Application of biological material overexpressing IFI16 gene in preparation of drug for resisting dengue virus

Abstract

The invention provides application of an IFI16 gene overexpression biological material in preparation of an anti-dengue virus drug, and belongs to the technical field of anti-dengue virus. According to the invention, differentially expressed genes after host cells transfect viruses are found, and the differentially expressed genes are analyzed, so that the key genes related to dengue virus resistance are determined; it is determined that the over-expressed IFI16 gene has the effect of inhibiting dengue virus replication and can be used for preparing the anti-dengue virus medicine.

Description

Technical Field

[0001] The invention belongs to the technical field of anti-dengue virus, and in particular relates to application of a biological material over-expressing an IFI16 gene in preparing an anti-dengue virus drug. Background Art

[0002] Dengue virus (DENV) is a member of the Flaviviridae family. Other important pathogens in this genus include Zika virus and yellow fever. Dengue virus is a single-stranded positive-strand RNA virus that is mainly transmitted to humans by Aedes aegypti and Aedes albopictus. DENV has four antigenically different serotypes (DENV-1-4). Human infection with DENV is usually asymptomatic or causes a series of self-limiting symptoms, including fever and rash. However, some patients will develop fatal dengue hemorrhagic fever / dengue shock syndrome (DHF / DSS).

[0003] Dengue virus enters cells via receptor-mediated endocytosis, releasing a single-stranded RNA genome of approximately 11 kb into the cytoplasm. The viral genomic RNA contains an open reading frame (ORF) that encodes a single polyprotein flanked by a capped 5' untranslated region (UTR) and a non-polyadenylated 3'UTR and serves as a template for the translation of viral precursor proteins. The single polyprotein is then co- and post-translationally cleaved into three structural proteins (C, prM, and E) and seven nonstructural (NS) proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5). Structural proteins are used for the assembly of viral particles, while nonstructural proteins are mainly involved in the synthesis of the viral RNA genome and further translation processes in DENV infection.

[0004] At present, although the research on the mechanism of interaction between dengue virus and host has developed rapidly, the host's anti-infection immune mechanism is still unclear. Therefore, the identification of key target molecules of dengue virus and the development of anti-dengue virus drugs are the next research focus. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a use of a biomaterial overexpressing the IFI16 gene in the preparation of an anti-dengue virus drug.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides an application of a biological material overexpressing an IFI16 gene in preparing an anti-dengue virus drug. Overexpressing the IFI16 gene inhibits the replication of the dengue virus. The nucleotide sequence of the IFI16 gene is shown in SEQ ID NO: 1.

[0008] Preferably, the IFI16 gene inhibits the replication of dengue virus in human alveolar basal epithelial cells of lung cancer by upregulating one or more of the ISG15 gene, XAF1 gene, IFI44L gene, OASL gene, OAS2 gene, IFI44 gene, CXCL10 gene, MX1 gene, IFI35 gene and IFIT1 gene.

[0009] Preferably, the biological material for overexpressing the IFI16 gene includes a plasmid, and the plasmid is pcDNA3.1-IFI16. The pcDNA3.1-IFI16 uses pcDNA3.1 as an initial vector, and an IFI16 gene fragment is cloned between the restriction sites of the NheI enzyme and the NotI enzyme of pcDNA3.1.

[0010] Preferably, the concentration of the plasmid is 3 ng / μL to 30 ng / μL.

[0011] The present invention also provides the use of a biological material over-expressing the IFI16 gene in preparing a reagent for inhibiting the replication of dengue virus in cells.

[0012] Preferably, the cells comprise lung cancer human alveolar basal epithelial cells.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The present invention identifies key genes related to resistance to dengue virus by searching for genes differentially expressed after host cells are transfected with the virus, analyzing the differentially expressed genes, and determining that overexpression of the IFI16 gene has a significant effect of inhibiting dengue virus replication, and can be used to prepare anti-dengue virus drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is a graph showing the results of protein interaction (PPI) analysis of key genes screened for resistance to dengue virus;

[0016] Figure 2 Is the effect of knocking down the IFI16 gene on the replication of dengue virus type 2;

[0017] Figure 3 The effect of overexpression of IFI16 gene on the replication of dengue virus type 2. DETAILED DESCRIPTION

[0018]

[0019] In the present invention, the IFI16 gene inhibits the replication of dengue virus in human alveolar basal epithelial cells of lung cancer by upregulating one or more of the ISG15 gene, XAF1 gene, IFI44L gene, OASL gene, OAS2 gene, IFI44 gene, CXCL10 gene, MX1 gene, IFI35 gene and IFIT1 gene.

