1 and Atf6.

[0023] Figure 4 Example 4: Enema administration of AAV2 containing PDIA1 significantly exacerbated DSS-induced colitis in mice. Figure A is a flowchart of the experimental design; Figure B shows changes in body weight in each group of mice; Figure C shows serum FD4 levels; Figure D shows serum PDIA1 levels in each experimental group; Figure E shows intestinal tissue images of mice with an acute colitis model; and Figure F shows length statistics.

[0024] Figure 5 Example 5: The PDIA1 inhibitor CCF642 significantly improves DSS-induced colitis in mice. A is a flowchart of the experimental design; B shows the change in body weight of mice in each group; C shows the disease activity index score of mice in each group; D shows the level of FD4 in the serum of mice in each experimental group; E shows photos of intestinal tissue from mice with acute colitis; F shows length statistics; G shows HE staining of mice with acute colitis in different groups; H shows immunohistochemical staining of PDIA1 protein; I shows Western blot analysis of intestinal epithelial tight junction proteins and proteins related to the endoplasmic reticulum stress pathway. DETAILED DESCRIPTION

[0025] The present invention will be further described in detail below with reference to the examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the following examples and experimental examples are conventional means well known to those skilled in the art, and the materials and reagents used can be obtained from commercial sources.

[0026] Example 1: Identification of a significant increase in PDIA1 protein during ulcerative colitis disease progression

[0027] 1. Experimental Methods

[0028] 1.1 Download of scRNA-seq data (SCP259) from intestinal tissues of ulcerative colitis patients and healthy donors

[0029] To investigate whether PDIA1 is altered in UC disease, we analyzed scRNA-seq data of intestinal tissues from UC patients and normal donor HC (SCP259) and performed GO pathway enrichment analysis on genes upregulated in UC patients relative to HC healthy controls.

[0030] 1.2 Immunohistochemistry of UC patient pathological sections

[0031] Intestinal tissue was fixed in 4% paraformaldehyde, dehydrated, and embedded in paraffin. Serial sections (6 μm) were cut and antigen retrieval was performed using sodium citrate. The membrane was permeabilized with 0.2% Triton X-100, blocked with endogenous peroxidase inhibitors, and then blocked with 5% BSA for 1 hour. The sections were then incubated with primary antibodies overnight at 4°C. After overnight incubation with primary antibodies, the sections were washed and incubated with the corresponding secondary antibodies. Finally, DAB was used for color development, and nuclear staining was performed with hematoxylin.

[0032] 2. Experimental Results

[0033] like Figure 1 As shown in AD, we analyzed the scRNA-seq dataset and found that genes involved in the endoplasmic reticulum stress (ER stress) pathway were highly expressed in UC patients compared with the normal control group. We further found that the P4HB gene (encoding PDIA1 protein) involved in regulating the endoplasmic reticulum stress pathway was highly expressed by intersecting with the mouse data ( Figure 1 E), and the P4HB gene is expressed more in intestinal epithelial cells in the inflammatory area of ​​UC patients ( Figure 1 FH), further immunohistochemical staining results showed that PDIA1 was highly expressed in the intestinal epithelial cells of UC patients compared with healthy controls, and the specific difference was significant ( Figure 1 IJ).

[0034] Example 2: PDIA1 is highly expressed in a DSS-induced mouse colitis model, and its expression increases with increasing inflammation

[0035] 1. Experimental Methods

[0036] 1.1 Establishment of a DSS-induced colitis model in mice

[0037] DSS (Dextran Sulfate Sodium) induced colitis model is a commonly used animal model of ulcerative colitis (UC). We used an acute model, healthy adult male C57BL / 6J mice were given 2.5% DSS in drinking water, ensuring the mice could drink freely. After 7 days of 2.5% DSS drinking, the mice were given water for two days. We took samples at different time points (Day 0, Day 3, Day 5, Day 7 and Day 9), and weighed the mice regularly. Weight loss is one of the typical symptoms of colitis.

[0038] 1.2 HE staining experiment

[0039] After the paraffin section of the tissue sample was deparaffinated and hydrated, hematoxylin staining was performed. The section was placed in 1% hydrochloric acid alcohol for differentiation until the nucleus was clearly visible. Then, eosin staining was performed, and finally, dehydration was performed using neutral resin for mounting.

