Molecular breeding method for synthesizing betacyanin in transgenic sweet potato and application of molecular breeding method

Abstract

The invention provides a combined gene RUBY capable of generating betacyanin through expression in sweet potatoes and application thereof, the combined gene RUBY is formed by sequentially connecting a CYP76AD1 gene, a DODA gene and a GT gene in series through a 2A peptide sequence capable of being automatically cut through coding, the nucleotide sequence of the CYP76AD1 gene is shown as SEQ ID NO.1, the nucleotide sequence of the DODA gene is shown as SEQ ID NO.3, and the nucleotide sequence of the GT gene is shown as SEQ ID NO.5. The invention further provides a preparation method of the combined gene RUBY capable of generating betacyanin through expression in sweet potatoes and application of the combined gene RUBY capable of generating betacyanin through expression in sweet potatoes. According to the invention, a combined gene participating in betacyanin synthesis is obtained, a combined coding region of the combined gene is constructed into an enhanced over-expression vector, and after the vector is transferred into sweet potatoes, three key genes participating in betacyanin biosynthesis in obtained transgenic sweet potatoes have obvious expression compared with non-transgenic sweet potatoes so as to form betacyanin; and different tissues of the transgenic plant are pink. The method disclosed by the invention has important guiding significance and good production and application values for directionally breeding novel functional sweet potato varieties through a genetic engineering technology.

Description

Technical Field

[0001] The invention relates to a molecular breeding method for synthesizing betalain in transgenic sweet potatoes and application thereof, belonging to the technical field of genetic engineering. Background Art

[0002] Betaine is a water-soluble nitrogen-containing natural pigment widely used in the world. Beta common ) roots. Betalain is composed of two types of compounds, red-purple betalain and yellow-orange betalain, which are synthesized by a series of enzyme-catalyzed steps, including hydroxylase, dioxygenase and glucosyltransferase. The bright red color of plants such as beet, pitaya and cactus fruit is the result of betalain accumulation. Betalain has no toxic side effects, and studies have found that it has high physiological activity and has significant effects such as antibacterial, antioxidant, anti-fatigue and cancer prevention. In view of its safety and many benefits to the human body, betalain is the only source of betalain additives allowed to be used in food, which not only increases the appearance of food but also improves its nutritional value. It has significant application value in many fields such as functional foods, cosmetics and medicines, and therefore its demand has increased significantly. For a long time, the main source of betalain has been red beetroot, but many factors such as the large amount of nitrate in beetroot extracts have significantly limited the development and utilization of beetroot-derived betalain. At present, betalain from beets can only meet 10% of the global demand for food additives. Therefore, studying the biosynthesis process of betaine and improving its production capacity are of significant value to the development and application of betaine.

[0003] sweet potato( Ipomoea batatas ) is rich in dietary fiber, phenolic compounds, carotenoids, vitamins and many other substances that are beneficial to the human body. The World Health Organization regards it as the top of the best food list with the highest nutritional index. Sweet potato has unique characteristics such as super high yield and wide adaptability. It can not only be used as food, feed and industrial raw materials, but also an important emerging energy crop and high-efficiency health crop. However, there are no genes related to the betalain synthesis pathway in sweet potatoes. Therefore, it is urgent to focus on constructing the synthesis pathway of betalain in sweet potatoes with the advantages of high and stable yields through genetic engineering, so as to obtain a transgenic sweet potato material with pink tubers and rich in betalain. Summary of the invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies of the prior art and provide a molecular breeding method for synthesizing betalain in transgenic sweet potatoes and its application.

