Application of insecticidal protein

Abstract

The invention discloses application of insecticidal protein, and particularly discloses a method for controlling lepidoptera pests and application, the method comprises the following steps: lepidoptera pests are contacted with the insecticidal protein, or nucleic acid molecules for coding the insecticidal protein are introduced into plants, so that the lepidoptera pests eat the plants, and the plants are fed with the insecticidal protein. The insecticidal protein comprises an amino acid sequence as shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 20. According to the invention, the Cry1Da1 protein BD1-002, the Cry1Da1 protein BD1-018, the Cry1Da1 protein BD1-019, the Cry1Da1 protein BD1-021, the Cry1Da1 protein BD1-022 and the Cry1Da1 protein BD1-022S have relatively good insecticidal activity on the soybean pest, namely the argyrogramma agnata.

Description

Technical Field

[0001] The invention relates to application of an insecticidal protein, in particular to application of a Cry1Da1 protein in controlling soybean pest Spodoptera exigua. Background Art

[0002] Argyrogramma agnata, belonging to the family Noctuidae of the order Lepidoptera, is mainly distributed in the Yangtze River Basin and the Yellow River Basin of my country. It is one of the main soybean pests in the main soybean producing areas of my country. Argyrogramma agnata is a polyphagous pest that mainly harms a variety of crops such as beans, rapeseed, cabbage, cauliflower, Chinese cabbage, radish and other cruciferous vegetables. Its damage characteristics are: the larvae feed on the leaves, causing notches and holes. In severe cases, the leaves will be eaten up, affecting the yield. Cultivated soybean (Glycine max (L.) Merri) is an important economic crop grown worldwide as the main source of vegetable oil and vegetable protein, and is an important food crop in China. Soybean is one of the plants that Argyrogramma agnata likes to feed on the most. Every year, Argyrogramma agnata causes different degrees of grain loss, with a 10% to 20% reduction in production in mild cases and a 30% to 40% reduction in production in severe cases. In order to prevent and control Argyrogramma agnata, the main methods commonly used are agricultural control, chemical control, physical control and biological control.

[0003] Agricultural control is the comprehensive and coordinated management of multiple factors in the entire farmland ecosystem, regulating crops, pests, and environmental factors to create a farmland ecological environment that is conducive to crop growth but not conducive to the occurrence of Spodoptera exigua. For example, deep winter plowing can directly eliminate some overwintering pupae in fields where the last generation of larvae occur more frequently in autumn. The pupae buried deep cannot emerge from the ground, while the pupae exposed to the surface will be preyed on by natural enemies such as birds or dried up by wind, thus greatly reducing the insect population base in the coming year. Because agricultural control is mostly preventive measures, its application has certain limitations and cannot be used as an emergency measure. It is powerless when the Spodoptera exigua breaks out.

[0004] Chemical control, also known as pesticide control, is the use of chemical insecticides to kill pests. It is an important part of the comprehensive management of Spodoptera exigua. It is fast, convenient, simple and highly economical. It is an indispensable emergency measure, especially in the case of a large outbreak of Spodoptera exigua. At present, the main chemical control method is liquid spraying, which has a good control effect before the larvae of Spodoptera exigua reach the third instar. At this time, the larvae have a small appetite and weak drug resistance. The 1-2 instar larvae can be determined according to the peak period of attracting adults under the lamp, or the control time can be determined according to the damage of the first instar larvae. Usually, 2.5% deltamethrin, 4.5% high-efficiency cypermethrin, 5% avermectin, 5% fluazifop emulsifiable concentrate or 10% imidacloprid wettable powder are used to prepare 1000-1500 times liquid for spraying. At the same time, chemical control also has its limitations. For example, improper use often leads to crop damage, pest resistance, killing of natural enemies, environmental pollution, destruction of farmland ecosystems, and pesticide residues posing a threat to the safety of humans and livestock.

[0005] Physical control is mainly based on the response of pests to various physical factors in environmental conditions, using various physical factors such as light, electricity, color, temperature and humidity, as well as mechanical equipment to trap and kill, irradiate sterility and other methods to control pests. When the adults are in full bloom, use nets or lights to trap and kill. Taking advantage of the strong phototaxis of the adults of the silver-striped armyworm, set up black light lamps to trap and kill adults during the emergence period to reduce the amount of eggs and larvae in the field; however, the black light lamp needs to clean the dirt on the filter every day, otherwise it will affect the emission of black light, and then affect the insecticidal effect; and the stability of the power supply voltage is required to be high, and there is a risk of hurting people's eyes during operation; in addition, the one-time investment in installing the lamp is large.

[0006] Biological control is to use certain beneficial organisms or biological metabolites to control the number of pest populations in order to reduce or eliminate pests. For example, pesticides with low toxicity to natural enemies are selected, and the application time is adjusted according to the difference in the field occurrence period of pests and natural enemies, avoiding the application of pesticides when natural enemies occur in large numbers to protect natural enemies; secondly, the black tumor Ichneumon wasp of rice budworm can be artificially released or Bacillus thuringiensis SD-5, Spodoptera exigua nuclear polyhedrosis virus and other preparations can be sprayed to control Spodoptera exigua. Its characteristics are that it is safe for humans and animals, has little pollution to the environment, and can achieve the purpose of long-term control of certain pests; however, the effect is often unstable, and the same investment is required regardless of the severity of the Spodoptera exigua.

[0007] In order to solve the limitations of agricultural control, chemical control, physical control and biological control in practical applications, scientists have discovered through research that by transferring insect-resistant genes encoding insecticidal proteins into plants, some insect-resistant transgenic plants can be obtained to control plant pests.

[0008] Bacillus thuringiensis (Bt) is a Gram-positive bacterium widely distributed in nature. The biggest difference between Bt and other Bacillus is that crystal proteins are produced along with the formation of spores in the late growth period, generally known as parasporal crystals. Bt strains are considered to be insect pathogens, and their pathogenicity mainly or completely depends on parasporal crystal proteins. In recent years, a large number of literatures have reported that various Bt strains have insecticidal activity against insects such as Lepidoptera, Coleoptera, Diptera, Hymenoptera, and Homoptera.

