Targeted enhanced copper death-immunomodulator as well as preparation method and application thereof

Abstract

The invention discloses a targeted enhanced copper death-immunomodulator and a preparation method and application thereof, and belongs to the technical field of medical materials.The targeted enhanced copper death-immunomodulator comprises a polydopamine nanoparticle (PDA) substrate and a CuO2 nano-dot compounded CuO2 PDA nano-composite, the CuO2 PDA nano-composite is wrapped with a cell membrane, and the cell membrane is coated with a polydopamine nano-particle (PDA) substrate and a polydopamine nano-particle (PDA) nano-dot. According to the invention, a targeting ligand of a programmed cell death ligand-1 (Program Cell Death Ligand 1, PD-L1) is grafted on a cell membrane, and the targeting ligand of the Program Cell Death Ligand 1 (PD-L1) is grafted on the cell membrane. The regulator can be efficiently accumulated to a tumor site in a targeted manner, on one hand, the regulator can produce H2O2 in situ in a tumor, the intracellular oxidation-reduction balance is broken, the yield of active oxygen in the tumor is enhanced, and then tumor cell copper death is enhanced; on the other hand, the regulator can durably reduce the abundance of PD-L1 on the surfaces of tumor cells, and finally the purpose of multi-path combined efficient tumor immunotherapy is achieved.

Description

Technical Field

[0001] The present invention belongs to the technical field of medical materials, and in particular relates to a targeted enhanced copper death-immunomodulator and a preparation method and application thereof. Background Art

[0002] Copper death is a newly discovered regulated cell death mode. The main mechanism involves the binding of excessive intracellular copper ions to acylated proteins in the mitochondrial tricarboxylic acid cycle, which subsequently leads to abnormal oligomerization of dihydrolipoamide S-acetyltransferase (DLAT) and loss of iron-sulfur cluster proteins, thereby inducing protein toxic stress and triggering programmed cell death. This special cell death mode provides opportunities for tumor treatment. On the one hand, compared with some traditional tumor treatment methods, the copper death pathway of tumor cells can improve the drug resistance of tumor cells, help overcome the limitations of traditional treatment methods, and improve the treatment effect; on the other hand, copper death of tumor cells will promote the externalization of calreticulin, release active ingredients such as high-mobility group protein B1 and tumor-associated antigens, thereby activating the body's anti-tumor immune response. Therefore, copper death-immune cascade therapy has become a new type of combined tumor treatment.

[0003] Currently, there are many copper ion carriers used to study copper death, such as ilisimol, which is a mitochondrial targeted drug for the treatment of solid tumors. It is a highly efficient copper ion carrier that allows copper ions to specifically bind to ferredoxin 1 (FDX1) to induce copper death. In addition, there are also studies using MOF to carry copper ions and glucose oxidase to induce copper death in tumor cells, but these drugs still have the disadvantages of safety or single action. Due to its unique chemical reactivity, degradability and high biocompatibility, CuO2 nanodots (NDs) have attracted great attention from researchers: (1) In the acidic environment of tumor tissue, CuO2 NDs bind to H + Reaction occurs, releasing Cu 2+ ;Cu 2+ Reacting with intracellular GSH can disrupt the intratumoral redox homeostasis and form Cu that is more suitable for DLAT binding + , which helps to enhance the copper death effect of tumors. (2) CuO2 NDs and H + The reaction produces H2O2, Cu + It reacts with sufficient H2O2 to generate hydroxyl radicals, which produce cytotoxicity and kill tumor cells. The results show that the introduction of CuO2 NDs into nanomedicines greatly improves the efficacy of chemotherapy, photothermal therapy, chemodynamic therapy (CDT), etc. (3) CuO2 NDs reacts with H2O2 to generate hydroxyl radicals, which produce cytotoxicity and kill tumor cells. +During the reaction, it decomposes into Cu 2+ , which is easily excreted by the organism, avoiding the toxicity caused by the aggregation of CuO2 NDs in the body, and showing excellent biocompatibility. In addition, CuO2 NDs have significant advantages such as simple and rapid synthesis, cheap raw materials, large specific surface area, and easy to be combined with other nanomaterials. However, the activity of CuO2 NDs is relatively large, and its stability needs to be further improved through modification to enhance its stability in the circulatory system.

[0004] On the other hand, tumor cells upregulate the expression of cytokines such as transforming growth factor-β, interleukin-10, and PD-L1, interact with tumor-associated macrophages, myeloid-derived immunosuppressive cells, etc., to form an immunosuppressive microenvironment, thereby allowing the tumor to escape immune surveillance and the killing effect of cytotoxic T lymphocytes, weakening the anti-tumor effect of the copper death-immune cascade. At present, some strategies have been proposed to improve the efficiency of treatment and reduce toxic side effects. For example, the use of combined PD-L1 monoclonal antibodies to block PD-L1 on the surface of tumor cell membranes can achieve combined treatment of copper death and immune checkpoint blockade (ICB) therapy to improve the survival of mice. Although PD-L1 monoclonal antibodies have achieved certain clinical effects in a variety of malignant tumors, most patients respond poorly to this treatment and it is difficult to achieve lasting ICB. In addition to the fast metabolism and clearance of monoclonal antibody drugs and the short blocking time, studies have found that PD-L1 blockade caused by monoclonal antibodies is more likely to return to the cell membrane through the early endosome-recycling endosome pathway after the antibody dissociates from it, and continue to inhibit the function of T cells and prevent them from recognizing and killing tumor cells. In addition, the binding of PD-L1 to PD1 plays an important role in the differentiation and apoptosis of T cells, limiting the efficacy of ICB. In addition, considering the cost factor of monoclonal antibodies, it is urgent to develop new methods to achieve efficient and lasting blocking of PD-L1, improve the efficiency of ICB treatment, and increase the response rate of patients. Protein targeted degradation technology provides a new research idea for solving the above problems. At present, the multivalent binding of functionalized nanoparticles to specific receptors on the cell surface has been shown to be able to localize to lysosomes through the cell's endocytosis mechanism and subcellular level transport, so that cell surface proteins are degraded. Various polymer nanoparticles have been used to promote the lysosomal degradation of PD-L1 through multivalent binding due to their easy modification characteristics, preventing its recycling and cell membrane surface recycling. However, these methods have not been able to activate the body's anti-tumor immune response at the same time.

[0005] In response to the above challenges, from the perspective of targeted delivery of CuO2 nanodots and realization of ICB to improve the effect of tumor immunotherapy, constructing a functional bionic nanosystem for efficient copper death-immune cascade therapy of tumors is of great significance for tumor treatment and has become a problem that needs to be urgently solved by technicians in this field. Summary of the invention

[0006] In view of the above-mentioned deficiencies in the prior art, the present invention provides a targeted enhanced copper death-immunomodulator and a preparation method and application thereof. The modulator can efficiently and targetedly accumulate at the tumor site. On the one hand, the modulator self-produces H2O2 in situ in the tumor, consumes glutathione GSH, enhances the production of reactive oxygen species inside the tumor to induce CDT, and thereby enhances the copper death of tumor cells; on the other hand, the modulator can persistently reduce the abundance of PD-L1 in tumor cells, ultimately achieving the purpose of efficient tumor immunotherapy.

[0007] To achieve the above purpose, the technical solution adopted by the present invention to solve the technical problem is:

[0008] A targeted enhanced copper death-immunomodulator, comprising a CuO2@PDA nanocomposite composed of a PDA substrate and CuO2 nanodots, wherein the CuO2@PDA nanocomposite is coated with a functionalized cell membrane on the outside, and a PD-L1 targeting ligand is grafted onto the functionalized cell membrane.

[0009] Furthermore, the particle size of the PDA substrate in the CuO2@PDA nanocomposite is 80-200 nm, and the particle size of CuO2 is 2-10 nm.

[0010] Furthermore, the PD-L1 targeting ligand is a PD-L1 antibody, a PD-L1 targeting peptide and a PD-L1 targeting aptamer; the PD-L1 targeting ligand is modified with a lipophilic group.

[0011] Furthermore, the PD-L1 targeting ligand is a PD-L1 targeting aptamer, whose sequence is: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and the lipophilic group is modified at the 3' end of the sequence; the lipophilic group is cholesterol or a phospholipid-PEG copolymer, and the phospholipid is 1,2-distearoyl-sn-glycerol-3-phosphatidylethanolamine (DSPE) or 1,2-dioleoyl-SN-glycero-3-phosphatidylethanolamine (DOPE).

[0012] The preparation method of the above-mentioned targeted enhanced copper death-immunomodulator specifically comprises the following steps:

[0013] (1) PDA solution was added dropwise to a solution containing PVP (molecular weight 24000) and copper salt, and after mixing, an alkaline solution was added thereto to adjust the pH value to a weak alkaline state, and then H2O2 solution was added thereto, and the mixture was stirred for reaction to obtain a CuO2@PDA nanocomposite;

[0014] (2) adding cell membrane to the CuO2@PDA nanocomposite, ultrasonically treating it in a water bath, and then incubating it statically to obtain the cell membrane-wrapped CuO2@PDA nanocomposite;

[0015] (3) Adding PD-L1 targeting ligand to the CuO2@PDA nanocomplex wrapped in the cell membrane, mixing and incubating to obtain a novel nanocomposite.

