Gene for improving salt tolerance of pyridine degrading bacteria and application

Abstract

The invention relates to a gene for improving the salt tolerance of pyridine degrading bacteria and application, and solves the technical problem that the degradation efficiency of the existing bacterial strain is limited by salinity, and the nucleotide sequence of the salt-tolerant gene is as shown in SEQ ID NO.1. The invention also provides a protein, a recombinant plasmid and a host cell containing the gene. The method can be widely applied to degradation of high-salt pyridine wastewater.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a gene for improving the salt tolerance of pyridine-degrading bacteria and its application. Background Art

[0002] Microbial salt-tolerance genes refer to genes that enable microorganisms to maintain normal physiological functions in a high-salt environment. These genes help microorganisms adapt to high-salt stress through a variety of mechanisms, including regulating intracellular ion balance, accumulating compatible solutes, and enhancing membrane stability. The study of salt-tolerance genes not only helps to reveal the adaptation mechanism of microorganisms, but also has important application value in agriculture, environmental remediation, and biotechnology. The expression and stability of salt-tolerance genes under different environmental conditions need further study to ensure their reliability and effectiveness in practical applications. At the same time, the construction of salt-tolerant genetically engineered bacteria faces many technical limitations, and it is necessary to comprehensively consider multiple factors such as gene selection, expression regulation, host bacteria selection, and environmental adaptability to achieve efficient and stable salt tolerance. Salt tolerance is usually a complex trait controlled by multiple genes. The modification of a single gene is often difficult to significantly improve salt tolerance and may not be able to completely overcome salt stress.

[0003] Currently, the screening of salt-tolerant strains mostly relies on natural isolation, but their degradation efficiency is still limited by salinity. Summary of the invention

[0004] In order to solve the technical problem that the degradation efficiency of existing strains is limited by salinity, the present invention provides a gene and application capable of improving the pyridine degradation efficiency and salt tolerance of the strain.

[0005] To this end, the present invention provides a salt-tolerant gene hj102, whose nucleotide sequence is shown in SEQ ID NO.1.

[0006] The present invention also provides a protein encoded by the salt-tolerant gene hj102, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0007] The invention also provides a recombinant plasmid, which contains the gene sequence of the salt-tolerant gene hj102.

[0008] The present invention also provides a host cell, wherein the host cell contains the recombinant plasmid, and the recombinant plasmid contains the gene sequence of the salt-tolerant gene hj102.

[0009] The present invention also provides the use of the salt-tolerant gene, the protein, the recombinant plasmid or the host cell in improving the salt tolerance of microorganisms.

[0010] Preferably, the host cells include Escherichia coli and Rhodococcus, and also include the use of other microorganisms as host cells to enhance their salt tolerance.

[0011] Preferably, the host is Rhodococcus, and the salt tolerance and degradation capabilities are improved by expressing the salt-tolerant gene hj102 described in claim 1.

[0012] Beneficial effects of the present invention: 1. The salt-tolerance gene provided by the invention can be used to transform the salt-tolerance ability of microorganisms, providing a new idea and strategy for improving the salt-tolerance ability of microorganisms and enriching the salt-tolerance gene pool; 2. The present invention applies salt-tolerant genes to pyridine-degrading bacteria Rhodococcus sp. In PD04, the strain's ability to grow and degrade pyridine under high salt conditions was enhanced. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It indicates the effect of salt-tolerance gene hj102 on the growth of Escherichia coli BW25113 under 35 g / L NaCl salt stress; Figure 2 Indicates the salt tolerance gene hj102 under 40 g / L NaCl salt stress Rhodococcus sp. PD04 growth and degradation of pyridine. DETAILED DESCRIPTION

[0014] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0015] Some of the reagents and culture medium used in the present invention are prepared as follows: LB medium (g / L): 5.0% yeast powder, 10.0% tryptone, 10.0% NaCl. When preparing solid culture medium, add 2% agar powder to the above formula.

[0016] M9 medium (g / L): glucose 4.0, Na 2 HPO 4 12H 2 O 17.09, KH 2 PO 4 3.0, NH 4 Cl 1.0, NaCl 0.5, MgSO 4 7H 2 O 0.492, CaCl 2 0.01.

[0017] MSM medium (g / L): K 2 HPO 4·3H 2 O 0.3, NaH 2 PO 4 ·2H 2 O 0.2, MnSO 4 ·4H 2 O 0.01, MgSO 4 7H 2 O 0.05, FeSO 4 7H 2 O 0.01, add NaCl solid as needed to prepare culture medium with different salinity.