[0009] Cry1Da1 protein is a Bacillus thuringiensis parasporal crystal protein, which is ingested by insects and enters the midgut. The toxin protein protoxin is dissolved in the alkaline pH environment of the insect midgut. The N- and C-termini of the protein are digested by alkaline proteases, converting the protoxin into active fragments; the active fragments bind to receptors on the surface of the insect midgut epithelial cell membrane and insert into the intestinal membrane, causing perforation symptoms in the cell membrane, destroying the osmotic pressure changes and pH balance inside and outside the cell membrane, disrupting the insect's digestion process, and ultimately causing its death. Cry1Da1 protein is a Lepidoptera-specific Bt insecticidal crystal protein with a new mechanism. Its midgut receptors in Lepidoptera are different from other Cry proteins (reference 1). It has good resistance to a variety of Lepidoptera insects such as fall armyworm and cotton bollworm. However, the prior art does not disclose that Cry1Da1 protein and its variants have insecticidal activity against the soybean pest Spodoptera silver-striped. Summary of the invention

[0010] In view of this, the object of the present invention is to provide a method and use of Cry1Da1 protein to control the soybean pest Spodoptera: Spodoptera exigua.

[0011] In a first aspect, the present invention provides a method for controlling lepidopteran pests, comprising contacting the lepidopteran pests with an insecticidal protein comprising an amino acid sequence as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20.

[0012] In a second aspect, the present invention provides a method for controlling lepidopteran pests, comprising introducing a nucleic acid molecule encoding an insecticidal protein into a plant, allowing the lepidopteran pests to feed on the plant, wherein the insecticidal protein comprises an amino acid sequence as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20.

[0013] In a third aspect, the present invention provides the use of an insecticidal protein for controlling lepidopteran pests, wherein the insecticidal protein comprises an amino acid sequence as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20.

[0014] The beneficial effects of the present invention are:

[0015] The Cry1Da1-related proteins in the present invention are toxic to Spodoptera exigua. The plants in the present invention, especially soybeans, contain exogenous DNA in their genomes, and the exogenous DNA contains a nucleotide sequence encoding a Cry1Da1-related protein. The Spodoptera exigua pest contacts the protein by feeding on plant tissues, and the growth of the Spodoptera exigua pest is inhibited and / or causes death after contact. Inhibition refers to lethality or sublethality. At the same time, the plants should be morphologically normal and can be cultured under conventional methods for consumption and / or production of products. In addition, the plants can substantially eliminate the need for chemical or biological pesticides (the chemical or biological pesticides are pesticides for the Spodoptera exigua pests targeted by the Cry1Da1-related protein). The present invention provides a use of an insecticidal protein, which has the following advantages:

[0016] 1. Internal control. The existing technology mainly controls the damage of the silver-cut armyworm pest through external factors, such as agricultural control, chemical control, physical control and biological control; while the present invention controls the silver-cut armyworm pest by producing Cry1Da protein in the plant body that can kill the silver-cut armyworm, that is, through internal control.

[0017] 2. No pollution, no residue. Although the chemical control methods used in the prior art have played a certain role in controlling the harm of the silver-striped armyworm pest, they also cause pollution, damage and residue to humans, livestock and farmland ecosystems; the method for controlling the silver-striped armyworm pest of the present invention can eliminate the above-mentioned adverse consequences.

[0018] 3. Prevention during the entire growth period. The methods used in the prior art to control the silver-striped armyworm pest are all staged, while the present invention protects plants during the entire growth period. Transgenic plants (Cry1Da protein) can avoid being attacked by the silver-striped armyworm from germination and growth to flowering and fruiting.

[0019] 4. Whole plant control. Most of the methods used in the prior art to control the silver-striped armyworm pest are local, such as foliar spraying; while the present invention protects the entire plant, such as the roots, leaves, stems, fruits, tassels, female spikes, anthers or filaments of transgenic plants (Cry1Da protein) can resist the attack of silver-striped armyworm.

[0020] 5. Stable effect. Whether it is the agricultural control method or the physical control method used in the prior art, it is necessary to use environmental conditions to control pests, and there are many variable factors; the present invention is to express the Cry1Da protein in the plant body, which effectively overcomes the defect of unstable environmental conditions, and the control effect of the transgenic plant (Cry1Da protein) of the present invention is stable and consistent in different locations, different times, and different genetic backgrounds.

[0021] 6. Simple, convenient and economical. The frequency vibration insecticidal lamp used in the prior art has a large one-time investment and there is a risk of electric shock injury if it is not operated properly. The present invention only needs to plant transgenic plants that can express Cry1Da protein without taking other measures, thus saving a lot of manpower, material resources and financial resources.

[0022] 7. Complete effect. The methods used in the prior art to control the silver-cut armyworm pests are not completely effective and only play a mitigating role; however, the transgenic plants (Cry1Da protein) of the present invention can cause a large number of deaths of newly hatched larvae of the silver-cut armyworm and greatly inhibit the development progress of a small number of surviving larvae, and the transgenic plants are generally only slightly damaged. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 A flow chart for constructing a recombinant cloning vector DBN002A containing the nucleotide sequence of Cry1Da1-related protein BD1-002 of the present invention;

[0024] Figure 2 The present invention is a flowchart for constructing the soybean recombinant expression vector DBN002A-B containing the nucleotide sequence of Cry1Da1-related protein BD1-002. DETAILED DESCRIPTION

[0025] It should be noted that, unless otherwise defined, the technical terms or scientific terms used in this application should have the common meanings understood by technicians in the relevant field.

[0026] The experimental methods in the following examples are conventional methods unless otherwise specified. The medicinal materials, reagents, etc. used in the following examples are commercially available products unless otherwise specified.

[0027] In a first aspect, the present invention provides a method for controlling lepidopteran pests, comprising contacting the lepidopteran pests with an insecticidal protein comprising an amino acid sequence as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20.

[0028] In a second aspect, the present invention provides a method for controlling lepidopteran pests, comprising introducing a nucleic acid molecule encoding an insecticidal protein into a plant, allowing the lepidopteran pests to feed on the plant, wherein the insecticidal protein comprises an amino acid sequence as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20.

[0029] Those skilled in the art will readily recognize that advances in the field of molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequence and underlying gene sequence of proteins of agricultural interest.

[0030] The genes and proteins described in the present invention include not only specific example sequences, but also parts and / or fragments (including internal and / or terminal deletions compared to the full-length protein), variants, mutants, substitutions (proteins with substituted amino acids), chimeras and fusion proteins that preserve the insecticidal activity characteristics of the specific example proteins. The "variant" or "variation" refers to a nucleotide sequence encoding the same protein or encoding an equivalent protein with insecticidal activity. The "equivalent protein" refers to a protein that has the same or substantially the same biological activity against lepidopteran pests as the protein described in the present invention.