[0016] Furthermore, in step (1), Cu 2+ The mass ratio of PDA is 0.75-4:1, Cu 2+ :PVP molar ratio 1:0.2-2, Cu 2+ :H2O2 molar ratio 1:5-25, Cu 2+ :OH - The molar ratio is 1:0.5-2.5.

[0017] Furthermore, Cu 2+ :H2O2:OH - : The molar ratio of PVP is 1:20:2:0.4.

[0018] Furthermore, in step (1), the copper salt solution is CuCl2 solution, CuSO4 solution or Cu(NO3)2 solution; the alkaline solution is NaOH solution or KOH solution; and the pH value of the mixed solution is 7.2-7.5.

[0019] Furthermore, in step (2), the mass ratio of the CuO2@PDA nanocomposite to the cell membrane is 1:1-6; the power of the ultrasonic water bath is 120-240W, the static incubation temperature is 25-37°C, and the incubation time is 1-3h.

[0020] Furthermore, the cell membrane in step (2) is a red blood cell membrane.

[0021] Furthermore, in step (3), the molar ratio of the cell membrane-wrapped CuO2@PDA nanocomplex to the PD-L1 targeting ligand is 1:500-3000; and the incubation time is 1-3 h.

[0022] The above-mentioned targeted enhanced copper death-immunomodulator is used in the treatment of solid tumors; solid tumors include skin cancer, malignant melanoma, nasopharyngeal cancer, esophageal cancer, gastric cancer, liver cancer, breast cancer, laryngeal cancer, thyroid cancer, tongue cancer, prostate cancer, penile cancer, testicular tumor, vaginal malignancy, and vulvar malignancy.

[0023] The beneficial effects produced by the present invention are:

[0024] 1. The targeted enhanced copper death-immunomodulator of the present invention comprises three parts: a CuO2@PDA nanocomposite with polydopamine PDA as a carrier, an erythrocyte membrane and a targeting ligand, wherein the targeting ligand is a PD-L1 antibody, a PD-L1 targeting peptide and a PD-L1 targeting aptamer, which bind to the PD-L1 ligand on the surface of tumor cells; the particle size of PDA as a carrier in the CuO2@PDA nanocomposite is 80nm-200nm, and its surface groups are mainly composed of phenol groups and amine groups in dopamine molecules, which can be functionalized, that is, small-sized CuO2 nanodots (2-10nm) can be grown in situ on its surface;

[0025] The CuO2@PDA nanocomposite with PDA as the carrier is formed by the coordination of copper ions with the phenolic group -OH on the surface of dopamine and the oxidation of H2O2 under alkaline conditions to form the CuO2@PDA nanocomposite, referred to as CuD. PDA is used as the carrier in CuD, which makes the fixation effect of CuO2 better, the overall structure of the nanocomposite more stable, and the accumulation in the tumor is increased, thereby improving the targeting effect.

[0026] Coating the red blood cell membrane on the surface of CuD can improve the stability of the particle and enable it to achieve a long circulation effect in vivo; the coated red blood cell membrane is functionalized by targeting ligands, so that it can specifically recognize and bind to PD-L1 on the surface of tumor cells, and further through receptor-mediated endocytosis, the ligand and AMCuD complex is transported into the lysosome, degrades PD-L1 through the lysosome-autophagy pathway, blocks the subcellular circulation of PD-L1, reduces the abundance of PD-L1 on the cell membrane, and relieves the immunosuppressive effect mediated by the PD-1 / PD-L1 signaling axis, thereby enhancing the effect of tumor cells being recognized and killed by cytotoxic T cells;

[0027] 2. The targeted enhanced copper death-immunomodulator (AMCuD) in the present invention also has the function of responsive in situ self-production of H2O2 in tumor cells, and enhances the ability of copper death through chemical dynamic reaction. Specifically, the CuO2 nanodots in AMCuD produce H2O2 in the acidic environment of lysosomes, releasing Cu 2+ , further, PDA and Cu 2+ Both react with the intracellular reducing substance glutathione GSH, destroying the oxidative stress homeostasis of tumor cells and leading to an increase in the intracellular oxidative stress level; at the same time, Cu + It binds to lipoyl proteins related to the mitochondrial tricarboxylic acid cycle in cells, causing the loss of iron-sulfur cluster proteins and the oligomerization of dihydrolipamide S-acetyltransferase DLAT, thereby causing mitochondrial proteotoxic stress and leading to copper death of tumor cells.

[0028] 3. AMCuD in the present invention can be directly injected into the tumor or administered intravenously, and has the effect of treating solid tumors on the surface or inside various organs and inhibiting their metastasis. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The UV-visible absorption spectrum and DLS result diagram of CuO2@PDA nanocomposite, wherein A is the UV-visible absorption spectrum diagram of PDA and CuD (300-900nm), B is the hydrated particle size diagram, and C is the Zeta potential diagram;

[0030] Figure 2 Transmission electron microscopy (TEM) characterization results, MAPPING results and XPS results of CuD, where A and B are TEM results of CuD, C is the element distribution MAPPING result, and D is the XPS result;

[0031] Figure 3 It is the structural schematic diagram of AMCuD;

[0032] Figure 4 The UV-visible absorption spectrum, DLS results, TEM characterization and MAPPING results of AMCuD, where A is the hydrated particle size diagram of PDA, CuD and AMCuD, B is the Zeta potential diagram, C is the UV-visible absorption spectrum diagram (300-900nm); D is the TEM image of AMCuD, and E is the elemental MAPPING results diagram;

[0033] Figure 5 Figures 1 and 2 show the release of Cu, self-production of H2O2, consumption of GSH and detection results of active oxygen of AMCuD under acidic conditions, wherein A shows the Cu release results of AMCuD under pH 5.5 and 7.4, B shows the production of hydrogen peroxide verified by potassium permanganate fading experiment, C shows the consumption of GSH by PDA, CuD and AMCuD over time, D shows the results of MB fading experiment detecting CuD, AMCuD and the production of hydroxyl radicals by Cu-Fenton at different concentrations of AMCuD, E shows the stability detection of AMCuD in PBS and 10% FBS culture medium; F shows the peroxide stability detection of CuD and AMCuD in PBS at pH 7.4;

[0034] Figure 6The figures are the results of AMCuD targeted endocytosis, targeted binding to cell membrane surface PD-L1 and lysosomal degradation of cell PD-L1, among which A is the result of flow cytometry detection of endocytosis of AMCuD and its control group particles, B is the result of Apt-PDL1-FAM specific targeting of PD-L1 on the surface of 4T1 cells, C is the result of AMCuD binding to PD-L1 on the cell membrane surface and entering the intracellular lysosome, and D is the result of AMCuD-mediated long-term downregulation of PD-L1 on the surface of 4T1 cells;

[0035] Figure 7 Figure 1 is a graph showing the in vitro cytotoxicity of AMCuD, the accumulation of intracellular copper, the generation of ROS, and the enhanced chemodynamic therapy effect; wherein, A is a graph showing the effect of different concentrations of AMCuD on the survival rate of 4T1 cells, B is a graph showing the effect of different particles on the survival rate of 4T1 cells (PDA = 80 μg / mL), C is a graph showing the content of Cu in 4T1 cells after AMCuD and its control group particles were incubated with 4T1 for 12 hours, D is a graph showing the results of the DCFH-DA staining experiment after AMCuD and its control group particles were incubated with 4T1 for 6 hours, and E is a graph showing the experimental results of inducing cell apoptosis after AMCuD and its control group particles were incubated with 4T1 for 12 hours;

[0036] Figure 8 The figure is a diagram of the anticancer effect of AMCuD in inducing copper death in vitro; A is the result of JC-1 staining experiment, B is the biological electron microscope image, C is the result of mitochondrial morphology and DLAT immunofluorescence staining experiment, and D is the result of western blot experiment;

[0037] Fig. 9 The in vivo fluorescence imaging results of AMCuD are shown in Figure 1, where A is the fluorescence imaging of AMCuD and its control group particles in 4T1 tumor-bearing mice, B is the in vitro organ imaging, and C is the fluorescence statistical result diagram;

[0038] Fig.10 PD-L1 immunofluorescence staining images of tumor sections of AMCuD and control group mice;

[0039] Fig.11 The figures are the results of AMCuD anti-tumor effect and immunofluorescence staining of tissue sections inducing copper death of tumors in vivo, among which A is the growth curve of tumor volume of mice in different treatment groups, B is the statistical graph of in vitro tumor tissue weight, C is the western blot result of tumor tissue of mice in different treatment groups, and D is the immunofluorescence staining of tumor tissue sections;

[0040] Fig.12The results of AMCuD in vivo copper death activating immunogenic cell death combined with long-term ICB therapy to reshape the tumor immunosuppressive microenvironment, among which A is the immunofluorescence staining of tumor tissue sections of mice in different treatment groups, B is the flow cytometry results of DC cell maturation in lymph nodes of mice in different treatment groups, C is the statistical results, and D is the CD8 + The statistical chart of the percentage of T cells, E is the CD4 + CD8 + The flow cytometry results of T cells, F is the statistical chart of the percentage results, G is the CD8 + The result diagram of the ratio of the number of T cells to Treg cells;

[0041] Fig.13 The figures are the results of AMCuD's anti-tumor recurrence and tumor lung metastasis, and prolonged survival, among which, A is a schematic diagram of the establishment and treatment of the mouse 4T1 tumor re-challenge model, B is a statistical graph of the survival of mice in different treatment groups, C is a graph of the differentiation of memory T cells in the spleen of mice in different treatment groups, D is a statistical graph of the proportion of central memory T cells and effector memory T cells, E is a Bonn reagent staining image of the lungs of mice in different treatment groups after death and a HE staining result graph of lung tissue sections, and F is a graph of the tumor growth curves of mice in different treatment groups. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention, that is, the embodiments described are only part of the embodiments of the present invention, rather than all of the embodiments.