[0040] 1.3 Immunofluorescence experiment

[0041] The paraffin section of the tissue was deparaffinated and hydrated by placing it in xylene for 30 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, 95% ethanol for 5 min, 85% ethanol for 5 min, 75% ethanol for 5 min, and distilled water. Antigen retrieval was performed using citric acid buffer, endogenous peroxidase was blocked using 3% hydrogen peroxide solution, and 3% goat serum was used for room temperature blocking for 30 min. The primary antibody was incubated by adding the diluted primary antibody to the section, and incubated overnight at 4°C. The next day, the secondary antibody was incubated, and the poly-HRP goat anti-mouse / rabbit universal secondary antibody was used as a ready-to-use type (AFIHC001). The concentrated fluorescent dye was mixed with TSA buffer at a ratio of 1:50-1:200, and the prepared TSA fluorescent dye reaction solution was added to the section to evenly cover the tissue. The reaction was performed at room temperature for 1-15 min, DAPI was used for cell nucleus staining, anti-fluorescence quencher was used for mounting, and nail polish was added around the section.

[0042] Experimental results

[0043] As the number of DSS drinking days increased, the colon damage in mice worsened, with severe diarrhea, blood in the stool, and shortened colon. Figure 2 According to the analysis of HE staining results, we found that the colon mucosa was extensively ulcerated, the crypt structure was generally lost, and a large number of inflammatory cells infiltrated at day 5. Figure 2 We found that the expression of ZO-1 protein, a major molecule of tight junction in cell membrane, gradually decreased as inflammation intensified, indicating that the tight junction between intestinal epithelial cells was destroyed. On the contrary, the expression of PDIA1 protein increased in the intestinal epithelial tissue as inflammation intensified. Figure 2 EF). We further extracted proteins from mouse colon tissue for western blot analysis and found that as inflammation intensified, the expression of p-PEKR and IRE1 proteins in the endoplasmic reticulum stress pathway also increased, suggesting that high expression of PDIA1 is related to endoplasmic reticulum stress ( Figure 2 G). The above results indicate that the expression of PDIA1 is positively correlated with the occurrence of colitis.

[0044] Example 3: Knockdown of PDIA1 in the intestinal epithelium improves DSS-induced colitis in mice

[0045] 1. Experimental Methods

[0046] 1.1 Construction of PDIA1 intestinal epithelial cell conditional knockout mice

[0047] We sought to determine the effects of selectively knocking down PDIA1 in intestinal epithelial cells in mice. To investigate whether PDIA1 is essential for intestinal epithelial barrier function in the pathogenesis of UC, we used Vilin-Cre transgenic mice to knock down PDIA1 in intestinal epithelial cells and obtain PDIA1 fl / fl and Vilin-Cre knockdown of PDIA1 fl / fl (Knockdown of PDIA1 chon- / - Adult male mice were used to establish a DSS-induced acute colitis model. The mice were weighed daily and the disease activity index (DAI) score was calculated.

[0048] 1.2 Alcian blue staining experiment

[0049] Alcian blue staining is a staining method used to detect acidic mucopolysaccharides and acidic glycoproteins. We use it to assess the extent of mucosal damage in intestinal tissue. After dewaxing and hydrating paraffin sections of intestinal tissue, the sections are immersed in an Alcian blue staining solution, typically a 1% Alcian blue solution in acetate buffer at pH 2.5. Staining time varies depending on the concentration of the staining solution and the specimen type, but typically ranges from 30 minutes to several hours. Sections are gently rinsed in distilled water to remove unbound dye. Sections are then dehydrated through a series of ethanol concentrations (ranging from 70% to 100%). Dehydrated sections are then treated with xylene to make them transparent. Sections are then mounted using a suitable mounting medium (such as neutral gum).