[0005] The invention discloses a gene combination for expressing betalain in sweet potato and its application, which is a gene combination for expressing betalain in sweet potato and its application, and is a gene combination for expressing betalain in sweet potato and its application, which is a gene combination for expressing betalain in sweet potato and its application, and is a gene combination for expressing betalain in sweet potato and its application Kpn I and Spe I restriction site to connect the combined gene CYP76AD1- 2A-DODA-2A-GT ( RUBY ), construct its recombinant overexpression vector, and then transfer the recombinant overexpression vector into the sweet potato genome based on the in situ transformation technology of Agrobacterium rhizogenes, and screen out transgenic sweet potato materials with rich betalain and pink root tubers. The transgenic sweet potato plants can not only be used as excellent raw materials for producing betalain, but also become new functional sweet potato varieties that promote health.

[0006] One of the purposes of the present invention is to provide a gene combination for betalain biosynthesis RUBY ,Depend on CYP76AD1 (P450 oxygenase) gene, FRIEND (L-DOPA 4,5-dioxygenase) gene and GT (Betanidin-5-O-glucosyltransferase) gene is composed of a series of 2A peptide sequences that encode self-cleavable peptides. CYP76AD1 The nucleotide sequence of the gene is shown in SEQ ID NO.1. FRIEND The nucleotide sequence of the gene is shown in SEQ ID NO.3. GT The nucleotide sequence of the gene is shown in SEQ ID NO.5, the sequence of the 2A peptide gene 1 is shown in SEQ ID NO.2, and the sequence of the 2A peptide gene 2 is shown in SEQ ID NO.4. RUBY The nucleotide sequence of the gene is CYP76AD1 - 2A - FRIEND - 2A - GT , as shown in SEQ ID No.1-SEQ ID No.5.

[0007] The present invention has found that the combination of genes involved in the accumulation of betalain RUBY , and expressing it heterologously in sweet potato plants can significantly increase the accumulation of betalain, which is of great significance for the targeted breeding of new transgenic sweet potato varieties rich in betalain through genetic engineering technology.

[0008] The second object of the present invention is to provide a combination gene containing genes involved in betalain synthesis RUBY Enhanced recombinant expression vector.

[0009] The enhanced recombinant expression vector comprises a 2×35S promoter (containing a COR47-5′UTR translation initiation enhancer sequence) and a HSP-T878 terminator fused thereto. RUBY Gene expression cassette.

[0010] The enhanced recombinant expression vector is a pCAMBIA1300-eYGFPuv-Flag-MYC vector. Kpn I and Spe betalain biosynthesis gene RUBY nucleotide sequence.

[0011] The third object of the present invention is to provide a microbial transformant containing the enhanced recombinant expression vector as described above.

[0012] The above-mentioned microbial transformant is Agrobacterium rhizogenes K599.

[0013] The fourth object of the present invention is to provide the above-mentioned betalain biosynthesis gene combination RUBY Application in the preparation of transgenic sweet potatoes.

[0014] Furthermore, the present invention provides the above-mentioned betalain biosynthesis gene combination RUBY Application in the synthesis of betalain from sweet potato.

[0015] Combination gene involved in betalain biosynthesis of the present invention RUBY It can improve the synthesis of betalain in sweet potato. RUBY It was transferred into the sweet potato genome and overexpressed in transgenic sweet potatoes to obtain transgenic sweet potatoes with high betacyanin content.

[0016] A molecular breeding method for synthesizing betalain in transgenic sweet potatoes, wherein the transgenic material is constructed by: combining and co-expressing three key genes for betalain synthesis, including CYP76AD1 Gene, FRIEND Genes and GT Gene, three genes are connected in series to an open reading frame by encoding a 2A peptide sequence that can be cleaved by itself, called RUBY The gene was expressed in 247 grams of betalain and 1.5 g of betalain was expressed in 247 grams of betalain. The enhanced recombinant overexpression vector was constructed, which was transferred into Agrobacterium rhizogenes and genetically transformed into sweet potato plants to obtain transgenic sweet potatoes rich in betalain.