[0043] Therefore, the following detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without making creative work are within the scope of protection of the present invention.

[0044] It should be noted that relational terms such as "first" and "second" are used only to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprises" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, an element defined by the sentence "comprises a ..." does not exclude the existence of other identical elements in the process, method, article or device including the element.

[0045] The features and performance of the present invention are further described in detail below in conjunction with the embodiments and drawings.

[0046] Example 1

[0047] A targeted enhanced copper death-immunomodulator, the preparation method of which comprises the following steps:

[0048] (1) 0.4 mL of 5 mg / mL polydopamine nanoparticle solution was dropwise added with 5 mL of CuCl2 solution (CuCl2 concentration was 0.01 M) containing 0.5 g PVP under magnetic stirring conditions, and after mixing, 5 mL of 0.02 M NaOH solution was added thereto to adjust the pH value of the solution to 7.4, and then 100 μL of 30% H2O2 solution was added thereto, and the mixture was stirred for 30 min, and then centrifuged at 12000 rpm for 20 min, the supernatant was discarded, the precipitate was washed with water, and then 2 mL of deionized water was added to obtain a CuO2@PDA nanocomposite solution, referred to as CuD solution;

[0049] (2) 0.5 mL of 1 mg / mL CuD solution and 1 mg of red blood cell membrane (RBCm) were added to a 1.5 mL centrifuge tube and mixed by blowing. The mixture was coated by ultrasound (180 W) for 2 min under ice bath conditions. After ultrasound, the mixture was incubated at 37 °C for 2 h to promote the fusion of the cell membrane on the CuD surface. After incubation, the mixture was centrifuged at high speed (12000 rpm, 5 min), the supernatant was discarded, and the mixture was washed three times to remove the unbound RBCm. 0.5 mL of deionized water was added to the fixed volume to obtain a CuO2@PDA nanocomplex solution coated with red blood cell membrane, referred to as MCuD solution.

[0050] (3) Take 0.5 mL of MCuD solution (1 mg / mL), add 0.5 mL of PD-L1 aptamer (Apt-PDL1) solution, mix well by pipetting, and incubate at 37°C for 2 h. After the reaction is completed, high-speed centrifugation (12000 rpm, 5 min) is performed and the supernatant is discarded. The supernatant is washed three times to remove unbound Apt-PDL1, and then 0.5 mL of deionized water is added to the fixed volume to obtain a targeted enhanced copper death-immunomodulator solution, referred to as AMCuD.

[0051] Example 2

[0052] A targeted enhanced copper death-immunomodulator, the preparation method of which has a different ratio from that of implementation 1, comprises the following steps:

[0053] (1) 0.2 mL of 5 mg / mL polydopamine nanoparticle solution was dropwise added with 5 mL of CuCl2 solution (CuCl2 concentration was 0.01 M) containing 0.5 g PVP under magnetic stirring conditions, and after mixing, 2.5 mL of 0.02 M NaOH solution was added thereto to adjust the pH value of the solution to 7.2, and then 125 μL of 30% H2O2 solution was added thereto, and the mixture was stirred for 30 min, and then centrifuged at 12000 rpm for 20 min, the supernatant was discarded, the precipitate was washed with water, and then 2 mL of deionized water was added to obtain a CuO2@PDA nanocomposite solution, referred to as CuD solution;

[0054] (2) 0.5 mL of 1 mg / mL CuD solution and 0.5 mg of red blood cell membrane (RBCm) were added to a 1.5 mL centrifuge tube and mixed by blowing. The mixture was coated by ultrasound (120 W) for 2 min under ice bath conditions. After ultrasound, the mixture was incubated at 37 °C for 2 h to promote the fusion of the cell membrane on the CuD surface. After incubation, the mixture was centrifuged at high speed (12000 rpm, 5 min), the supernatant was discarded, and the mixture was washed three times to remove the unbound RBCm. 0.5 mL of deionized water was added to the fixed volume to obtain a CuO2@PDA nanocomplex solution coated with red blood cell membrane, referred to as MCuD solution.

[0055] (3) Take 0.5 mL of MCuD solution (1 mg / mL), add 0.25 mL of PD-L1 aptamer (Apt-PDL1) solution, mix well by pipetting, and incubate at 37°C for 2 h. After the reaction is completed, high-speed centrifugation (12000 rpm, 5 min) is performed and the supernatant is discarded. The supernatant is washed three times to remove unbound Apt-PDL1, and then 0.5 mL of deionized water is added to the fixed volume to obtain a targeted enhanced copper death-immunomodulator solution, referred to as AMCuD.

[0056] Example 3

[0057] A targeted enhanced copper death-immunomodulator, the preparation method of which is different in proportion from that of Example 1 and Example 2, comprises the following steps:

[0058] (1) 5 mL of CuCl2 solution (CuCl2 concentration of 0.01 M) containing 0.5 g of PVP was added dropwise to 0.8 mL of 5 mg / mL polydopamine nanoparticle solution under magnetic stirring, and 7.5 mL of 0.02 M NaOH solution was added thereto after mixing, and the pH value of the solution was adjusted to 7.5. Then, 100 μL of 30% H2O2 solution was added thereto, and the mixture was stirred for 30 min, and then centrifuged at 12000 rpm for 20 min, the supernatant was discarded, the precipitate was washed with water, and then 2 mL of deionized water was added to obtain a CuO2@PDA nanocomposite solution, referred to as CuD solution;

[0059] (2) 0.5 mL of 1 mg / mL CuD solution and 1.5 mg of red blood cell membrane (RBCm) were added to a 1.5 mL centrifuge tube and mixed by blowing. The mixture was coated by ultrasound (240 W) for 2 min under ice bath conditions. After ultrasound, the mixture was incubated at 37 °C for 2 h to promote the fusion of the cell membrane on the CuD surface. After incubation, the mixture was centrifuged at high speed (12000 rpm, 5 min), the supernatant was discarded, and the mixture was washed three times to remove the unbound RBCm. 0.5 mL of deionized water was added to the fixed volume to obtain a CuO2@PDA nanocomplex solution coated with red blood cell membrane, referred to as MCuD solution.

[0060] (3) Take 0.5 mL of MCuD solution (1 mg / mL), add 0.75 mL of PD-L1 aptamer (Apt-PDL1) solution, mix well by pipetting, and incubate at 37°C for 2 h. After the reaction is completed, high-speed centrifugation (12000 rpm, 5 min) is performed and the supernatant is discarded. The supernatant is washed three times to remove unbound Apt-PDL1, and then 0.5 mL of deionized water is added to the fixed volume to obtain a targeted enhanced copper death-immunomodulator solution, referred to as AMCuD.

[0061] Test example

[0062] 1. Testing the materials prepared in each step of Example 1

[0063] The CuD nanocomposite prepared in step (1) was tested as follows:

[0064] 1. UV-visible absorption spectrum detection and Zeta potential detection, the results are shown in Figure 1 .in, Figure 1 A is the UV-visible absorption spectrum test result, Figure 1B is the DLS particle size test result. Figure 1 C is the Zeta potential test result;

[0065] Depend on Figure 1 A shows that CuD has the UV-visible absorption peak (350-450nm) of CuO2 nanodots; Figure 1 B shows that the particle size of CuD has slightly increased; Figure 1 C shows that the Zeta potential of CuD increases from -12.4mV of PDA to +6.8mV.

[0066] 2. Transmission electron microscopy characterization

[0067] Characterized by transmission electron microscopy, such as Figure 2 (AC) shown, where Figure 2 (A) is the transmission electron microscopy (TEM) characterization image of CuD; (B) is the high-resolution TEM image of CuD; (C) is the mapping element distribution result of CuD.