[0031] In the present invention, Cry1Da1 protein includes but is not limited to amino acid sequences having certain homology with the amino acid sequences shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20. The similarity / identity between these sequences and the sequences of the present invention is typically greater than 60%, preferably greater than 75%, more preferably greater than 90%, even more preferably greater than 95%, and may be greater than 99%. Preferred nucleotides and proteins of the present invention can also be defined according to more specific ranges of identity and / or similarity. For example, there are 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity and / or similarity with the sequences exemplified by the present invention.

[0032] In a preferred embodiment, the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20 is shown in SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:21, respectively.

[0033] In the present invention, the nucleic acid molecule or its fragment hybridizes with the modified Cry1Da1 gene of the present invention under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the modified Cry1Da1 gene of the present invention. Nucleic acid molecules or their fragments can specifically hybridize with other nucleic acid molecules under certain circumstances. In the present invention, if two nucleic acid molecules can form an antiparallel double-stranded nucleic acid structure, it can be said that the two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules show complete complementarity, one of the nucleic acid molecules is called the "complement" of the other nucleic acid molecule. In the present invention, when each nucleotide of a nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to show "complete complementarity". If two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under at least conventional "low stringency" conditions, the two nucleic acid molecules are called "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under conventional "high stringency" conditions, the two nucleic acid molecules are said to have "complementarity". Deviations from complete complementarity are permissible as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. In order for a nucleic acid molecule to serve as a primer or probe, it is only necessary to ensure that it has sufficient complementarity in sequence to form a stable double-stranded structure under the specific solvent and salt concentration used.

[0034] In the present invention, a substantially homologous sequence is a nucleic acid molecule that can specifically hybridize with a complementary strand of another matching nucleic acid molecule under highly stringent conditions. Suitable stringent conditions for promoting DNA hybridization, for example, treatment with 6.0× sodium chloride / sodium citrate (SSC) at about 45°C, followed by washing with 2.0×SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from about 2.0×SSC, 50°C for low stringency conditions to about 0.2×SSC, 50°C for high stringency conditions. In addition, the temperature conditions in the washing step can be increased from about 22°C at room temperature for low stringency conditions to about 65°C for high stringency conditions. Both the temperature conditions and the salt concentration can be changed, or one of them can be kept constant while the other variable is changed. Preferably, the stringent conditions of the present invention may be specific hybridization with SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:21 in a 6×SSC, 0.5% SDS solution at 65°C, followed by washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.

[0035] Therefore, sequences having insecticidal activity and hybridizing with SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 21 of the present invention under stringent conditions are included in the present invention. These sequences are at least about 40% to 50% homologous to the sequences of the present invention, about 60%, 65% or 70% homologous, and even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence homology.

[0036] Due to the redundancy of genetic codons, a variety of different DNA sequences can encode the same amino acid sequence. It is within the technical level of those skilled in the art to generate these alternative DNA sequences that encode the same or substantially the same protein. These different DNA sequences are included within the scope of the present invention. The "substantially identical" sequence refers to a sequence that has amino acid substitutions, deletions, additions or insertions that do not substantially affect the insecticidal activity, and also includes fragments that retain insecticidal activity.

[0037] "Transgenic" as used herein refers to any cell, cell line, callus, tissue, plant part or plant whose genome is altered by the presence of heterologous nucleic acid (such as a recombinant DNA construct). "Transgenic" as used herein includes those original transgenic events and those generated from the original transgenic events by sexual hybridization or asexual propagation, and does not encompass genome (chromosomal or extrachromosomal) changes made by conventional plant breeding methods or by naturally occurring events (such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation).

[0038] The term "insecticide" or "insect resistance" as used herein refers to being toxic to crop pests, thereby achieving "control" and / or "prevention" of crop pests. Preferably, the term "insecticide" or "insect resistance" refers to killing crop pests. More specifically, the target insects are lepidopteran pests.

[0039] The "contact" mentioned in the present invention refers to touching, staying and / or feeding, specifically insects and / or pests touching, staying and / or feeding on plants, plant organs, plant tissues or plant cells. The plants, plant organs, plant tissues or plant cells may express insecticidal proteins in their bodies, or may have insecticidal proteins and / or microorganisms that produce insecticidal proteins on their surfaces.

[0040] The "control" and / or "prevention" mentioned in the present invention refers to the contact between lepidopteran pests and Cry1Da1 protein, after which the growth of the lepidopteran pests is inhibited and / or death is caused. Further, the lepidopteran pests contact the Cry1Da1 protein by feeding on plant tissues, after which the growth of all or part of the lepidopteran pests is inhibited and / or death is caused. Inhibition refers to sublethal, that is, it is not lethal but can cause certain effects in growth and development, behavior, physiology, biochemistry and tissue, such as slow growth and / or cessation. At the same time, the plants should be normal in morphology and can be cultured under conventional methods for consumption and / or production of products. In addition, plants and / or plant seeds for controlling lepidopteran pests containing nucleotide sequences encoding Cry1Da1 protein have reduced plant damage compared with non-transgenic wild-type plants under conditions of artificial inoculation of lepidopteran pests and / or natural occurrence of lepidopteran pests, and the specific manifestations include but are not limited to improved leaf resistance, and / or increased grain weight, and / or increased yield, etc. The "control" and / or "prevention" effect of Cry1Da1 protein on lepidopteran pests can exist independently. Specifically, any tissue of the transgenic plant (containing a nucleotide sequence encoding the Cry1Da1 protein) simultaneously and / or asynchronously contains and / or produces Cry1Da1 protein and / or another substance that can control lepidopteran pests. The presence of the other substance cannot lead to the "control" and / or "prevention" effect being completely and / or partially achieved by the other substance, and is unrelated to the Cry1Da1 protein. Normally, in the field, the process of lepidopteran pests feeding on plant tissues is short and difficult to observe with the naked eye. Therefore, under conditions of artificial inoculation of lepidopteran pests and / or natural damage by lepidopteran pests, if there are dead lepidopteran pests in any tissue of the transgenic plant (containing the nucleotide sequence encoding the Cry1Da1 protein), and / or lepidopteran pests whose growth is inhibited thereon, and / or the plant has reduced damage compared with non-transgenic wild-type plants, the method and / or use of the present invention is achieved, that is, the method and / or use of controlling lepidopteran pests is achieved by contacting lepidopteran pests with Cry1Da1 protein.