[0017] The molecular breeding method is characterized in that the sweet potato material is Yanshu 25; the method for constructing the transgenic plant is as follows: based on the in situ transformation technology of Agrobacterium rhizogenes, the transgenic plant containing the combined gene is transformed into RUBY The enhanced overexpression vector of the gene was transferred into the plant genome, and transgenic sweet potato plants with pink root tubers rich in betalain were screened. Transgenic sweet potatoes can convert tyrosine into betalain, making the root tubers pink.

[0018] Compared with the prior art, the present invention obtains a combination gene for expressing betacyanin in sweet potato, and constructs the combination coding region of the gene into an enhanced overexpression vector pCAMBIA1300-eYGFPuv-Flag-MYC, and transfers the vector into transgenic sweet potato to obtain the combination gene. RUBY The three key genes involved in the biosynthesis of betalain in the transgenic sweet potato are significantly expressed compared with non-transgenic sweet potatoes to form betalain, and the transgenic plants show pink in different tissues during the cultivation process. Therefore, the combination gene of the present invention provides a good application prospect for the production of betalain in sweet potatoes and the improvement of sweet potato varieties, and can also be used for molecular breeding of ornamental sweet potatoes. The present invention has important guiding significance and good production application value for the directional cultivation of new functional sweet potato varieties through genetic engineering technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The combined gene of the present invention CYP76AD1 - 2A - FRIEND - 2A - GT A is a schematic diagram of the enzymatic reaction of converting tyrosine into betacyanin; B is a schematic diagram of the construction of a combined gene CYP76AD1 - 2A - FRIEND - 2A - GT Schematic diagram of the overexpression vector to reconstruct the complete betalain biosynthetic pathway.

[0020] Figure 2 The phenotype comparison diagram of betalain accumulation in transgenic adventitious roots and non-transgenic adventitious roots on the same plant in the present invention. A in the figure is a representative transgenic adventitious root; B is a non-transgenic adventitious root. TR: transgenic adventitious root, NR: non-transgenic adventitious root.

[0021] Figure 3 The phenotypic comparison diagram of the transgenic sweet potato and the wild-type sweet potato in the present invention. In the figure, A shows the difference in the accumulation of betalain in the epidermis of the transgenic sweet potato and the wild-type sweet potato; B shows the difference in the accumulation of betalain in the tubers of the transgenic sweet potato and the wild-type sweet potato. WT is the wild-type sweet potato Yanshu 25, and OE-1, OE-2, and OE-5 are three independent transgenic sweet potato lines.

[0022] Figure 4 The combined gene in the transgenic sweet potato of the present invention RUBY of CYP76AD1 , FRIEND and GT Schematic diagram of gene overexpression efficiency detection results.

[0023] Figure 5 The figure is a schematic diagram of the detection results of betacyanin and betacyanin content in the transgenic sweet potato and wild-type sweet potato of the present invention. In the figure, A is the difference in the accumulation of betacyanin content; B is the difference in the accumulation of betacyanin content. WT is the wild-type sweet potato Yanshu 25, and OE-1, OE-2, and OE-5 are three independent transgenic sweet potato lines. DETAILED DESCRIPTION

[0024] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings: This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and specific operation process are given, but the protection authority of the present invention is not limited to the following embodiments.

[0025] Unless otherwise specified, the specific methods used in the following examples are conventional methods, and the reagents used can be obtained from commercial sources, such as the conditions described in Molecular Cloning Laboratory Manual (3rd edition, J. Sambrook et al., translated by Huang Peitang et al., Science Press, 2002), or the experimental conditions guided by the manufacturer.