[0068] Depend on Figure 2 A and B show that obvious black nanoparticles (metal) appear in the high-resolution TEM image of CuD. Further analysis of the mapping element distribution map ( Figure 2 C) It proves that the C element, Cu element, and O element are evenly distributed on CuD and there is almost no free state, which proves the successful synthesis of CuD copper-based nanocomposites.

[0069] 3. X-ray photoelectron spectroscopy characterization

[0070] The valence states of Cu and O in CuD were characterized by X-ray photoelectron spectroscopy (XPS). Figure 2 As shown in (D), the O1s peak of CuO2 in the X-ray photoelectron spectroscopy of CuD is located at 532.5 eV and is assigned to OO, indicating the presence of peroxide groups. In addition, the valence state of Cu in CuO2 is divalent, and the XPS spectrum of Cu 2p shows two main peaks at 932.5 and 952.7 eV, and two satellite peaks at 941.9 eV and 961.8 eV, respectively. The XPS results prove the synthesis of CuO2.

[0071] The schematic diagram of the preparation process of AMCuD in Example 1 is as follows Figure 3 shown.

[0072] The AMCuD was synthesized and characterized by UV-visible absorption spectroscopy, fluorescence spectroscopy and particle size analyzer. Figure 4; Among them, (A) is the statistical diagram of the hydrated particle size of each nanosystem; (B) is the Zeta potential diagram of each nanosystem; (C) is the UV-visible absorption spectrum diagram of each nanosystem; (D) is the TEM diagram of AMCuD; (E) is the Mapping element distribution diagram;

[0073] like Figure 4 As shown in A, the results of the Malvern particle size analyzer showed that the hydrated particle size of AMCuD increased from 178nm of CuD to 192nm; the Zeta potential of PDA, CuD, and AMCuD ( Figure 4 B), it was found that after the red blood cell membrane was coated, the Zeta potential was further reduced to -12mV; TEM image of AMCuD ( Figure 4 D) showed obvious cell membrane structure; further through high-resolution TEMMapping element distribution map ( Figure 4 E) It proves that the O, N, Cu and P elements are evenly distributed on AMCuD and there is almost no free state, which proves the successful synthesis of the aptamer-modified bionic copper-based composite nanosystem AMCuD.

[0074] Furthermore, using ICP-OES and fluorescence spectroscopy, the Cu loading was calculated by subtraction method to be about 20%, and the molar ratio of MCuD to loaded Apt-PDL1 was 1:1.4; Figure 4 By detecting the UV-visible absorption peaks, it was found that the final functionalized bionic nanosystem AMCuD had a characteristic absorption peak of copper peroxide near 400nm, and characteristic absorption peaks of FAM near 493nm and 517nm, proving the successful synthesis of AMCuD.

[0075] 2. Self-production of H2O2, consumption of glutathione (GSH) and generation of hydroxyl radicals by AMCuD in vitro

[0076] The performance of the aptamer-functionalized biomimetic nanosystem AMCuD was evaluated by

[0077] 1. Detection of Cu release under acidic conditions

[0078] AMCuD ([CuD] = 100 μg) was resuspended in buffer solutions of pH 5.5 and 7.4, respectively, and placed in a shaker at 100 rpm / min and 37°C. Appropriate amounts of samples were taken out at different time points and centrifuged to obtain supernatants. The Cu content in the supernatants was detected by ICP-OES, and the release of Cu ions under different pH environments was calculated.

[0079] like Figure 5As shown in Figure A, under the condition of pH 5.5, AMCuD can quickly release copper ions, and the release of Cu ions can reach more than 80% within 12 hours, and the final release amount is higher than 80%; under the condition of pH 7.4, AMCuD has good stability, and the release of Cu ions within 24 hours is less than 30%, indicating that AMCuD has stability in physiological environment and the ability to disintegrate under acidic conditions.

[0080] 2. Performance characterization of self-produced H2O2 under acidic conditions

[0081] 100 μg CuD and AMCuD solutions of equal amounts of PDA were added to 0.1 M acidic KMnO4 solution, and a blank control group was set up. After reacting at room temperature for 10 minutes, the supernatant was collected after high-speed centrifugation (10000 rpm, 5 minutes), and the full-wavelength absorption spectrum of the supernatant was detected by UV-visible spectrophotometer.

[0082] like Figure 5 As shown in B, CuO2 coated on the surface of CuD reacts with H2O to generate H2O2 under acidic conditions, and the permanganate in potassium permanganate is reduced to generate MnO2, which causes the potassium permanganate solution to fade. The AMCuD group coated with functionalized cell membranes exhibits a similar reaction phenomenon to CuD, indicating that the coating of the cell membrane does not affect the acid response of CuD to produce H2O2.

[0083] 3. Glutathione depletion

[0084] PDA, CuD and AMCuD (100 μg / mL) and GSH (1 mM) were added to PBS buffer (pH 6.5) at room temperature, and the supernatant was taken at different time points and further treated with 10 μL of 5,5'-dithiobis(2-nitrobenzoic acid, DTNB) (0.2 mM). The loss of GSH was calculated by measuring the absorbance at 412 nm using an ELISA reader.

[0085] like Figure 5 As shown in C, the color development of DNTB by PDA nanospheres gradually weakened with the increase of time, proving that PDA has the ability to consume GSH. At the same time, compared with PDA, the color development effect of DNTB by CuD and AMCuD nanocomposites at the same time and particle concentration was significantly reduced, which was due to the strong oxidative effect of CuO2.

[0086] 4. Ability to generate OH

[0087] Cu 2+It can react with H2O2 to generate hydroxyl radicals in a Fenton-like catalytic reaction. MB was used as an indicator to determine the generation of ·OH by AMCuD. MB solution (10 μg / mL) was mixed with PDA, CuD, AMCuD, and AMCuD + different concentrations of H2O2, and the mixture was shaken at 37°C for 1 hour. The ultraviolet absorption peak intensity of MB was determined by ultraviolet spectrophotometry.

[0088] Hydroxyl radicals can bleach methylene blue dye, which changes its color from dark blue to lighter. Figure 5 It can be seen that without adding additional H2O2, the efficiency of AMCuD in generating hydroxyl radicals is similar to that of CuD, and the material has a superior MB degradation effect. Under the condition of the same concentration of AMCuD, the higher the concentration of H2O2, the better the MB degradation effect of the material.

[0089] 5. Stability of AMCuD

[0090] Modification of cell membrane can improve the stability of nanocomplex. The particle size of AMCuD in PBS solution and culture medium solution containing 10% calf serum was detected by Malvern particle size analyzer. Figure 5 As shown in E, the particle size of AMCuD in the two solutions did not change significantly within 5 days, which indicates that the modification of the cell membrane endows AMCuD with good stability.

[0091] At the same time, a hydrogen peroxide detection kit was used to detect the changes in the H2O2 levels produced by CuD and AMCuD after being placed for different periods of time to evaluate the effect of cell membrane modification on peroxide stability. Figure 5 As shown in F, the H2O2 level produced by CuD gradually decreased with the extension of time. The H2O2 level produced after three days was only about 0.322 μmol / mL, which was only about 12.0% of the level on day 0. The H2O2 level generated by AMCuD also decreased with the extension of time. The H2O2 level after three days was about 1.49 μmol / mL, which was 54.6% of the level on day 0, indicating that the modification of the cell membrane can improve the stability of peroxides.

[0092] 3. AMCuD in vitro targeted endocytosis and PD-L1 degradation experiments

[0093] AMCuD prepared according to the method in Example 1, mouse breast cancer cells 4T1 and human liver cancer cells HCCLM3 were purchased from ATCC, 4T1 cells were cultured in RPMI 1640 medium, and HCCLM3 cells were cultured in DMEM medium; the plasmids used were prepared by GeneCare.

[0094] 1. AMCuD endocytosis ability

[0095] 4T1 cells in the logarithmic growth phase were seeded in 12-well plates at a density of 1×10 5 / well), repeated three groups, continued to culture for 24h, washed with PBS buffer for 3 times, added PDA, CuD, nAMCuD (disordered aptamer) and AMCuD ([PDA] = 80μg / mL, [Ce6] = 10μg / mL) diluted with cell culture medium, and continued to culture for 4h; aspirated the supernatant culture medium, washed repeatedly with PBS buffer for 3 times, added 1mL of cell nuclear stain (hoechst33342 (10μg / mL)) to the wells, stained in the dark for 15min at room temperature, discarded the hoechst33342 stain, washed with PBS buffer for 3 times, added 1mL of PBS buffer to immerse the cells, and kept the bottom of the 12-well plate free of visible water; placed the 12-well plate under an inverted fluorescence microscope for observation, observed with a 20x microscope, and detected hoechst33342 (λ Ex =405nm), Ce6(λ Ex =640nm) fluorescence signal.