[0018] Example 1 Mining of salt-tolerant genes The salt-tolerance gene hj102 originates from the granular sludge metagenome data, which is submitted to the NMDC database with the number NMDC40061105 and the publication date of October 18, 2024.

[0019] The specific process of obtaining the salt-tolerant gene hj102 is as follows: using the publicly reported salt-tolerant gene sequence as the query sequence, the Blastx alignment tool was used to conduct a deep alignment analysis of the granular sludge metagenome data, screen out a series of potential salt-tolerant elements, and finally construct a potential salt-tolerant element library. Blastx / Blastp alignment and conservation analysis were performed through the NCBI database, and no association was found between the gene hj102 and the salt-tolerant function. Furthermore, the hj102 gene was cloned from the granular sludge metagenome, and its salt-tolerant function was verified by molecular biology experiments.

[0020] Example 2 Construction of Escherichia coli recombinant expression vector In order to construct a recombinant expression vector for heterologous expression of hj102 in E. coli, primers F1 / R1 were designed to amplify the full-length coding sequence of hj102 with reference to the coding sequence of the target gene provided in SEQ ID NO.1, and primers F2 / R2 were used to perform PCR amplification on the pFsBADG plasmid vector to linearize it (the underlined part in the primer is the homology arm). The amplified target fragment and the linearized plasmid vector were purified and fused using the Gibson assembly technology, and transformed into the competent E. coli Top10. After selecting the positive clones, sequencing was performed to obtain the correct recombinant expression vector pFsBADG-hj102.

[0021] F1 (SEQ ID NO.3): gctaacaggaggaattaaccATG GCAGCTGCTGGCTTCTTGG R1 (SEQ ID NO.4): ctgcgttctgatttaatctgTTAATTTTCACCATTGGTTTCACCAAGCG F2 (SEQ ID NO.5): TAACAGATTAAATCAG AACGCAGAAGCGG R2 (SEQ ID NO.6): CATggttaattcctcctgttagc aaagttaaac Example 3 Heterologous expression and functional verification of salt-tolerance genes in Escherichia coli The sequenced recombinant expression vector pFsBADG-hj102 and the empty plasmid vector pFSBADG were transformed into Escherichia coli BW25113 (this strain is a common strain and can be purchased from the open market) to obtain recombinant bacteria. E. coli BW25113 / pFsBADG-hj102 and control strains E. coli BW25113 / pFsBADG.

[0022] Pick a single colony with good growth and inoculate it into 5 mL LB liquid medium (Gm R , 50 μg / mL) in a test tube and cultured overnight at 37°C and 200 rpm. The next day, the seed solution was transferred to 50 mL of fresh LB liquid medium (Gm R , 50 μg / mL) in a 250 mL shake flask, and wait until the bacterial concentration OD 600 When the p-value reached 0.6-0.8, arabinose solution with a final concentration of 0.2% was added and the expression was induced for 15 h at 25°C and 200 rpm.

[0023] The bacterial solution was centrifuged at 5000 rpm and 4°C for 5 min, the cells were collected, washed twice with 0.9% NaCl solution, and resuspended with an appropriate amount of 0.9% NaCl solution to make the cell concentration OD 600 = 10. The concentrated bacterial solution was transferred to 25 mL M9 medium (Gm R , 50 μg / mL, 35 g / L NaCl) in a 100 mL shake flask, and at the same time add arabinose solution with a final concentration of 0.2%, culture at 37°C, 200 rpm, and measure OD every 4 h. 600 And record the growth curve, the results are as follows Figure 1 shown.

[0024] It can be seen that E. coli BW25113 heterologously expressing the hj102 gene showed stronger growth ability under the same concentration of salt stress, and its growth delay period was shortened from the original 12 h to 4 h, and the maximum growth OD 600 The maximum OD value of the control group can reach 3.59 (20 h), which is higher than that of the control group. 600 0.91 (36 h) was increased by 2.95 times. These results indicate that hj102 gene is an effective salt tolerance gene.

[0025] Example 4 Construction of a recombinant expression vector of Rhodococcus In order to construct a recombinant expression vector for heterologous expression of hj102 in Rhodococcus pyridinophilus, primers F3 / R3 were designed to amplify the full-length coding sequence of hj102 with reference to the coding sequence of the target gene provided in SEQ ID NO.1, and primers F4 / R4 were used to perform PCR amplification on the pNV18 plasmid vector to linearize it (the underlined part in the primer is the homology arm). The amplified target fragment and the linearized plasmid vector were purified and fused using the Gibson assembly technology, and transformed into Escherichia coli Top10 competent cells. After selecting positive clones, sequencing was performed to obtain the correct recombinant expression vector pNV18-hj102.