[0020] In the present invention, the biological material for overexpressing the IFI16 gene includes a plasmid, the plasmid is pcDNA3.1-IFI16, the pcDNA3.1-IFI16 uses pcDNA3.1 as the initial vector, and the IFI16 gene fragment is cloned between the restriction sites of the NheI enzyme and the NotI enzyme of pcDNA3.1; the concentration of the plasmid is preferably 3ng / μL~30ng / μL, and further preferably 5ng / μL~25ng / μL; the knockdown of IFI16 gene expression increases the replication of dengue virus; the sequence of the siRNA for knocking down the IFI16 gene is: positive chain: GGACGACUGACCACAAUCA (SEQ ID NO: 4), antisense chain: UGAUUGUGGUCAGUCGUG (SEQ ID NO: 5).

[0021] The present invention also provides the use of a biological material overexpressing the IFI16 gene in preparing an agent for inhibiting the replication of dengue virus in cells. In the present invention, the cells include lung cancer human alveolar basal epithelial cells.

[0022] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0023] Materials used in the present invention: A549 cells are laboratory preserved and cultured;

[0024] Fetal bovine serum, trypsin, sodium penicillin, streptomycin, and DMEM culture medium were purchased from Gibco, USA; PrimeScriptTM RT Reagent Kit, TB Premix Ex Taq TM II was purchased from Takara, Japan; 3000 was purchased from Invitrogen, USA;

[0025] The brand of the fluorescence quantitative PCR instrument is LightCycler96, the brand of the ordinary PCR instrument is A300, the brand of the ultra-micro spectrophotometer is Pullon, the brand of the desktop centrifuge is Himac, the brand of the carbon dioxide incubator is CCL-170B-8, the brand of the horizontal centrifuge is Dynamic, and the brand of the cell counter is IC1000.

[0026] Example 1

[0027] 1. Screening of anti-dengue virus genes

[0028] By downloading the dataset GSE51808 from the GEO public database, bioinformatics analysis was performed on the transcriptome data of human peripheral blood mononuclear cells infected with dengue virus, and 25 dengue virus genes were screened out, including PARP12 gene, PLSCR1 gene, IFI16 gene, ISG15 gene, SP110 gene, XAF1 gene, TRIM21 gene, IFI6 gene, IFI44L gene, LY6E gene, EPSTI1 gene, OASL gene, OAS2 gene, IFITM1 gene, IFI44 gene, CXCL10 gene, ISG20 gene, MX1 gene, IFI35 gene, DTX3L gene, IFI27 gene, ADAR gene, IFIT1 gene, USP18 gene, and IRF7 gene.

[0029] 2. Screening of key genes against dengue virus

[0030] In order to further search for the key molecules of differentially expressed genes in dengue virus-infected hosts, protein-protein interaction (PPI) analysis was performed on the 25 differentially expressed genes obtained using the STRING database, and 14 key dengue virus genes were screened out.

[0031] Experimental results: Figure 1 As shown. IFI16 gene, ISG15 gene, XAF1 gene, IFI6 gene, IFI44L gene, OASL gene, OAS2 gene, IFI44 gene, CXCL10 gene, MX1 gene, IFI35 gene, IFIT1 gene, USP18 gene, and IRF7 gene may be key genes for host antiviral activity.

[0032] 3. Experimental analysis of 14 key dengue virus genes

[0033] Experiments have found that the IFI16 gene can upregulate one or more of the ISG15 gene, XAF1 gene, IFI6 gene, IFI44L gene, OASL gene, OAS2 gene, IFI44 gene, CXCL10 gene, MX1 gene, IFI35 gene, IFIT1 gene, USP18 gene and IRF7 gene to inhibit the replication of dengue virus.

[0034] Example 2

[0035] 1. Evaluation of the antiviral function of IFI16 gene (knockdown expression experiment)

[0036] 1. A549 cells, 2*10 cells per well of a 24-well plate 5 The culture medium was DMEM medium supplemented with 10% fetal bovine serum and 1% sodium penicillin and streptomycin.

[0037] 2. On the second day, lip3000 was used for gene knockdown. Three parallel wells were set up in each well. One group of non-target siRNA (sense chain: GGACGACUGACCGACAAUCA (SEQ ID NO: 2), antisense chain: UGAGUGUGGUCAGUCGUCC (SEQID NO: 3)) and one group of siRNA targeting IFI16 (sense chain: GGACGACUGACCACAAUCA (SEQ ID NO: 4), antisense chain: UGAUUGUGGUCAGUCGUG (SEQ ID NO: 5)) were set up. The concentration of siRNA was 100 nM, 2 μL of lip3000 was used in each well, and 500 μL of serum-free DMEM medium was used in each well. After 6 hours of transfection, the medium was replaced with 10% FBS.