[0096] like Figure 6 As shown in A, the red fluorescence of the fluorescent probe Ce6 labeled on PDA can be seen in the AMCuD group, and compared with the control group (PBS solution), the red fluorescence of Ce6 in the AMCuD group is the strongest, indicating that the AMCuD synthesized in Example 1 has a good targeted endocytosis effect. Figure 6 In B, flow cytometry quantification of the fluorescence intensity of Ce6 in cells of different groups showed that RBCm coating reduced cellular uptake, but Apt-PD-L1 modification significantly enhanced tumor cell uptake.

[0097] 2. AMCuD selectively targets endocytosis

[0098] 4T1 cells in the logarithmic growth phase were inoculated in a laser confocal culture dish (15 mm in diameter) at a density of 5 × 10 4 / well), repeat three groups, and continue to culture for 24h. Wash three times with PBS buffer, one group was pre-incubated with PD-L1 monoclonal antibody for 3h in advance, and then nAMCuD (disordered aptamer) and AMCuD ([PDA] = 80μg / mL, [Apt-PDL1-FAM] = 2nmol / mL) diluted with cell culture medium were added respectively, and culture was continued for 1h. The supernatant culture medium was discarded, and the cells were washed repeatedly with PBS buffer for 3 times. 1mL of cell nuclear stain (hoechst33342 (10μg / mL)) was added to the culture dish, and staining was carried out at room temperature in the dark for 15min. The hoechst33342 stain was discarded and washed three times with PBS buffer. 1mL of PBS buffer was added to immerse the cells, and there was no clear water at the bottom of the culture dish. The culture dish was placed under a laser confocal microscope for observation, and the hoechst33342 (λ Ex =405nm), Ce6(λ Ex =640nm) fluorescence signal.

[0099] like Figure 6 As shown in C, in the nAMCuD group, weak green fluorescence of the fluorescent probe FAM labeled on the Apt-disordered sequence can be seen on the cell membrane surface, while in the targeted group AMCuD group, the green fluorescence on Apt-PDL1 is the strongest and concentrated on the 4T1 cell membrane surface, indicating that the AMCuD synthesized in Example 1 has a good effect of targeting the membrane surface PD-L1; Figure 6 In B, the green fluorescence on the surface of the 4T1 cell membrane in the cell + AMCuD group incubated with PD-L1 monoclonal antibody in advance was significantly weakened compared with the untreated AMCuD group, which indicates that Apt-PDL1 specifically targets PD-L1 on the surface of tumor cell membranes.

[0100] 3. AMCuD-induced lysosomal degradation of PDL1

[0101] The CD274-GFP fusion expression plasmid was constructed and transfected into HCCLM3 human liver cancer cells using LTX, and the successfully transfected cells were selected using G418. HCCLM3 cells in the logarithmic growth phase with fluorescence were inoculated in a laser confocal culture dish (15 mm) and the cells were inoculated (density of 5×10 4 After the cells adhered to the wall, the cells were co-incubated with AMCuD and the control group Aptamer-PDL1 for 1 hour. After the incubation, the cells were washed three times with PBS to remove the excess free aptamers or functionalized nanoparticles, and the incubation was continued for 4 hours, 8 hours, and 24 hours. The culture dish was placed under a laser confocal microscope for observation at 63 times. GFP (λ Ex=488nm) was used to observe the changes of PD-L1 on the cell membrane surface.

[0102] AMCuD and PD-L1 monoclonal antibody were co-incubated with HCCLM3 cells for 2 h, and lysosomes were labeled with lysosomal dyes. Figure 6 As shown in C, in the cells of the PD-L1 monoclonal antibody group, there was no obvious co-localization of the red fluorescence representing the lysosome and the green fluorescence representing the PD-L1 protein, indicating that when the cells were co-incubated with the PD-L1 monoclonal antibody, the PD-L1 protein on the cell membrane surface would not enter the lysosomal endocytosis pathway; in the AMCuD group, it was observed that the green fluorescence representing the PD-L1 protein on the cell membrane surface and the red fluorescence of the lysosome had obvious co-localization, indicating that AMCuD can bind to and carry the PD-L1 protein on the cell membrane surface into the lysosomal endocytosis pathway, realize the lysosomal degradation of the PD-L1 protein on the tumor cell membrane surface, and thus achieve the purpose of persistently blocking the PD-1 / PD-L1 signaling pathway.

[0103] like Figure 6 As shown in D, at 0 h, strong green fluorescence of PD-L1-GFP could be seen on the cell membrane surface in the Apt-PD-L1 and AMCuD groups. As time went on, at 4 h, the green fluorescence of PD-L1-GFP on the cell membrane surface in the Apt-PD-L1 and AMCuD groups was significantly weakened. At 8 h, the green fluorescence intensity of PD-L1-GFP on the cell membrane surface in the Apt-PD-L1 and AMCuD groups was significantly different. Due to the presence of recycling bodies, the PD-L1 protein in the Apt-PD-L1 group quickly returned to the cell membrane surface and restored its immune checkpoint function, while in the AMCuD group, the PD-L1 protein content on the cell membrane surface remained at a low level. After 24 h, we observed that the green fluorescence on the cell membrane surface in the Apt-PD-L1 group basically returned to the initial intensity, indicating that the PD-L1 protein returned to the cell membrane surface and restored its immune checkpoint function, while the green fluorescence on the cell membrane surface in the AMCuD group was still at a low level, indicating that lysosomal degradation can effectively prolong the recovery of PD-L1 in cells.

[0104] IV. In vitro targeted enhanced tumor copper death therapeutic effect of AMCuD

[0105] AMCuD was prepared according to the preparation method provided in Example 1. Mouse breast cancer cells 4T1 were purchased from ATCC, and 4T1 cells were cultured in RPMI 1640 medium.

[0106] 1. In vitro proliferation inhibition experiment of AMCuD

[0107] 4T1 cells in the logarithmic growth phase were seeded in 96-well plates (density of 1.0×10 4 / each well), and culture overnight. Remove the culture medium in the well plate, add different concentrations of AMCuD (10.0, 20.0 50.0, 100.0, 200.0, 500.0 μg / mL) into the well plate (each concentration is repeated in three wells), and continue to culture for 24 hours. Remove the cell culture medium and wash repeatedly with PBS buffer three times. Add 100 μL of the prepared CCK-8 working solution to each well and continue incubation for 1 hour. Detect the absorbance value (OD value) at 450nm by an enzyme reader, and calculate the cell survival rate according to the formula: Survival rate = (OD value of the experimental group - OD value of the blank group) - (OD value of the control group - OD value of the blank group) × 100%.

[0108] like Figure 7 As shown in A, the survival rate of 4T1 cells was measured after incubation of different concentrations of AMCuD with the cells for 24 h. It can be seen that when the concentration of the nanocomplex was 50 μg / mL, the survival rate of the cells was already lower than 50%, and when the concentration was 200 μg / mL, the survival rate of the cells was only about 15%, indicating that AMCuD has significant tumor cell toxicity in a relatively low range and can be effective in anti-tumor treatment.

[0109] 4T1 cells in the logarithmic growth phase were seeded in 96-well plates (density 10 4 / well), and culture for 24h. Remove the old culture medium, wash three times with PBS buffer, and add nAMD, AMD, nAMCuD, and AMCuD ([PDA]=80μg / mL, [Cu]=20μg / mL, [Apt]=1nmol / mL) solutions diluted with cell culture medium to the cells according to the following groups and incubate for 24h; after the culture, remove the old culture medium and wash three times with PBS buffer. Add 100.0μL of CCK8 working solution to each well and continue to culture for 1h. Place the cell well plate in an ELISA instrument, set the detection wavelength to 450nm, record the absorbance (OD value), and calculate the relative cell survival rate.

[0110] like Figure 7 As shown in B, the red blood cell membrane biomimetic carriers nAMD and AMD (Apt-PDL1@RBCm@PDA) were co-incubated with 4T1 cells for 24 hours, and the cell survival rate was above 80%, indicating that the carriers have good biocompatibility and biosafety. In the absence of targeted enhanced cell endocytosis, compared with the control group nAMCuD (58%), the cell survival rate of the AMCuD group was reduced to less than 25%, proving that the AMCuD functionalized biomimetic copper-based nanocomposite has enhanced targeted anti-tumor therapeutic potential in tumor treatment.

[0111] 2. Copper accumulation in tumor cells

[0112] 4T1 cells in the logarithmic growth phase were seeded in a cell culture dish (density 5×10 6 / well), cultured for 24h. Remove the old culture medium, wash with PBS buffer 3 times, and add nAMD, AMD, nAMCuD, AMCuD ([PDA] = 80μg / mL, [Cu] = 20μg / mL, Apt = 1nmol / mL) solutions diluted in cell culture medium to the cells for 4h according to the following groups:

[0113] After the culture was completed, the old culture medium was removed and the cells were washed three times with PBS buffer. Trypsin was added to each well to digest the cells in the collection well, and the samples were digested with nitric acid and fixed to volume. The concentration of Cu in each group of samples was detected by ICP-OES, and the accumulation of Cu in the cells was obtained by calculation.