[0041] In a preferred embodiment, the lepidopteran pest is the silver-lined armyworm. The silver-lined armyworm is widely distributed in my country, mainly in the Yangtze River Basin and the Yellow River Basin. The silver-lined armyworm has different generations per year in different places. In the Ningxia Hui Autonomous Region, there are 2 to 3 generations per year, about 3 to 4 generations in Hebei and Jiangsu, about 5 to 6 generations in Hunan and Hubei, and 7 generations in Guangzhou. The insect hibernates as a pupa. Adults can be seen emerging in April of the following year, and after 4 to 5 days after emergence, they enter the peak period of egg laying. The eggs are mostly scattered on the back of the leaves. The second to third generations lay the most eggs, and the adults hide during the day and come out at night, with phototaxis and chemotaxis. The newly hatched larvae mostly feed on the leaf flesh on the back of the leaves, leaving the epidermis. After the third instar, they feed on the tender leaves to form holes, and their appetite increases greatly. The larvae have a total of 5 instars, have a state of suspended animation, and will curl up and fall to the ground when frightened. At room temperature, the larval stage is about 10 days. The mature larvae spit white silk on the back of the host leaf to make cocoons and pupate. Adults can still be seen from late November to early December. The extent of the damage caused by Spodoptera exigua is mainly affected by the number of insect sources and temperature and humidity. Higher humidity and lower temperature in summer are conducive to its occurrence, but heavy rain during the egg and early larval stages is not conducive to its occurrence.

[0042] In the classification system, Lepidoptera is generally divided into suborders, superfamilies, and families based on morphological characteristics such as the venation sequence of adult wings, linkage mode, and antennae type. The Noctuidae family is the most species-rich family in Lepidoptera, with more than 20,000 species discovered worldwide, and thousands of records in China alone. Most Noctuidae insects are pests of crops, eating leaves and borers, such as cotton bollworms and Spodoptera litura. Although cotton bollworms, Spodoptera litura, and Spodoptera litura belong to the Noctuidae family of the Lepidoptera order, in addition to similarities in classification standards, there are great differences in other morphological structures; just like strawberries and apples in plants (both belong to the Rosaceae family of the Rosaceae order), they both have bisexual flowers, radial symmetry, and 5 petals, but their fruit and plant morphology are very different. However, because people have less contact with insects, especially agricultural pests, they pay less attention to the differences in insect morphology, which makes people think that insects are similar in morphology. In fact, the silver-striped armyworm has its own unique characteristics, both in larval and adult forms. For example, the head of the larva of the armyworm is dark brown, and the chest varies from earthy yellow to dark green; the adult of the armyworm is dark brown, with white tufts of hair on the back of the chest, and the forewings are gray-brown with many patterns. The larva of the silver-striped armyworm, which also belongs to the Noctuidae family, is light green; the adult of the silver-striped armyworm is gray-brown, with two tufts of long brown scales on the back of the chest, and the forewings are dark brown with silver-white markings.

[0043] Insects belonging to the same family of Noctuidae not only differ greatly in morphological characteristics, but also in feeding habits. For example, the cotton bollworm, which is also a member of the Noctuidae family, bores cotton bolls or corn ears, while the Spodoptera litura prefers to bite leaves, leaving only the main veins. Its host range is extremely wide. In addition to corn and soybeans, it can also harm nearly 100 families and more than 300 plants, including melons, eggplants, beans, onions, leeks, spinach, cruciferous vegetables, grains, and cash crops. The host range of the silver-striped armyworm is relatively concentrated on cruciferous vegetables and legumes, and it mainly feeds on leaves. The difference in feeding habits also implies that the enzymes and receptor proteins produced by the digestive system in the body are different. The enzymes produced in the digestive tract are the key points for the Bt gene to work. Only enzymes or receptor proteins that can bind to specific Bt genes can make a certain Bt gene have an insect-resistant effect on the pest. More and more studies have shown that insects of the same order but different families, or even different species of the same family, have different sensitivities to the same Bt protein. For example, Cry1Ab protein has completely different effects on four types of Noctuidae pests. It has good resistance to Helicoverpa armigera, but almost no effect on Spodoptera exigua, Spodoptera litura and Agrotis ipsilon. The above pests all belong to the Noctuidae family of the Lepidoptera order, but the same Bt protein shows different resistance effects on these Noctuidae pests. This fully demonstrates that the interaction between Bt protein and enzymes and receptors in insects is complex and unpredictable.

[0044] In a preferred embodiment, the plant is a monocot or a dicot; in a more preferred embodiment, the plant is soybean.

[0045] The "plant" described in the present invention is any plant, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc.

[0046] The transgenic plants may be in any growth stage.

[0047] In a third aspect, the present invention provides the use of an insecticidal protein for controlling lepidopteran pests, wherein the insecticidal protein comprises an amino acid sequence as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20.

[0048] In a preferred embodiment, the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20 is shown in SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:21, respectively.

[0049] In a preferred embodiment, the lepidopteran pest is Spodoptera exigua.

[0050] In a preferred embodiment, the pesticidal protein is contacted with a lepidopteran pest to thereby control the lepidopteran pest.

[0051] In a preferred embodiment, the insecticidal protein is used to control lepidopteran pests in plants; preferably, the plant is a monocot or a dicot; more preferably, the plant is soybean.

[0052] The amino acid and nucleotide sequences involved in this article are shown in the following table:

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059] The technical solution of the present invention is further illustrated by specific embodiments below.

[0060] Example 1 Acquisition and Synthesis of Cry1Da1 Protein Gene

[0061] The BD1-002 sequence is a patent protected sequence modified by BD1-001 (Cry1Da1). The BD1-001 and BD1-002 sequences are from the public information of patent US10287605B2 or NCBI GenBank: CAA38099.1, and the amino acid sequence is 1165aa in length. BD1-018, BD1-019, BD1-021, BD1-022, and BD1-022S are sequences modified by the inventor based on BD1-001.

[0062] 1. Obtain nucleotide sequence

[0063] The amino acid sequence of BD1-002 insecticidal protein (1165 amino acids) is shown in SEQ ID NO:2 in the sequence listing; the BD1-002 nucleotide sequence (3498 nucleotides) encoding the amino acid sequence corresponding to the BD1-002 insecticidal protein is shown in SEQ ID NO:8 in the sequence listing.

[0064] The amino acid sequence of the BD1-018 insecticidal protein (1165 amino acids) is shown in SEQ ID NO:3 in the sequence listing; the BD1-018 nucleotide sequence (3498 nucleotides) encoding the amino acid sequence corresponding to the BD1-018 insecticidal protein is shown in SEQ ID NO:9 in the sequence listing.

[0065] The amino acid sequence of the BD1-019 insecticidal protein (1165 amino acids) is shown in SEQ ID NO:4 in the sequence listing; the BD1-019 nucleotide sequence (3498 nucleotides) encoding the amino acid sequence corresponding to the BD1-019 insecticidal protein is shown in SEQ ID NO:10 in the sequence listing.