[0050] 2. Experimental Results

[0051] To validate the role of PDIA1 in the progression of enteritis, we generated mice with conditional PDIA1 knockout in the intestinal epithelium. In a DSS-induced acute enteritis model, data including body weight (Figure 3A-B), colon length (Figure 3D-E), and intestinal permeability (Figure 3C) demonstrated that conditional PDIA1 knockout in the intestinal epithelium significantly ameliorated enteritis symptoms. Further pathological analysis demonstrated that PDIA1 knockout significantly inhibited the progression of enteritis (Figure 3F) and effectively restored the mucus barrier in mice (Figure 3G-H). QPCR results from mouse colonic tissue also demonstrated that wild-type mice exhibited severe epithelial damage after DSS induction, with increased expression of endoplasmic reticulum stress pathway proteins Xbp1 and Atf6, whereas PDIA1 knockout effectively abrogated these impairments.

[0052] Example 4: Enema of PDIA1-expressing AAV2 significantly exacerbated DSS-induced colitis in mice

[0053] 1. Experimental Methods

[0054] Adeno-associated virus (AAV2) overexpressing PDIA1 in mice by intraperitoneal enema

[0055] To determine whether overexpression of PDIA1 exacerbates DSS-induced colitis in mice, we used recombinant AAV2-PDIA1 (pcAAV-CMV-P4hb-HA-P2A-GdGreen-WPRE, where P4hb is the gene name for PDIA1) for in vivo overexpression of PDIA1 via rectal enema. AAV2-PDIA1 was purchased from Obio Technology (Shanghai) Corp., Ltd (China).

[0056] The preparation method of AAV2-PDIA1 is as follows:

[0057] During the preparation process, the PDIA1 gene

[0058] (atgctg cgccgcgctc tgctgtgcct ggccgtggcc gccctggtgc gcgccgacgccccgaggag gaggaccacg tcctggtgct gcggaaaagc aacttcgcgg aggcgctggc ggcccacaagtacctgctggt tgccccttgg tgtggccact gcaaggctct ggcccctgag tatgccaaagccgctgggaa gctgaaggca gaaggttccg agatcaggtt ggccaaggtg gacgccacgg aggagtctgacctggcccag cagtagcggc tgcgcggcta tcccaccatc aagttcttca ggaatggaga cacggctcccccaaggaat atacagctgg cagagaggct gatgacatcg tgaactggct gagaagcgc acgggcccggctgccaccac cctgcctgac ggcgcagctg cagagtcctt ggtggagtcc agcgaggtgg ctgtcatcggctcttcaag gacgtggagt cggactctgc caagcagttt ttgcaggcag cagaggccat cgatgacataccatttggga tcacttccaa cagtgacgtg ttctccaaat accagctcga caaagatggg gttgtcctctttaagaagtt tgatgaaggc cggaacaact ttgaagggga ggtcaccaag gagaacctgc tggactttatcaaacacaac caccccgctg ttgtcatcga gttcaccgag cagacagccc cgaagattt tggaggtgaaatcaagactc acatcctgct gttcttgccc aagagtgtgt ctgactatga cggcaaactg agcaacttcaaaacagcagc cgagagcttc aagggcaaga tcctgttcat cttcatcgac agcgaccaca ccgacaaccagcgcatcctc gagttctttggcctgaagaa ggaagagtgc ccggccgtgc gcctcatcac cctggaggaggagatgacca agtacaagcc cgaatcggag gagctgacgg cagagaggat cacagagttc tgccaccgcttcctggaggg caaaatcaag ccccacctga tgagccagga gctgccggag gactgggaca agcagcctgtcaaggtgctt gttgggaaga actttgaaga cgtggctttt gatgagaaaa aaaacgtctt tgtggagttctatgccccat ggtgtggtca ctgcaaacag ttggctccca tttgggataa actgggagag acgtacaaggaccatgagaa catcgtcatc gccaagatgg actcgactgc caacgaggtg gaggccgtca The recombinant protein aagtgcacagcttccccaca ctcaagttct ttcctgccag tgccgacagg acggtcattg attacaacgg ggaacgcacgctggatggtt ttaagaaatt cctggagagc ggtggccagg atggggcagg ggatgatgac gatctcgaggacctggaaga agcagaggag ccagacatgg aggaagacga tgatcagaa gctgtgaaag atgaactgtaa (see SEQ ID NO.1) was cloned into the vector H36160 pcAAV-CMV-P4hb-HA-P2A-GdGreen-WPRE. The recombinant expression plasmid and pHelper (carrying adenovirus-derived genes) and pAAV-RC (carrying AAV replication and capsid genes) were co-transfected into AAV-293 cells (providing the trans-acting factors required for AAV replication and packaging). 2-3 days after transfection, recombinant AAV is assembled in the packaging cells. After harvesting, the cells are lysed and the AAV particles are released into the supernatant for recovery. The viral supernatant is then concentrated and purified by density gradient centrifugation and ultrafiltration, and the viral titer is determined by quantitative PCR. We administered 100 μL (1.0E+12 v.g. / ml AAV) to the intestinal lumen of C57BL / 6 wild-type (WT) mice by enema. Adeno-associated virus 2 (AAV2-) expressing PDIA1 in intestinal epithelial cells was expressed in 100 μL of AAV.PDIA1) or control AAV2 (AAV2-NC).