[0114] like Figure 7 As shown in Figure C, there was no difference in the Cu content in the nanocomposite carriers nAMD and AMD compared with the control group; compared with the bionic copper-based nanocomposite nAMCuD, the intracellular Cu content of the AMCuD group with specific targeting was significantly upregulated, while in cells pre-incubated with PD-L1 monoclonal antibody, the Cu content was significantly reduced but significantly higher than that of the control group. These results demonstrate that AMCuD can effectively and rapidly increase the Cu content in tumor cells, which is beneficial to inducing cell copper death and has enhanced targeted anti-tumor therapeutic potential in tumor treatment.

[0115] 3. AMCuD induces intracellular ROS generation and cell apoptosis

[0116] 4T1 cells in the logarithmic growth phase were seeded in 24-well plates (density 5×10 4 / well), cultured for 24h. Remove the old culture medium, wash with PBS buffer 3 times, and add nAMD, AMD, nAMCuD, AMCuD ([PDA] = 80μg / mL, [Cu] = 20μg / mL, Apt = 1nmol / mL) solutions diluted in cell culture medium to the cells for 6h according to the following groups:

[0117] After the culture is completed, the old culture medium is removed and the cells are washed three times with PBS buffer. DCFH-DA working solution (10 μmol / L) is added to each well, incubated at 37°C for 20 minutes, the supernatant culture medium is discarded, and the cells are repeatedly washed three times with serum-free medium. 1 mL of cell nuclear stain (hoechst33342 (10 μg / mL)) is added to the wells, and the cells are stained in the dark at room temperature for 15 minutes. The hoechst33342 stain solution is discarded and the cells are washed three times with PBS buffer. 1 mL of serum-free medium is added to submerge the cells, and there is no clear water at the bottom of the 24-well plate. The 24-well plate is placed under an inverted fluorescence microscope for observation, and the hoechst33342 (λ Ex =405nm)、DCF(λ Ex =488nm) fluorescence signal.

[0118] like Figure 7 As shown in D, the control group, nAMD and AMD groups had no green fluorescence, indicating that the bionic nanocarrier did not produce ROS in tumor cells, while the bionic copper-based nanocomposite group nAMCuD group showed a more obvious green fluorescence, representing the production of ROS, indicating that the CuO2 modified on the PDA surface has a good ability to produce ROS; in comparison, the specific targeting group AMCuD had a strong green fluorescence, indicating that the ROS production in the cell was greater. According to the results of endocytosis, the cells took up more AMCuD in the same period of time, and the Cu ions released by the copper-based nanocomplex in the cell reacted with the self-produced and intracellular H2O2 to generate sufficient toxic hydroxyl radicals, which was beneficial to induce cell apoptosis and had enhanced targeted anti-tumor therapeutic potential in tumor treatment.

[0119] 4T1 cells in the logarithmic growth phase were seeded in 12-well plates (density 1×10 5 / well), cultured for 24h. Remove the old culture medium, wash with PBS buffer 3 times, and add nAMD, AMD, nAMCuD, AMCuD ([PDA] = 80μg / mL, [Cu] = 20μg / mL, Aptamer = 1nmol / mL) solutions diluted in cell culture medium to the cells for incubation for 8h according to the following groups:

[0120] After the culture is completed, the old culture medium is removed and the cells are washed three times with PBS buffer. Trypsin is added to each well to digest and collect the cells in the well. 50,000-100,000 resuspended cells are taken and centrifuged at 1000g for 5 minutes. The supernatant is discarded, 195μL Annexin V-FITC binding solution is added to gently resuspend the cells, 5μL Annexin V-FITC and 5μL propidium iodide staining solution are added, and gently mixed. Incubate at room temperature in the dark for 10-20 minutes, and then detect on a flow cytometer.

[0121] like Figure 7 As shown in E, compared with the control, nAMD and AMD groups, nearly 30% of cells underwent apoptosis in the nAMCuD group, indicating that the ROS produced by CuO2 in the cells induced cell apoptosis; in comparison, the apoptosis rate of cells in the specific targeted group AMCuD group was close to 40%, indicating that the greater the ROS production in the cells, the more cell apoptosis, indicating that copper death-immunomodulators are beneficial to induce cell apoptosis.

[0122] 4. AMCuD induces cell death by copper

[0123] Excess intracellular copper can be transported to mitochondria through ion carriers and directly bind to the acylated components of the tricarboxylic acid cycle of mitochondrial respiration, causing the aggregation of acylated proteins (dihydrolipoamide S-acetyltransferase (DLAT)) and the loss of iron-sulfur cluster proteins (ferredoxin FDX1 and lipoyl synthetase (LIAS)), inducing proteotoxic stress and ultimately leading to cell death.

[0124] 4T1 cells in the logarithmic growth phase were inoculated in a laser confocal culture dish (15 mm) at a density of 5 × 10 4 / well), repeat three groups, and continue to culture for 24h. Wash three times with PBS buffer, and add nAMD, AMD, nAMCuD, AMCuD ([PDA] = 80μg / mL, [Cu] = 20μg / mL, Apt = 1nmol / mL) solutions diluted in cell culture medium to the cells according to the following groups and incubate for 6h. Aspirate the supernatant culture medium, wash repeatedly with PBS buffer for 3 times, add 1mL of the prepared JC-1 working solution (1:200) to the culture dish, and stain for 20min at room temperature in the dark. After incubation at 37℃, aspirate the supernatant, wash twice with JC-1 staining buffer, and add 1ml of cell culture medium. Place the culture dish under a laser confocal microscope for observation, observe with a 63x microscope, and detect JC-1 monomers (λ Ex =490nm), JC-1 polymer (λ Ex =525nm) fluorescence signal and bright field signal.

[0125] When the mitochondrial membrane potential is high, JC-1 aggregates in the mitochondrial matrix to form polymers (J-aggregates), which can produce red fluorescence; when the mitochondrial membrane potential is low, JC-1 cannot aggregate in the mitochondrial matrix. At this time, JC-1 is a monomer and can produce green fluorescence.

[0126] like Figure 8As shown in A, in the control, nAMD and AMD groups, obvious red fluorescence can be seen in the cells, and there is basically no green fluorescence, indicating that the vector group has no interference with the mitochondria of the cells; and in the non-targeted group nAMCuD, the cells produced obvious green fluorescence, indicating that the mitochondrial membrane potential of the cells has changed and the function of the mitochondria has been affected; in comparison, the green fluorescence is strongest in the targeted group AMCuD group, indicating that the AMCuD synthesized in Example 1 has good specific targeting and can effectively affect the abnormal mitochondrial function of the cells.

[0127] 4T1 cells in the logarithmic growth phase were inoculated in a 100 mm cell culture dish at a density of 2 × 10 6 / well), repeat three groups, and continue to culture for 48h. Wash with PBS buffer three times, add the control group and AMCuD ([PDA] = 80μg / mL, [Cu] = 20μg / mL, [Apt] = 1nmol / mL) solution diluted with cell culture medium to the cells according to the following grouping, incubate for 6h, discard the supernatant, rinse with PBS three times, and collect the cells for biological transmission electron microscopy.

[0128] like Figure 8 As shown in B, compared with the cell morphology in the control group, the mitochondria in the cytoplasm of the cells in the AMCuD group have condensed, the cristae have become thicker, the membrane density has increased, the gaps between the cristae have widened, the outer membrane is continuous, and the volume of mitochondria in a few cells has shrunk. Mitochondrial condensation is a typical sign of copper death;

[0129] 4T1 cells in the logarithmic growth phase were inoculated in a laser confocal culture dish (15 mm in diameter) at a density of 5 × 10 4 / well), repeat three groups, continue to culture for 24h, wash three times with PBS buffer, and add nAMD, AMD, nAMCuD, AMCuD ([PDA] = 80μg / mL, [Cu] = 20μg / mL, Aptamer = 1nmol / mL) solutions diluted in cell culture medium to the cells according to the following groups and incubate for 6h. Aspirate the supernatant culture medium, wash repeatedly with PBS buffer for 3 times, add Mito-Tracker Deep Red FM (50nM) to the confocal culture dish to label the mitochondria of the cells, incubate for 30min, wash three times with preheated cell culture medium, carefully remove the culture medium used for washing, add 4% paraformaldehyde fixative, and fix at room temperature for 15-30 minutes. After staining, block with BSA (1%) at 37°C for 1h, discard the supernatant, add 200μL of DLAT primary antibody working solution (1:100, 1% BSA dilution), incubate overnight at 4°C, aspirate the primary antibody and rinse carefully 3 times with PBS, add diluted secondary antibody with green fluorescent dye, incubate at room temperature in the dark for 2h, aspirate the secondary antibody and rinse carefully 3 times with PBS, then add nuclear dye DAPI working solution, stain at 37°C for 20min, aspirate DAPI and rinse carefully 3 times with PBS, place the culture dish under an inverted confocal microscope for observation, observe with 100x microscope, and detect DLAT (λ Ex =488nm), mitochondrial probe mito-tracker (λ Ex =644nm) and DAPI (λ Ex =405nm) fluorescence signal.