[0066] The amino acid sequence of the BD1-021 insecticidal protein (1165 amino acids) is shown in SEQ ID NO:5 in the sequence listing; the BD1-021 nucleotide sequence (3498 nucleotides) encoding the amino acid sequence corresponding to the BD1-021 insecticidal protein is shown in SEQ ID NO:11 in the sequence listing.

[0067] The amino acid sequence of the BD1-022 insecticidal protein (1161 amino acids) is shown in SEQ ID NO:6 in the sequence listing; the BD1-022 nucleotide sequence (3486 nucleotides) encoding the amino acid sequence corresponding to the BD1-022 insecticidal protein is shown in SEQ ID NO:12 in the sequence listing.

[0068] The amino acid sequence of the BD1-022S insecticidal protein (615 amino acids) is shown in SEQ ID NO:20 in the sequence listing; the BD1-022S nucleotide sequence (1848 nucleotides) encoding the amino acid sequence corresponding to the BD1-022S insecticidal protein is shown in SEQ ID NO:21 in the sequence listing.

[0069] 2. Synthesis of the above nucleotide sequence

[0070] The BD1-002 nucleotide sequence (as shown in SEQ ID NO:8 in the sequence list), the BD1-018 nucleotide sequence (as shown in SEQ ID NO:9 in the sequence list), the BD1-019 nucleotide sequence (as shown in SEQ ID NO:10 in the sequence list), the BD1-021 nucleotide sequence (as shown in SEQ ID NO:11 in the sequence list), the BD1-022 nucleotide sequence (as shown in SEQ ID NO:12 in the sequence list), and the BD1-022S nucleotide sequence (as shown in SEQ ID NO:21 in the sequence list) are synthesized. The 5' end of the synthesized nucleotide sequences (SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:21) is also connected to a BamHI restriction site, and the 3' end is also connected to a Hind III restriction site.

[0071] Example 2 Vector construction, in vitro expression and purification of Cry1Da1 protein

[0072] 1. Construction of a recombinant cloning vector containing Cry1Da1 genes

[0073] 1) Using the BamHI and HindIII restriction sites, the nucleotide sequence of BD1-002 (SEQ ID NO: 8) was cloned and connected to the pET28a plasmid (Novagen, USA, CAT: 69864-3) to obtain the recombinant vector DBN002A. The construction process is as follows: Figure 1As shown (wherein, f1 origin represents the replication origin of bacteriophage f1; Kan represents the kanamycin resistance gene; T7 promoter represents the T7 RNA polymerase promoter; His Tag represents the His tag; BD1-002 represents the BD1-002 nucleotide sequence (SEQ ID NO: 8); T7 terminator represents the T7 terminator). The heat shock method was used to transform Escherichia coli BL21 (DE3) competent cells (Transgen, China, CAT: CD501). The heat shock conditions were: 50 μL of Escherichia coli BL21 (DE3) competent cells, 10 μL of plasmid DNA, 42°C water bath for 30s; 37°C, 100 rpm shaking culture for 1h; then the cultured product was spread on an LB solid plate (1% tryptone, 1% NaCl, 0.5% yeast extract, 1.5% agar) containing 50 mg / L kanamycin (Kanamycin), and cultured at 37°C for 12h. Pick a monoclonal colony and inoculate it in 5mL LB liquid medium (1% tryptone, 1% NaCl, 0.5% yeast extract, pH = 7.5 adjusted with NaOH), add kanamycin with a final concentration of 50mg / L, and place it on a shaker at 37°C, 220rpm for 16h, and use AxyPrep plasmid DNA extraction kit (CORNING, China, CAT: AP-MN-P-50) to extract its plasmid. The obtained plasmid was verified by BamHI and HindIII restriction enzyme digestion, and the positive clone was sequenced and verified. The results showed that the target nucleotide sequence inserted in the positive recombinant cloning vector was the nucleotide sequence shown in SEQ ID NO: 8 in the sequence table, that is, the BD1-002 nucleotide sequence was correctly inserted.

[0074] 2) According to the above method for constructing a recombinant cloning vector, the nucleotide sequence of BD1-018 was connected to pET28a to obtain a recombinant cloning vector DBN018A, wherein BD1-018 is the nucleotide sequence of BD1-018 (SEQ ID NO: 9). The results of enzyme digestion and sequencing verification showed that the nucleotide sequence of BD1-018 in the recombinant cloning vector DBN018A was correctly inserted.

[0075] 3) According to the above method for constructing a recombinant cloning vector, the nucleotide sequence of BD1-019 was connected to pET28a to obtain a recombinant cloning vector DBN019A, wherein BD1-019 is the nucleotide sequence of BD1-019 (SEQ ID NO: 10). The results of enzyme digestion and sequencing verification showed that the nucleotide sequence of BD1-019 in the recombinant cloning vector DBN019A was correctly inserted.

[0076] 4) According to the above method for constructing a recombinant cloning vector, the nucleotide sequence of BD1-021 was connected to pET28a to obtain a recombinant cloning vector DBN021A, wherein BD1-021 is the nucleotide sequence of BD1-021 (SEQ ID NO: 11). The results of enzyme digestion and sequencing verification showed that the nucleotide sequence of BD1-021 in the recombinant cloning vector DBN021A was correctly inserted.

[0077] 5) According to the above method for constructing a recombinant cloning vector, the nucleotide sequence of BD1-022 was connected to pET28a to obtain a recombinant cloning vector DBN022A, wherein BD1-022 is a nucleotide sequence of BD1-022 (SEQ ID NO: 12). The results of enzyme digestion and sequencing verification showed that the nucleotide sequence of BD1-022 in the recombinant cloning vector DBN022A was correctly inserted.

[0078] 6) According to the above method for constructing a recombinant cloning vector, the BD1-022S nucleotide sequence was connected to pET28a to obtain a recombinant cloning vector DBN022SA, wherein BD1-022S is a BD1-022S nucleotide sequence (SEQ ID NO: 21). Enzyme digestion and sequencing verification results showed that the BD1-022S nucleotide sequence in the recombinant cloning vector DBN022SA was correctly inserted.

[0079] 2. In vitro expression of Cry1Da1-like proteins

[0080] 1) Pick a positive monoclonal colony and inoculate it into 5 mL LB liquid culture medium, add kanamycin with a final concentration of 50 mg / L, and culture it on a shaker at 37°C and 220 rpm for 16 h to obtain an activated strain.