[0026] F3 (SEQ ID NO.7): GCTATGACCATGATTACATG GCAGCTGCTGGCTTCTTGG R3 (SEQ ID NO.8): AAACGACGGCCAGTGCCTTA ATTTTCACCATTGGTTTCACCAAGCG F4 (SEQ ID NO.9): TAAGGCACTGGCCGTCGTTT TACAAC R4 (SEQ ID NO.10): CATGTAATCATGGTCATAGC TGTTTCCTGTGTG Example 5 The role of salt-tolerance genes in the degradation of pyridine by Rhodococcus sp. Pyridine-degrading bacteria Rhodococcus sp. PD04 is the host cell (reference: Huo D, Hu Y, Li L, Gao H, Wang M, Guan H, Zhang Q, Yu B. (2024), Complete genome sequence of Rhodococcussp. strain PD04, a pyridine-degrading bacterium under hypersaline condition. Microbiol Resour Announc, 13:e00103-24. The applicant guarantees that the strain will be released to the public within 20 years from the date of application). The purpose of this study is to investigate the effect of the salt-tolerance gene hj102 on the growth and pyridine degradation of the strain under high-salt conditions.

[0027] The recombinant expression vector pNV18-hj102 with correct sequencing and the empty plasmid vector pNV18 were transformed into pyridine-degrading bacteria using the electroporation method. Rhodococcus sp. PD04, and obtained recombinant bacteria Rhodococcus sp. / pNV18-hj102 and control strains Rhodococcus sp. / pNV18.

[0028] Pick a single colony with good growth and inoculate it in a test tube containing 5 mL LB liquid medium, and culture it overnight at 30°C and 200 rpm. The next day, transfer the seed liquid to a 250 mL shake flask containing 50 mL fresh LB liquid medium at a 1% inoculum to continue to expand the culture. When the bacteria grow to the late logarithmic growth stage, centrifuge at 5000 rpm for 10 min to collect the bacteria, wash them three times with 0.9% NaCl solution, and keep a small amount of supernatant for resuspending the bacteria to prepare a bacterial suspension.

[0029] Take appropriate amount of bacterial suspension and add it to MSM medium (40 g / L NaCl) to adjust the initial OD 600 =0.1, and pyridine was added to a final concentration of about 500 mg / L, followed by incubation at 30°C, 200 rpm on a shaker, sampling was performed at 24 h intervals, and a control group without adding any strains was set up.

[0030] like Figure 2 As shown, compared with the control strain Rhodococcus sp. / pNV18, a recombinant strain heterologously expressing the salt tolerance gene hj102 Rhodococcus sp. / pNV18-hj102 showed faster growth and pyridine degradation in a medium with a salinity of 4%. Rhodococcus sp. / pNV18-hj102 rapidly entered the logarithmic growth phase after a 24-h hysteresis period and rapidly degraded pyridine. At 120 h, the strain grew to an OD 600The maximum value was 0.639, and the pyridine content was reduced from the initial 491.7 mg / L to 3.0 mg / L, with a degradation rate of up to 99.4%. These results highlight the important role of salt-tolerant genes in the degradation of pyridine by Rhodococcus in high-salinity environments, providing an effective solution for the efficient degradation of pyridine pollutants in high-salinity environments.

[0031] The above description is only for the preferred embodiments of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the scope of the claims of the present invention shall be within the scope of protection of the present invention.

Claims

1. A salt-tolerance gene, characterized in that: The nucleotide sequence of the salt-tolerant gene is shown in SEQ ID NO.

1.

2. A protein encoded by the salt-tolerant gene according to claim 1, wherein the amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. A recombinant plasmid, characterized in that: The recombinant plasmid comprises the gene sequence according to claim 1.

4. A host cell, characterized in that: The host cell contains the recombinant plasmid according to claim 3.

5. Use of the salt-tolerant gene according to claim 1, the protein according to claim 2, the recombinant plasmid according to claim 3, or the host cell according to claim 4 in improving the salt tolerance of microorganisms.

6. The use according to claim 5, characterized in that: The host cells include Escherichia coli and Rhodococcus, and also include the use of other microorganisms as host cells to enhance their salt tolerance.

7. Use of the host cell according to claims 5 and 6 in the degradation of high-salt pyridine wastewater, wherein the host is Rhodococcus, and the salt tolerance and degradation capacity are improved by expressing the salt-tolerant gene according to claim 1.

Images