[0130] like Figure 8 As shown in C, in the control group, nAMD and AMD groups, it can be seen that the mitochondrial red fluorescence and DLAT green fluorescence in the cells have obvious co-localization, and the mitochondria are spherical, rod-shaped or filamentous particles, indicating that the expression of DLAT basically exists in mitochondria, and the incubation of the vector has no effect on the morphology of mitochondria; in the non-targeted group nAMCuD, the mitochondrial red fluorescence also appears generally broken spherical, indicating that the copper death-immunomodulator also has a significant effect on the mitochondrial morphology of cells, and at the same time, the green fluorescence of the cells presents a more concentrated state, indicating that under the influence of Cu, DLAT is aggregated in the mitochondrial site; in contrast, the green fluorescence in the targeted group AMCuD group is basically presented as small aggregated fluorescent spots, and the fluorescence intensity is significantly increased compared with the non-targeted group, indicating that the AMCuD functionalized bionic copper-based nanocomplex synthesized in Example 1 has good specific targeting, and can enhance the accumulation of Cu in the mitochondria in the cells and effectively induce copper death of the cells.

[0131] 4T1 cells in the logarithmic growth phase were inoculated in a 100 mm cell culture dish at a density of 5 × 10 6 / well), repeat three groups, and continue to culture for 48h. Wash with PBS buffer three times, and add nAMD, AMD, nAMCuD, AMCuD ([PDA] = 80μg / mL, [Cu] = 20μg / mL, Apt = 1nmol / mL) solutions diluted in cell culture medium to the cells according to the following groups, incubate for 12h, discard the supernatant, and rinse with PBS three times. Total cell protein was collected, and the protein concentration was determined by the BCA method; each group of samples was mixed with the upper buffer and boiled for 10 minutes, and stored at -20°C for later use; each group of samples was then added to SDS-PAGE gel to separate the samples (30 μg per well), the separated proteins were transferred to PVDF membrane, washed three times with TBST buffer, and added with blocking solution at room temperature for 2 hours; after blocking, the PVDF membrane was incubated with FDX1 and LIAS primary antibody dilutions at 4°C overnight, after incubation, the free primary antibody was removed, and the corresponding secondary dilution was added, and incubated at room temperature for 2 hours; after incubation, the PVDF membrane was washed with TBST, and the chemiluminescent solution was added for reaction for 5 minutes, and finally exposed to the chemiluminescent system for imaging.

[0132] like Figure 8 As shown in D, both LIAS and FDX1 were significantly decreased in the AMCuD group, indicating that the excessive accumulation of Cu in mitochondria effectively led to the loss of iron-sulfur cluster proteins, triggered mitochondrial dysfunction, and induced typical copper cell death.

[0133] 5. Study on AMCuD targeting tumors in vivo and reducing the abundance of PD-L1 on the surface of tumor cells

[0134] Balb / c mice were provided by Jicui Biological Animal Experiment Center, all of them were female, 4-6 weeks old, and weighed 18-22 g.

[0135] After in vitro expansion of cells, the cells were digested, counted, and diluted in sterile saline. 100 μL of saline (1×10 7 4T1 cells / mL), and after 8-14 days, the tumor grew to a volume of about 100 mm 3 Intravenous injection was performed and the mice were divided into 3 groups, with 3 mice in each group: Group 1: Apt-Cy5 (control group); Group 2: nAMCuD; Group 3: AMCuD; tail vein injection: 100 μL per mouse ([PDA] = 80 mg / mL, [Cu] = 20 mg / mL, [Apt-Cy5] = 2 μmol / mL); after 48 hours of imaging, the mice were dissected, and fluorescence imaging of major organs and tumors was performed, and the accumulation of Cy5 was analyzed by detecting the fluorescence of Cy5.

[0136] like Fig. 9 As shown in A, compared with the control group, a significant increase in fluorescence imaging signals can be detected at the tumor site. The strongest signal was detected at the tumor site within 8 hours after administration, and then the signal intensity weakened over time. The results of in vitro organ imaging showed that 48 hours after injection, the fluorescence of the AMCuD particle group was significantly distributed at the tumor site (as shown in Figure 2). Fig. 9 B). Semi-quantitative analysis of in vitro fluorescence imaging of tumor tissues and organ tissues also demonstrated the tumor targeting ability of AMCuD (e.g. Fig. 9 C). The above results indicate that AMCuD can indeed achieve targeted enrichment of drugs at the tumor site and has a longer tumor retention time, which is beneficial for subsequent copper death-immune combined therapy.

[0137] 48 hours after administration, the ex vivo tumors were dissected out and fixed with paraformaldehyde, and then paraffin sectioned. The tumor sections were incubated with rabbit anti-mouse PDL1 antibody (1:100 dilution, Abcam) and Alex 488-conjugated goat anti-rabbit secondary antibody (1:200 dilution, Jackson Inc.) according to the instructions, and the cell nuclei were stained with DAPI. The results are shown in Fig.10 . It can be seen that the expression of PD-L1 in 4T1 mouse breast cancer tissue is relatively high. When nAMCuD enters the cells, the expression of PD-L1 is upregulated. According to the literature review, we found that the accumulation of Cu in cells will enhance the expression of PD-L1 in tumor cells through STATs phosphorylation, thereby sensitizing ICB treatment. The Apt-PDL1 carried by the final functionalized bionic nano-copper-based complex AMCuD can effectively bind to PD-L1 on the cell membrane surface and enter the lysosomal degradation pathway, reducing the cell abundance of PD-L1 in tumor tissues, thereby improving the immunosuppression of tumor tissues.

[0138] VI. AMCuD in vivo targeted enhanced copper death synergistic immune anti-tumor

[0139] According to the method in the fifth item, a 4T1 orthotopic tumor-bearing mouse model was constructed and randomly divided into 6 groups, 6 mice in each group, and the mice were administered by tail vein. The blank group was intravenously injected with 100 μL of normal saline, and the remaining groups were: 100 μL sample ([PDA] = 160 mg / mL, [Cu] = 40 mg / mL, [Apt-PDL1 or scrambled order] = 2 μmol / mL); intraperitoneal administration: [α-PDL1] = 0.5 mg / mL. G1. Control group (Saline); G2. nAMD (non-targeted vector group, vector safety); G3. Apt-PDL1@RBCv (single immunotherapy group, abbreviated as AM); G4. nAMCuD (non-targeted bionic copper death single treatment group); G5. nAMCuD+α-PDL1 (non-targeted bionic copper death combined with monoclonal antibody treatment group); G6. AMCuD (targeted copper death synergistic immunotherapy group).

[0140] The size of the tumor in two dimensions was measured by vernier calipers every other day, and the weight of the tumor-bearing mice was tested. The second drug treatment was performed on the 3rd day, and the third drug treatment was performed on the 6th day. The tumor volume calculation formula is V = WL 2 / 2 (W represents the long diameter of the tumor, and L represents the short diameter of the tumor). On day 21, the mice were killed, and the tumor masses were isolated and weighed. Tumor tissues were collected, embedded in paraffin, and then sliced. Tumor sections were incubated with mouse copper death and apoptosis-related antibodies and Alex 488-conjugated goat anti-mouse secondary antibodies (1:200 dilution, Jackson Inc.) according to the instructions, and cell nuclei were stained with DAPI. The results are shown in Fig.11 .

[0141] Fig.11 A shows the changes in tumor volume in each group of mice. It can be seen that the copper death combined with immunization group G5 and G6 significantly inhibited the proliferation of in situ breast cancer. Fig.11 As shown in B, the final tumor volume and tumor inhibition rate calculated based on tumor weight in the G6 group were significantly different from those in the G4 group, indicating that copper overload-induced tumor death combined with aptamer-functionalized cell membrane-induced long-term ICB therapy had a synergistic tumor inhibition effect. Fig.11 C results show that the copper-based nanocomplex causes an increase in the expression of the apoptotic protein Caspase3 and a downregulation of the iron-sulfur cluster proteins FDX1 and LIAS, markers of copper death, in the tumor site. Fig.11As shown in D (scalebar = 50 μm), it can be seen that the expression of apoptotic proteins in the control group is almost non-existent, while the fluorescence signals of FDX1 (purple fluorescence) and LIAS protein (red fluorescence) that maintain mitochondrial function are very obvious; while the G4, G5 and G6 groups containing copper-based nanocomplexes all showed a significant increase in the fluorescence signal of apoptotic proteins, a significant decrease in the fluorescence signal of copper death proteins, and a high degree of co-localization of the fluorescence signal and the blue fluorescence signal of DAPI, indicating that copper-based nanocomplexes can indeed effectively induce apoptosis and copper death of tumor tissues.