[0081] 2) The bacterial solution was transferred to 2×YT medium (1.6% tryptone, 0.5% NaCl, 1% yeast extract) at a ratio of 1:10 and cultured on a shaker at 37° C. and 220 rpm for 1 h.

[0082] 3) When the culture medium OD600 = 0.6-0.8, add IPTG with a final concentration of 0.5 mM to induce expression, and culture on a shaker at 37°C and 220 rpm for 6 h.

[0083] 4) 7000rpm, 5min to collect the cells, discard the supernatant, and resuspend the cells with an appropriate amount of PBS buffer. Ultrasonic disruption of the cells to obtain disrupted bacterial solution. The disrupted bacterial solution was centrifuged at 7000rpm for 5min to obtain soluble and insoluble components, wherein the insoluble component was resuspended with PBS buffer.

[0084] 5) Take an appropriate amount of sample and perform SDS-PAGE detection. The results show that the target protein is mainly present in the soluble component.

[0085] 3. Purification of Cry1Da1-like proteins

[0086] 1) Using the AKTA rapid purification system, the soluble components were purified using the HisTrap HP nickel column to obtain purified Cry1Da1-like proteins; the purified proteins were desalted and purified using the HiTrap Desalting column. The operation steps refer to the AKTA operation manual.

[0087] 2) Take an appropriate amount of the desalted and purified sample and perform SDS-PAGE detection.

[0088] 3) Calculate the protein concentration in the desalted protein solution based on the BSA standard curve.

[0089] 4) The purified protein was stored at -20°C for future use.

[0090] Example 3 Feeding and testing of Spodoptera exigua

[0091] The purified protein solution was mixed with the feed of Spodoptera exigua (final concentration 100ug / g), mixed evenly and placed in a culture dish. Healthy, unfed newly hatched larvae of Spodoptera exigua were selected as test insects, and 10 larvae were inoculated. After the insect test culture dish was covered, it was placed under the conditions of temperature 25-28°C, relative humidity 70%, and photoperiod (light / dark) 16:8 until the experiment was ended on the third day. The mortality rate of Spodoptera exigua larvae was counted, and the mortality rate = number of dead insects / total number of insects × 100%. The feed with only CBS buffer added and the feed with only sterile water added were used as negative controls. Each system was repeated 6 times, and the experiment was repeated 2 times. The mortality rate of the CBS buffer treatment group was used as the control mortality rate, and the corrected mortality rate of each treatment group was calculated. Corrected mortality rate = (treatment mortality rate-control mortality rate) / (1-control mortality rate) × 100%. The results are shown in Table 1.

[0092] Table 1. Results of feeding test on Spodoptera exigua

[0093]

[0094] The results showed that the Spodoptera exigua that had eaten the Cry1Da1 protein described in the present application had a higher corrected mortality rate, indicating that the Cry1Da1 protein described in the present application had good insecticidal activity against the Spodoptera exigua.

[0095] Example 4 Obtaining transgenic soybean plants

[0096] 4.1 Construction of recombinant expression vector

[0097] The expression vector DBNBC-001 (vector backbone: pCAMBIA2301, provided by CAMBIA) was digested with restriction endonucleases AscⅠ and HindⅢ, and the BD1-002 nucleotide sequence was amplified using primer 1 (SEQ ID NO: 13) and primer 2 (SEQ ID NO: 14). The amplified BD1-002 nucleotide sequence fragment was inserted into the restriction endonuclease AscⅠ and HindⅢ cleavage sites of the expression vector DBNBC-001 by seamless cloning to construct a recombinant expression vector DBN002A-B. The construction process is as follows: Figure 2 As shown in the figure (RB: right border; eFMV: enhancer; prBrCBP: CBP1 gene promoter; spAtCTP2: signal peptide; cEPSPS: 5-enolpyruvylshikimate-3-phosphate synthase; tPsE9: pea ribulose-1,5-bisphosphate carboxylase / oxygenase small subunit E9 protein gene terminator; prAtUbi10: Arabidopsis thaliana ubiquitin (Ubiquitin) gene promoter; BD1-002: BD1-002 nucleotide sequence (SEQ ID NO: 8); tNos: nopaline synthase (nos) terminator; pr35s: cauliflower mosaic virus 35S promoter; PAT: phosphinothricin acetyltransferase gene; t35s: cauliflower mosaic virus 35S terminator; LB: left border). The method for constructing the vector is well known to those skilled in the art.

[0098] The recombinant expression vector DBN002A-B was transformed into Escherichia coli T1 competent cells by heat shock method, and the heat shock conditions were as follows: 50 μL Escherichia coli T1 competent cells, 10 μL plasmid DNA, 42°C water bath for 30s; 37°C shaking culture for 1h (shaking on a shaker at 100rpm); then the cultured product was spread on an LB solid plate containing 50mg / L kanamycin and cultured at 37°C for 12h. A single clone colony was picked and inoculated into 5mL LB liquid culture medium, and kanamycin with a final concentration of 50mg / L was added, and the culture was placed on a shaker at 37°C and 220rpm for 16h. A single clone colony was picked, and kanamycin with a final concentration of 50mg / L was added to the LB liquid culture medium, and the culture was carried out overnight at 37°C. The plasmid was extracted using the AxyPrep plasmid DNA extraction kit. The extracted plasmid was digested with restriction endonucleases AscⅠ and HindⅢ and identified, and the positive clones were sequenced and identified. The results showed that the nucleotide sequence of the recombinant expression vector DBN002A-B between the AscⅠ and HindⅢ cleavage sites was the nucleotide sequence shown in SEQ ID NO:8 in the sequence listing, i.e., the BD1-002 nucleotide sequence.

[0099] According to the above method for constructing DBN002A-B, primer 1 (SEQ ID NO: 13) and primer 3 (SEQ ID NO: 15) were used to amplify the BD1-018 nucleotide sequence, and the amplified BD1-018 nucleotide sequence fragment was inserted into the expression vector DBNBC-001 restriction site by seamless cloning to obtain the recombinant expression vector DBN018A-B. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN018A-B contained the nucleotide sequence shown in SEQ ID NO: 9 in the sequence table, i.e., the BD1-018 nucleotide sequence.

[0100] According to the above method for constructing DBN002A-B, primer 1 (SEQ ID NO: 13) and primer 3 (SEQ ID NO: 15) were used to amplify the BD1-019 nucleotide sequence, and the amplified BD1-019 nucleotide sequence fragment was inserted into the expression vector DBNBC-001 restriction site by seamless cloning to obtain the recombinant expression vector DBN019A-B. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN019A-B contained the nucleotide sequence shown in SEQ ID NO: 10 in the sequence table, i.e., the BD1-019 nucleotide sequence.