[0026] The sweet potato variety used in the examples of the present invention is Yanshu 25, which was stored in Jiangsu Normal University; Escherichia coli DH5α competent cells and Agrobacterium rhizogenes K599 competent cells were purchased from Beijing Bomade Gene Technology Co., Ltd.; restriction endonucleases were purchased from NEB; DNA purification kits were purchased from Dalian TaKaRa; Phanta Max Super-Fidelity DNA polymerase, homologous recombination reagent ClonExpress II One Step Cloning Kit, and 2×Rapid Taq Master Mix DNA polymerase were all purchased from Nanjing Novozyme Biotechnology Co., Ltd.; primer synthesis was completed by General Bio (Anhui) Co., Ltd., sequencing was completed by Qingke Biotechnology Co., Ltd. (Nanjing), and the remaining reagents were all analytically pure reagents. Example 1

[0027] 1. Gene Combination CYP76AD1 - 2A - FRIEND - 2A - GT Nucleotide sequence synthesis The high-throughput fully automatic gene synthesis technology platform of General Biotechnology (Anhui) Co., Ltd. was used to directly synthesize the combined gene using the pUC57 cloning vector. CYP76AD1 - 2A - FRIEND - 2A - GT ( RUBY ) nucleotide sequence (see Figure 1 A), which was verified by sequencing and was completely and correctly synthesized, can be used as a DNA template in the later stage. CYP76AD1 - 2A - FRIEND - 2A - GT ( RUBY ) are shown in SEQ ID No.1 to SEQ ID No.5, three key genes for betalain biosynthesis CYP76AD1 , FRIEND and GT The 2A peptide sequences encoding self-cleavable peptides were sequentially linked to an open reading frame, which translated into three key enzymes required for betalain biosynthesis (see Figure 1 B).

[0028] 2. Construction of genes containing combinations CYP76AD1 - 2A - FRIEND - 2A - GT Enhanced overexpression vector pass Kpn I and Spe I was used to digest the pCAMBIA1300-eYGFPuv- Flag-MYC vector stored in Jiangsu Normal University (the preparation method of the pCAMBIA1300-eYGFPuv-Flag-MYC vector is detailed in CN117247965A), and purified and recovered. CYP76AD1 - 2A - FRIEND - 2A - GT ( RUBY ) as a template, and designed homologous recombination primers P1 and P2 for PCR amplification, specifically: P1: 5'-TAATCAAATCAAGATTAAAG GGTACC ATGGATCATGCGACCCTCG -3' (SEQ ID No. 6), the underlined part is Kpn I restriction site P2:5'-TCATGGTCTTTGTAGTCCAT ACTAGT CTGGAGGCTTGGCTCAAGTTT -3' (SEQ ID No. 7), the underlined part is Spe I restriction enzyme cutting site.

[0029] The PCR reaction system was: 17 μL ddH2O, 1 μL dNTP Mix, 25 μL 2×Phanta Max Buffer, 1 μL Phanta Max Super-Fidelity DNA Polymerase, 2 μL DNA template, 2 μL upstream and downstream primers, 50 μL in total; the PCR reaction program was: 95 ℃ 2 min, 95 ℃ 15 s, 56 ℃ 15 s, 72 ℃ 3 min 30 s, 35 cycles. After the PCR amplification product was detected by agarose gel electrophoresis to confirm the correct size, it was purified and recovered, and then connected to the purified and recovered restriction vector pCAMBIA1300-eYGFPuv-Flag-MYC by homologous recombinase. After being sent to Qingke Biotechnology Co., Ltd. (Nanjing) for sequencing verification, the combined gene was obtained. RUBY Enhanced recombinant overexpression plasmid pCAMBIA1300-eYGFPuv- RUBY -Flag-MYC.

[0030] 3. Recombinant plasmid pCAMBIA1300-eYGFPuv- RUBY -Flag-MYC transformation into Agrobacterium rhizogenes According to the Agrobacterium rhizogenes competent cell transformation method, pCAMBIA1300-eYGFPuv- RUBY -Flag-MYC recombinant plasmid was transformed into Agrobacterium rhizogenes K599, and then the bacterial solution was evenly spread on TY solid medium containing 100 mg / mL kanamycin and cultured inverted at 28°C in the dark for 2 days until a single colony grew. A single clone was picked and the positive transformant was verified by colony PCR.