[0059] 2. Experimental results

[0060] In DSS-induced acute colitis model, the data of mice's body weight (Fig. 4A-B), colon length (Fig. 4D-E) and intestinal permeability (Fig. 4C) showed that overexpression of PDIA1 in intestinal epithelium could exacerbate the intestinal inflammation of mice. And the serum ELISA experiment of mice proved our success of overexpressing PDIA1 (Fig. 4F).

[0061] Example 5: Inhibitor of PDIA1 CCF642 can significantly improve DSS-induced colitis in mice

[0062] 1. Experimental methods

[0063] Detection of intestinal permeability of mice

[0064] Detection of intestinal permeability Before the end of the DSS model experiment, the mice were fasted and watered for 4 h, then 200 μL of 60 mg / mL FITC-dextran (600 mg / kg) was given by gavage, and 4 h later, the orbital venous blood was collected. The content of FITC-dextran in serum was determined by fluorescence microplate reader (Ex: 485 nm, Em: 535 nm).

[0065] 2. Experimental results

[0066] We used pharmacological inhibition method to explore the role of PDIA1 in DSS-induced colitis model by intraperitoneal injection of PDIA1 inhibitor CCF642 (purchased from Selleck) (Fig. 5A). Through the body weight and disease activity index (DAI) of mice, we found that the mice in the PDIA1 inhibitor CCF642 administration group had smaller body weight loss, lower DAI, and showed a dose-dependent manner (Fig. 5B-C). Intestinal barrier permeability experiment showed that inhibition of PDIA1 could reduce the permeability of DSS-induced mouse colon (Fig. 5D). The colon length of mice in the administration group was smaller and the colon length was longer compared with the model group (Fig. 5E-F). Further, H&E staining of pathological sections showed that the tissue damage in the administration group was low, and the morphology of the colon epithelial cells was complete and clear (Fig. 5G). Immunohistochemical staining results showed that PDIA1 was highly expressed in the DSS model group, and decreased after administration treatment (Fig. 5H). Figure 5 B-C). Intestinal barrier permeability experiment showed that inhibition of PDIA1 could reduce the permeability of DSS-induced mouse colon ( Figure 5 D). The colon length of mice in the administration group was smaller and the colon length was longer compared with the model group ( Figure 5 E-F). Further, H&E staining of pathological sections showed that the tissue damage in the administration group was low, and the morphology of the colon epithelial cells was complete and clear ( Figure 5 G). Immunohistochemical staining results showed that PDIA1 was highly expressed in the DSS model group, and decreased after administration treatment ( Figure 5H). The mouse colon tissue was taken, and the protein was extracted for Western blot detection. The results showed that the expression of ZO-1 and E-cadherin proteins in the colon of the DSS group mice was reduced, and it was restored after administration. At the same time, the p-PEKR and IRE1 proteins of the endoplasmic reticulum stress pathway were detected, and it was found that the expression increased in the model group, and the protein decreased after administration Figure 5 I). The above results show that in DSS-induced enteritis, PDIA1 has the function of destroying the intestinal barrier, and inhibiting PDIA1 can effectively alleviate the destruction of the intestinal barrier.

Claims

1. Application of a PDIA1 protein inhibitor in the preparation of a drug for treating ulcerative colitis, wherein the PDIA1 protein inhibitor is CCF642 CCF642.

Images