[0101] According to the method for constructing DBN002A-B, primer 1 (SEQ ID NO: 13) and primer 3 (SEQ ID NO: 15) were used to amplify the BD1-021 nucleotide sequence, and the amplified BD1-021 nucleotide sequence fragment was inserted into the expression vector DBNBC-001 restriction site by seamless cloning to obtain the recombinant expression vector DBN021A-B. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN021A-B contained the nucleotide sequence shown in SEQ ID NO: 11 in the sequence table, i.e., the BD1-021 nucleotide sequence.

[0102] According to the above method for constructing DBN002A-B, primer 1 (SEQ ID NO: 13) and primer 4 (SEQ ID NO: 16) were used to amplify the BD1-022 nucleotide sequence, and the amplified BD1-022 nucleotide sequence fragment was inserted into the expression vector DBNBC-001 restriction site by seamless cloning to obtain the recombinant expression vector DBN022A-B. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN022A-B contained the nucleotide sequence shown in SEQ ID NO: 12 in the sequence table, i.e., the BD1-022 nucleotide sequence.

[0103] According to the method for constructing DBN002A-B, primer 1 (SEQ ID NO: 13) and primer 7 (SEQ ID NO: 22) were used to amplify the BD1-022S nucleotide sequence, and the amplified BD1-022S nucleotide sequence fragment was inserted into the expression vector DBNBC-001 restriction site by seamless cloning to obtain the recombinant expression vector DBN022SA-B. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN022SA-B contained the nucleotide sequence shown in SEQ ID NO: 21 in the sequence table, i.e., the BD1-022S nucleotide sequence.

[0104] 4.2 Transformation of Agrobacterium with recombinant expression vector

[0105] The correctly constructed recombinant expression vectors DBN002A-B, DBN018A-B, DBN019A-B, DBN021A-B, DBN022A-B and DBN022SA-B were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) by liquid nitrogen method. The transformation conditions were as follows: 100 μl Agrobacterium LBA4404, 3 μl plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 minutes, and warm water bath at 37°C for 10 minutes; the transformed Agrobacterium LBA4404 was inoculated in an LB test tube at a temperature of 28°C and a rotation speed of 200 rpm. After culturing for 2 hours, the cells were plated on LB plates containing 50 mg / L rifampicin and 100 mg / L kanamycin until a positive single clone grew out. The single clone was picked for culture and its plasmid was extracted. The recombinant expression vectors DBN002A-B, DBN018A-B, DBN019A-B, DBN021A-B, DBN022A-B and DBN022SA-B were digested with restriction endonucleases and then verified. The results showed that the structures of the recombinant expression vectors DBN002A-B, DBN018A-B, DBN019A-B, DBN021A-B, DBN022A-B and DBN022SA-B were completely correct.

[0106] 4.3 Agrobacterium infection of soybean plants

[0107] According to the conventional Agrobacterium infection method, the cotyledonary node tissue of the aseptically cultured soybean variety SY2043C was co-cultured with Agrobacterium transformed with the recombinant expression vector, and the T-DNA of the recombinant expression vector DBN002A-B was transferred into the soybean chromosome group to obtain soybean plants with the BD1-002 nucleotide sequence; at the same time, wild-type soybean plants were used as controls.

[0108] According to the above method for obtaining soybean plants containing BD1-002, soybean plants into which BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequences were transferred were obtained. For Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in soybean germination medium (B5 salt 3g / L, B5 vitamins, sucrose 20g / L, agar 8g / L, pH=5.6), and the seeds were inoculated on the germination medium and cultured under the following conditions: temperature 25±1°C; photoperiod (light / dark) 16 / 8h. After germination for 4 to 6 days, the swollen soybean sterile seedlings at the cotyledon node of bright green were taken, the hypocotyl was cut 3 to 4mm below the cotyledon node, the cotyledons were cut longitudinally, and the terminal buds, lateral buds and seed roots were removed. Wound the cotyledon node with the back of a scalpel, and contact the wounded cotyledon node tissue with an Agrobacterium suspension, wherein the Agrobacterium is capable of transmitting the Cry1Da1 nucleotide sequence to the wounded cotyledon node tissue (step 1: infection step). In this step, the cotyledon node tissue is preferably immersed in an Agrobacterium suspension (OD660 = 0.5-0.8), and an infection medium (MS salt 2g / L, B5 vitamins, sucrose 20g / L, glucose 10g / L, 2-morpholineethanesulfonic acid (MES) 4g / L, zeatin (ZT) 2mg / L, acetosyringone 40mg / L, pH = 5.3) to initiate inoculation. The cotyledon node tissue is co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Preferably, the cotyledonary node tissue is cultured on solid medium (MS salts 4 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, agar 8 g / L, MES 4 g / L, ZT 2 mg / L, pH=5.6) after the infection step. After this co-cultivation phase, there may be an optional "recovery" step. In the "recovery" step, at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium is present in the recovery medium (B5 salts 3 g / L, B5 vitamins, agar 8 g / L, sucrose 30 g / L, MES 1 g / L, ZT 2 mg / L, cephalosporin 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, pH=5.6), and no selective agent for plant transformants is added (step 3: recovery step). Preferably, the tissue pieces regenerated from the cotyledonary node are cultured on solid medium with antibiotics but without selective agents to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the tissue pieces regenerated from the cotyledonary nodes are cultured on a medium containing a selection agent (phosphinothricin) and growing transformed calli are selected (step 4: selection step).Preferably, the tissue pieces regenerated from the cotyledonary nodes are cultured on a screening solid medium with a selection agent (sucrose 30 g / L, agar 8 g / L, B5 salt 3 g / L, B5 vitamins, MES 1 g / L, 6-benzyladenine 1 mg / L, cephalosporin 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, glufosinate 6 mg / L, pH = 5.6), resulting in selective growth of the transformed cells. Then, the transformed cells are regenerated into plants (step 5: regeneration step), preferably, the tissue pieces regenerated from the cotyledonary nodes grown on a medium containing a selection agent are cultured on a solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0109] The resistant tissue blocks obtained by screening were transferred to the B5 differentiation medium (B5 salt 3.1g / L, B5 vitamins, MES1g / L, sucrose 30g / L, ZT 1mg / L, agar 8g / L, cephalosporin 150mg / L, glutamic acid 50mg / L, aspartic acid 50mg / L, gibberellin 1mg / L, auxin 1mg / L, glufosinate 6mg / L, pH=5.6), and cultured at 25°C for differentiation. The differentiated seedlings were transferred to the B5 rooting medium (B5 salt 3.1g / L, B5 vitamins, MES1g / L, sucrose 30g / L, agar 8g / L, cephalosporin 150mg / L, indole-3-butyric acid 1mg / L), cultured at 25°C to a height of about 10cm on the rooting medium, and moved to the greenhouse for culture until fruiting. In the greenhouse, culture was carried out at 26°C for 16h every day and then at 20°C for 8h.