[0038] 3. 24 hours after transfection, cells were infected with dengue virus (DV2 NGC strain, donated by Guangzhou Center for Disease Control and Prevention) at MOI = 0.4. Two hours after infection, the medium was replaced with 2% FBS. The virus was infected for 24 hours, and the supernatant was discarded to collect the cells.

[0039] II. Evaluation of the antiviral function of IFI16 gene (overexpression experiment)

[0040] 1. A549 cells, 2*10 cells per well of a 24-well plate 5 indivual.

[0041] 2. On the second day, lip3000 reagent was used for gene overexpression. Three parallel wells were set in each well. One group was the plasmid pcDNA3.1-IFI16 for overexpressing IFI16. The pcDNA3.1-IFI16 used pcDNA3.1 as the initial vector, and the IFI16 gene fragment was cloned between the restriction sites of NheI enzyme and NotI enzyme of pcDNA3.1 (specifically synthesized by Beijing Qingke Biotechnology Co., Ltd., 4.0 μg / tube-dry powder), and one group of target-free empty plasmids (pcDNA3.1 plasmid, dry powder, purchased from Beijing Qingke Biotechnology Co., Ltd.).

[0042] 3. Prepare the dry powder plasmid overexpressing IFI16 and the dry powder empty plasmid into 20 ng / μL solution, add 1.5 μL plasmid to each well, 0.75 μL Lip3000, 500 μL 10% antiserum-free DMEM medium, and replace with 10% FBS serum medium 24 hours after transfection.

[0043] 4. 24 hours after transfection, cells were infected with dengue virus (DV2 NGC strain, donated by Guangzhou Center for Disease Control and Prevention) at MOI = 0.4. Two hours after infection, the medium was replaced with 2% FBS. The virus was infected for 24 hours, and the supernatant was discarded to collect the cells.

[0044] 3. Real-time quantitative PCR (RT-qPCR) detection of relative gene expression

[0045] The cells collected above were extracted using a tissue / cell rapid extraction kit (BOER, China) in strict accordance with the instructions. Then, reverse transcription was performed using a PrimeScriptTM RT Reagent Kit (TaKaRa, Japan). Premix Ex Taq TM II(TaKaRa,Japan) and Fluorescence quantitative PCR was performed using the 96 system (Roche, USA). The amplification reaction system is as follows (Table 1):

[0046] Table 1 Fluorescence quantitative PCR amplification reaction system

[0047]

[0048] Reaction conditions: step 1: pre-denaturation at 95°C for 30s; step 2: denaturation at 95°C for 5s, 60°C for 30s, 40 cycles; step 3: melting curve reaction conditions: gradually increase the temperature to 95°C. After the PCR reaction, check whether the melting curve and amplification curve are abnormal, export the experimental data, and calculate the expression level of the target gene using the -ΔΔct method.

[0049] 4. Data Analysis

[0050] All statistical data were analyzed using GraphPad Prism v6.0 software. Two-tailed unpaired Student's t-test was used for statistical analysis between groups; P ≤ 0.05 indicated significant differences between groups.

[0051] Experimental results: Figure 2 and Figure 3 As shown. Knockdown of IFI16 gene increased dengue virus replication, while overexpression of IFI16 gene inhibited dengue virus replication.

[0052] It can be seen from the above embodiments that the present invention determines the key genes related to anti-dengue virus by searching for genes differentially expressed after host cells are transfected with the virus, analyzing the differentially expressed genes, and determining that overexpression of the IFI16 gene has the effect of inhibiting dengue virus replication and can be used to prepare anti-dengue virus drugs.

[0053] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a biomaterial overexpressing the IFI16 gene in the preparation of an anti-dengue virus drug, characterized in that: Overexpression of the IFI16 gene inhibits the replication of dengue virus. The nucleotide sequence of the IFI16 gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The IFI16 gene inhibits the replication of dengue virus by upregulating one or more of the ISG15 gene, XAF1 gene, IFI6 gene, IFI44L gene, OASL gene, OAS2 gene, IFI44 gene, CXCL10 gene, MX1 gene, IFI35 gene, IFIT1 gene, USP18 gene and IRF7 gene.

3. The use according to claim 1, characterized in that: The biological material for overexpressing the IFI16 gene comprises a plasmid, wherein the plasmid is pcDNA3.1-IFI16, wherein the pcDNA3.1-IFI16 uses pcDNA3.1 as an initial vector, and an IFI16 gene fragment is cloned between the restriction sites of the NheI enzyme and the NotI enzyme of the pcDNA3.

1.

4. The use according to claim 3, characterized in that: The concentration of the plasmid is 3 ng / μL to 30 ng / μL.

5. Application of biological materials overexpressing the IFI16 gene in the preparation of reagents for inhibiting the replication of dengue virus in cells.

6. The use according to claim 5, characterized in that: The cells include lung cancer human alveolar basal epithelial cells.

Images