[0142] Copper death, CDT, etc. can simultaneously trigger the immunogenic cell death of tumor cells, release damage associated molecular patterns (DAMPs) such as the release of high mobility group box 1 protein (HMGB1) or the externalization of calreticulin (CRT), which can directly or indirectly initiate adaptive immune responses and induce the body's anti-tumor immunity. The anti-tumor immune activation of mice was evaluated by the maturity of dendritic cells (DCs) in mouse spleen tissue and the infiltration of T cells in tumor tissue. The results are shown in Fig.12 .

[0143] like Fig.12 As shown in A, compared with the control group, the expression of CRT in the tumor tissue of the AMCuD group of the copper-targeted death synergistic immunity group increased significantly (the green fluorescence signal was significantly enhanced), and the red fluorescence signal of HMGB1 migrated from the co-localization with the blue fluorescence signal of the cell nucleus DAPI in the control group to mainly existing around the blue fluorescence signal, indicating that AMCuD activates the immunogenic cell death of cells in tumor tissues and releases DAMPs. Fig.12 As shown in B and C, in the spleen of mice, mature DCs (CD11c + CD80 + CD86 + ) was 25%, which was much higher than the single ICB treatment group (12.5%) and the single copper death treatment group (18.2%). It was also significantly improved compared with the copper death combined with PD-L1 monoclonal antibody group (21.7%). Fig.12 D shows that CD8 + The number of T cells increased significantly, indicating that the immune system of the mice was able to kill tumor cells significantly. In addition, the T cells infiltrating the tumor tissues of the mice were also detected by flow cytometry. Fig.12 As shown in E, F, and G, CD8 +The proportion of T cells increased significantly, indicating that copper death synergistically with long-term ICB therapy significantly improved the body's anti-tumor immune effect.

[0144] VII. AMCuD activates anti-tumor long-term immunity and suppresses lung metastasis

[0145] In the sixth item, the central memory T cells (T cells) in the spleen of mice were detected. CM ) and effector memory T cells (Effective Memory T Cell, T EM ) was used to evaluate the body's long-term anti-tumor immune effect. The results showed that the proportions of the two types of memory T cells in the nAMCuD+α-PDL1 group and the AMCuD group were significantly increased compared with those in the control group, indicating that they had good anti-tumor recurrence and metastasis effects. Therefore, we established a tumor re-challenge model to evaluate the ability of AMCuD to activate the body's long-term anti-tumor recurrence and metastasis.

[0146] After in vitro expansion of cells, the cells were digested, counted, and diluted in sterile saline. 100 μL of 4T1 tumor cell suspension (1×10 7 4T1 cells / mL), and in about 10 days, the tumor grew to a volume of about 100mm 3 The mice were randomly divided into 3 groups, 5 mice in each group, and administered drugs through the tail vein. The blank group was intravenously injected with 100 μL of normal saline, and the rest of the groups were: 100 μL of sample ([PDA] = 160 mg / mL, [Cu] = 40 mg / mL, [Apt-PDL1 or scrambled order] = 2 μmol / mL); intraperitoneal administration, 100 μL sample solution per mouse: [α-PDL1] = 0.5 mg / mL. 1. Control group (Saline); 2. nAMCuD + α-PDL1; 3. AMCuD. The drugs were administered on days 0, 3, and 6, respectively. After the treatment, the remaining tumor tissue was surgically removed and sutured on the ninth day. On the 21st day, tumor cells were re-inoculated in the contralateral breast pad. The size of the tumor in two dimensions was measured by vernier calipers every other day, and the death time of the mice during the treatment was recorded. The tumor volume was calculated by the formula V = WL 2 / 2 (W represents the long diameter of the tumor, and L represents the short diameter of the tumor). On the 56th day, the mice were killed, and the lung tissues of the mice were isolated and fixed with Bouin' reagent and stained for 1 hour. After staining, they were rinsed with UP water, dried with absorbent paper, and photographed. Representative lung tissues were selected for embedding and sectioning, stained with HE reagent, and the distribution of tumor cells in the tissue sections was observed. The results are shown in Fig.13 .

[0147] from Fig.13As shown in B, AMCuD can effectively prolong the survival time of mice. On day 21, flow cytometry analysis was performed on the memory T cells in the spleen of mice that represent immune memory function. Fig.13 As shown in Figures C and 13D, after AMCuD treatment, the proportions of central memory T cells and effector memory T cells in mice increased significantly, indicating that AMCuD can prolong the anti-tumor immune function of mice, thereby effectively inhibiting tumor metastasis and recurrence. Fig.13 As shown in E, there are multiple obvious lung nodules on the lung tissues of mice in the Control group, and the proportion of tumor cells in HE sections is relatively high; the number of nodules on the lung tissues of mice in the copper death combined with PD-L1 monoclonal antibody group is significantly reduced, and HE sections show that the proportion of tumor cells is significantly reduced; there are basically no lung nodules in the lungs of mice in the AMCuD group of targeted copper death combined with long-term ICB, and there are almost no tumor cells or inflammation in the lungs of mice in HE sections, indicating that the targeted copper death of AMCuD combined with long-term ICB therapy can effectively inhibit the lung metastasis of tumor cells. Fig.13 As shown in F, the growth curve of the tumor in the AMCuD group mice was significantly slowed down after re-challenge, and 40% of the mice had cleared tumors after re-challenge, which indicates that AMCuD can significantly inhibit the postoperative tumor recurrence of 4T1 breast cancer.

[0148] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by a person of ordinary skill in the art without departing from the spirit and technical ideas disclosed by the present invention shall still be covered by the claims of the present invention.

Claims

1. A targeted enhanced copper death-immunomodulator, characterized in that: The invention comprises a CuO2@PDA nanocomposite formed by a PDA substrate and CuO2 nanodots. The CuO2@PDA nanocomposite is externally wrapped with a functionalized cell membrane, and a PD-L1 targeting ligand is grafted onto the functionalized cell membrane.

2. The targeted enhanced copper death-immunomodulator according to claim 1, characterized in that: The particle size of the PDA substrate in the CuO2@PDA nanocomposite is 80-200nm, and the particle size of the CuO2 nanodots is 2-10nm.

3. The targeted enhanced copper death-immunomodulator according to claim 1, characterized in that: The PD-L1 targeting ligand is a PD-L1 antibody, a PD-L1 targeting peptide and a PD-L1 targeting aptamer; the PD-L1 targeting ligand is modified with a lipophilic group.

4. The targeted enhanced copper death-immunomodulator according to claim 3, characterized in that: The PD-L1 targeting ligand is a PD-L1 targeting aptamer, and its sequence is: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and the lipophilic group is modified at the 3' end of the sequence; the lipophilic group is cholesterol or a phospholipid-polyethylene glycol copolymer, and the phospholipid is 1,2-distearoyl-sn-glycerol-3-phosphatidylethanolamine or 1,2-dioleoyl-SN-glycerol-3-phosphatidylethanolamine.

5. The method for preparing the targeted enhanced copper death-immunomodulator according to any one of claims 1 to 4, characterized in that: Specifically include the following steps: (1) adding a PDA solution dropwise to a solution containing PVP and copper salt, mixing well, adding an alkaline solution thereto to adjust the pH value to a weak alkaline state, and then adding a H2O2 solution thereto, stirring and reacting, to obtain a CuO2@PDA nanocomposite; (2) adding cell membrane to the CuO2@PDA nanocomposite, ultrasonically treating the nanocomposite in a water bath, and then incubating the nanocomposite statically to obtain a cell membrane-wrapped CuO2@PDA nanocomposite; (3) Adding PD-L1 targeting ligand to the CuO2@PDA nanocomplex wrapped in the cell membrane, mixing and incubating to obtain a novel nanocomposite.

6. The method for preparing the targeted enhanced copper death-immunomodulator according to claim 5, characterized in that: In step (1), PDA:Cu 2+ The mass ratio is 1:0.75-4, Cu 2+ :PVP molar ratio 1:0.2-2, Cu 2+ :H2O2 molar ratio 1:5-25, Cu 2+ :OH - The molar ratio is 1:0.5-2.

5.

7. The method for preparing the targeted enhanced copper death-immunomodulator according to claim 5, characterized in that: In step (1), the copper salt solution is CuCl2 solution, CuSO4 solution or Cu(NO3)2 solution; the alkaline solution is NaOH solution or KOH solution; and the pH value of the mixed solution is 7.2-7.

5.

8. The method for preparing the targeted enhanced copper death-immunomodulator according to claim 5, characterized in that: In step (2), the mass ratio of CuO2@PDA nanocomposite to cell membrane is 1:1-6.

9. The method for preparing the targeted enhanced copper death-immunomodulator according to claim 5, characterized in that: In step (3), the molar ratio of the cell membrane-wrapped CuO2@PDA nanocomplex to the PD-L1 targeting ligand is 1:500-3000.

10. Use of the targeted enhanced copper death-immunomodulator described in claim 9 in the preparation of solid tumor therapeutic drugs and solid tumor metastasis inhibition drugs.

Images