[0110] 4.4 Identification of genetically modified soybean materials

[0111] About 100 mg of leaves of soybean plants into which BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequences were respectively taken as samples, and their genomic DNA was extracted using Qiagen's Dneasy Plant Maxi Kit. The copy number of the PAT gene was detected by the Taqman probe fluorescence quantitative PCR method to determine the copy number of the Cry1Da1 gene. At the same time, the wild-type SY2043C soybean plant was used as a control, and the detection and analysis were carried out according to the above method, and the experiment was repeated 3 times. The experimental results of analyzing the copy number of the target gene showed that the BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequences had been integrated into the chromosome sets of the tested soybean plants, respectively, and the soybean plants introduced with the BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequences had obtained single-copy transgenic soybean plants. The single-copy transgenic soybean plants were selected for breeding to obtain soybean seeds.

[0112] The specific method for detecting the copy number of PAT gene is as follows:

[0113] Step 1, taking 100 mg of leaves of soybean plants introduced with BD1-002 nucleotide sequence, soybean plants introduced with BD1-018 nucleotide sequence, soybean plants introduced with BD1-019 nucleotide sequence, soybean plants introduced with BD1-021 nucleotide sequence, soybean plants introduced with BD1-022 nucleotide sequence, soybean plants introduced with BD1-022S nucleotide sequence and wild-type soybean plants, respectively, and grinding them into homogenate with liquid nitrogen in a mortar, and taking 3 replicates for each sample;

[0114] Step 2: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. For specific methods, refer to its product manual;

[0115] Step 3, using NanoDrop 2000 (Thermo Scientific) to measure the genomic DNA concentration of the above samples;

[0116] Step 4, adjusting the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80 to 100 ng / μL;

[0117] Step 5: Use Taqman probe fluorescence quantitative PCR method to identify the copy number of the sample, use the sample with known copy number as the standard, and use the sample of wild-type soybean plant as the control. Each sample is repeated 3 times and the average value is taken. The sequences of fluorescence quantitative PCR primers and probes are:

[0118] Primer 5: gagggtgttgtggctggtattg as shown in SEQ ID NO: 17 in the sequence listing;

[0119] Primer 6: tctcaactgtccaatcgtaagcg as shown in SEQ ID NO: 18 in the sequence listing;

[0120] Probe 1: cttacgctgggccctggaaggctag as shown in SEQ ID NO: 19 in the sequence listing;

[0121] The PCR reaction system is:

[0122]

[0123] The 50× primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration, and 860 μL of 1× TE buffer and was stored in an amber tube at 4°C.

[0124] The PCR reaction conditions were:

[0125]

[0126] Return to step 1 and perform 40×cycle

[0127] Data were analyzed using IBM SPSS software.

[0128] Example 5: The anti-insect effect of transgenic soybean on Spodoptera exigua

[0129] When soybean plants grow to the V3 stage, the second leaf from the bottom is taken for the silver-striped moth bioassay. Rinse the leaves with sterile water and dry the water, then remove the veins of the soybean leaves and cut them into strips of about 2 cm × 3.5 cm. Take one of the cut strips and put it on the moisturizing filter paper at the bottom of the round plastic culture dish. Put 10 newly hatched larvae of the silver-striped moth in each culture dish. After the insect test culture dish is covered, place it at a temperature of 25-28°C, a relative humidity of 70%, and a photoperiod (light / dark) of 16:8 for 3 days. Statistic the mortality rate of the silver-striped moth larvae and the damage to the leaves. The mortality rate = the number of dead insects / the total number of insects × 100%, and the insect inhibition rate is the ratio of the number of insects whose age is less than the number of insects in the control. Soybeans with the same genetic background and without insect-resistant protein were used as negative controls to calculate the corrected mortality rate, and the calculation formula is the same as above. The results are shown in Table 2.

[0130] Table 2. Test results of transgenic plants against Spodoptera argentea

[0131]

[0132] As can be seen from Table 2, compared with the negative control, the soybean plants expressing the Cry1Da1 protein constructed in the present application have a higher inhibition rate on the silver-cut armyworm, an increased mortality rate of the silver-cut armyworm, and a significantly reduced leaf damage rate. This indicates that the soybean plants expressing the Cry1Da1 protein constructed in the present application can not only inhibit the development of the silver-cut armyworm, but also reduce the insect's feeding on the leaves, and have a significant insect-resistant effect.

[0133] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention.

[0134] References:

[0135] 1.Bacillus thuringiensis Cry1Da_7and Cry1B.868Protein Interactionswith Novel Receptors Allow Control of Resistant Fall Armyworms,Spodopterafrugiperda(JESmith).(2019)Appl Environ Microbiol 85.

Claims

1. A method for controlling lepidopteran pests, comprising contacting the lepidopteran pests with an insecticidal protein comprising an amino acid sequence as shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO:

20.

2. A method for controlling lepidopteran pests, comprising introducing a nucleic acid molecule encoding an insecticidal protein into a plant, allowing the lepidopteran pests to feed on the plant, wherein the insecticidal protein comprises an amino acid sequence as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:

20.

3. The method according to claim 1 or 2, wherein the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20 is shown in SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:21, respectively.

4. The method according to claim 1 or 2, wherein the lepidopteran pest is Spodoptera exigua.

5. The method according to claim 2, wherein the plant is a monocot or a dicot; preferably, the plant is soybean.

6. Use of an insecticidal protein for controlling lepidopteran pests, wherein the insecticidal protein comprises an amino acid sequence as shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO:

20.

7. The use according to claim 6, wherein the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20 is shown in SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:21, respectively.

8. The use according to claim 6 or 7, wherein the lepidopteran pest is Spodoptera exigua.

9. The use according to claim 6 or 7, wherein the insecticidal protein is contacted with lepidopteran pests to control the lepidopteran pests.

10. The use according to claim 6 or 7, wherein the insecticidal protein is used to control lepidopteran pests in plants; preferably, the plant is a monocotyledonous plant or a dicotyledonous plant; more preferably, the plant is soybean.

Images