[0031] 4. Agrobacterium-mediated recombinant plasmid pCAMBIA1300-eYGFPuv- RUBY -Flag-MYC in situ genetic transformation of sweet potato The in situ transformation technique is used to genetically transform sweet potatoes. This method breaks through the technical barriers of low efficiency and long transformation cycle of sweet potato callus tissue, and provides a fast and reliable technical support for the study of sweet potato functional genomics. The in situ transformation technique of sweet potato uses the method of directly injecting Agrobacterium rhizogenes into the sweet potato stem tip to transform the enhanced recombinant overexpression plasmid pCAMBIA1300-eYGFPuv- RUBY -Flag-MYC Agrobacterium rhizogenes was cultured by shaking, and the bacterial solution OD was increased by osmotic fluid. 600The value is adjusted to about 0.8 and allowed to stand for 2 hours. Select well-developed Yanshu 25 stem tips (containing 4-5 leaves), peel off the leaves near the rooting zone below, use a 1 mL small syringe to absorb the above-mentioned static bacterial solution, insert the stem tip near the growth point below the stem tip (below or to the side), slowly move the needle back and forth, and slowly inject the buffer solution. The treated sweet potato stem tips were then inserted into nutrient soil for rooting. About 40 days after planting, it can be clearly observed that the transgenic adventitious roots are obviously pink, indicating that high levels of betalain have accumulated, while non-transgenic adventitious roots have not accumulated betalain (see Figure 2 The positive transgenic plants were then planted in the experimental field and cultured under normal management until their tuberous roots expanded.

[0032] 5. Combination of genes in transgenic sweet potatoes CYP76AD1 - 2A - FRIEND - 2A - GT Identification of expression levels After the transgenic sweet potato plants were grown in the experimental field for 4 months, the sweet potato tubers were harvested and the phenotypic characteristics of the positive transgenic sweet potatoes and wild-type sweet potatoes were observed. Figure 3 As shown, the epidermis of transgenic sweet potatoes (see Figure 3 A) and tuberous roots (see Figure 3 B) have obvious accumulation of betalain and appear pink. The genomic DNA of transgenic plants and wild-type sweet potatoes was extracted to identify and confirm the positive transgenic plants. CYP76AD1 - 2A - FRIEND - 2A - GT The expression level in transgenic sweet potato was determined, and the root tubers of transgenic sweet potato positive plants and wild-type sweet potato plants were taken to extract total RNA, which was reverse transcribed into cDNA according to the steps in the PrimeScript1st Strand cDNA Synthesis Kit instruction manual. The obtained cDNA was then used as a template to design CYP76AD1 (P3 and P4), FRIEND (P5 and P6) and GT qRT-PCR primers for the (P7 and P8) genes, and sweet potato genes ARF (P9 and P10) were used as internal references, and qRT-PCR analysis was performed to detect the combined genes, respectively. CYP76AD1 - 2A - FRIEND - 2A - GT Expression level in transgenic sweet potato positive root tubers.

[0033] Based on the combined gene CYP76AD1- 2A - FRIEND - 2A - GT and sweet potato internal reference gene ARF The following quantitative primers were designed based on the nucleotide sequence: P3: 5'-CTCATGCTCGCCACACTCCT-3' P4: 5'-CGGCTTGGTCTTTGGAGC-3' P5: 5'-ATTTCCAGAGCACTTCTACCCG -3' P6: 5'-GAGGTGAACTTGTAGGAGCCGT -3' P7: 5'-AAGGCTGGGAGATGAAGAATCG-3' P8: 5'-TGGAGGCTTGGCTCAAGTTTG-3' P9: 5'-CTTTGCCAAGAAGGAGATGC-3' P10: 5'-CTTGTCCTGACCACCAACA-3' The experimental system of qRT-PCR was: 2.5 μL ddH2O, 7.5 μL SYBR Premix Ex Taq II, 2 μL cDNA, 1.5 μL of each primer with a concentration of 4 μM. The qRT-PCR reaction program was: pre-denaturation: 95°C, 30 s; (denaturation: 95°C, 5 s; annealing: 60°C, 1 min), 40 cycles. The qRT-PCR results are shown in Figure 2. Figure 4 The results showed that three key genes involved in betalain biosynthesis in the positive transgenic sweet potato roots CYP76AD1 , DODA、GT All of them were significantly expressed. WT is the wild-type sweet potato Yanshu 25, OE-1, OE-2, and OE-5 are three independent transgenic sweet potato lines, and Nd means not detected. VI. Analysis of betalain and betacyanin accumulation in transgenic sweet potato roots

[0034] Since the transgenic sweet potato roots are obviously pink, it indicates that they have accumulated high levels of betalain. The accumulation of betalain and betalain xanthin in the transgenic sweet potato roots was then detected and analyzed. Figure 5 The results showed that betalain in transgenic sweet potato roots (see Figure 5 A) and betalain (see Figure 5The content of B) in sweet potatoes is significantly higher than that in wild sweet potatoes. This shows that the present invention realizes the feasibility of producing betalain by combining and co-expressing key genes for betalain synthesis in sweet potatoes. The high and stable yield advantages of sweet potatoes make them an excellent raw material for producing betalain, which has important guiding significance and good production application value for the directional cultivation of new functional crops through genetic engineering technology.

[0035] The above description is only a specific implementation of the present invention, but the protection scope of the present invention is not limited thereto. Any person familiar with the technology can understand and think of any changes or substitutions within the technical scope disclosed by the present invention, which should be included in the scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A gene combination for betalain biosynthesis, comprising CYP76AD1 Gene, DODA Genes and GT The gene is composed of a series of 2A peptide sequences that encode self-cleavable peptides. CYP76AD1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. DODA The nucleotide sequence of the gene is shown in SEQ ID NO.

3. GT The nucleotide sequence of the gene is shown in SEQ ID NO.

5.

2. Contains a combination of genes involved in betalain synthesis RUBY Enhanced recombinant expression vector.

3. The enhanced recombinant expression vector according to claim 2, comprising 2×35S promoter containing COR47-5′UTR translation initiation enhancer sequence and HSP-T878 terminator fused to RUBY Gene expression cassette.

4. The enhanced recombinant expression vector according to claim 3, characterized in that: The enhanced recombinant expression vector is in the pCAMBIA1300-eYGFPuv-Flag-MYC vector Kpn I and Spe betalain biosynthesis gene RUBY nucleotide sequence.

5. A microbial transformant containing the enhanced recombinant expression vector according to any one of claims 2 to 4.

6. The microbial transformant according to claim 5, characterized in that The microbial transformant is Agrobacterium rhizogenes K599.

7. The betalain biosynthesis gene combination as claimed in claim 1 RUBY Application in the preparation of transgenic sweet potatoes.

8. The betalain biosynthesis gene combination as claimed in claim 1 RUBY Application in the synthesis of betalain from sweet potato.

9. A molecular breeding method for synthesizing betalain in transgenic sweet potatoes, characterized in that: The method for constructing the transgenic material is: combining and co-expressing three key genes for betalain synthesis, including CYP76AD1 Gene, DODA Genes and GT Gene, three genes are connected in series to an open reading frame by encoding self-cleavable 2A peptide sequences, and their enhanced recombinant overexpression vector is constructed. The vector is transferred into Agrobacterium rhizogenes and genetically transformed into sweet potato plants to obtain transgenic sweet potatoes rich in betalain.

10. The molecular breeding method according to claim 9, characterized in that: The sweet potato material is Yanshu 25; the construction method of the transgenic plant is as follows: based on the in situ transformation technology of Agrobacterium rhizogenes, the transgenic plant containing the combined gene RUBY The enhanced overexpression vector was transferred into the plant genome, and transgenic sweet potato plants with pink root tubers rich in betalain were screened.

Images