Salt-tolerant related gene of rice and application thereof

By cloning and utilizing the rice salt-tolerant gene SPK1, molecular markers were developed and introduced into rice varieties, solving the problem of rice's sensitivity to salt stress, realizing the breeding of new salt-tolerant rice varieties, and improving growth and yield under salt stress.

CN119824015BActive Publication Date: 2026-06-19THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Filing Date
2024-11-06
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

In existing technologies, rice is sensitive to salt stress, which leads to growth inhibition and reduced yield. Furthermore, salt tolerance-related gene resources are scarce, making it difficult to cultivate new salt-tolerant rice varieties through modern bio-breeding techniques.

Method used

By cloning the rice salt tolerance-related gene SPK1, developing molecular markers, identifying haplotypes using CAPS primers, and introducing them into recipient varieties using hybridization methods, new salt-tolerant rice varieties were bred.

Benefits of technology

It significantly improved the growth and yield of rice under salt stress, optimized the salt tolerance of rice varieties, and shortened the breeding cycle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005121510330000051
    Figure BDA0005121510330000051
  • Figure HDA0005121510340000011
    Figure HDA0005121510340000011
  • Figure HDA0005121510340000012
    Figure HDA0005121510340000012
Patent Text Reader

Abstract

This invention discloses a rice salt tolerance-related gene and a salt tolerance-favorable haplotype, as well as the developed molecular markers and their application in the creation of new salt-tolerant rice lines. This invention introduces the gene into recipient rice varieties via hybridization for the breeding of new salt-tolerant rice varieties. This invention also discloses a method for identifying the SPK1 gene haplotype, which can be used to determine rice recipient varieties suitable for improvement and for assisted selection in hybrid offspring. This targeted design improvement can accelerate the breeding of new salt-tolerant rice varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology and relates to a rice salt tolerance-related gene and its application. Background Technology

[0002] my country has approximately 9.9 × 10⁹ m³ of saline-alkali land. 7 The total area of ​​undeveloped saline-alkali land in China is approximately 7.66 million hectares (110 million mu), and the area of ​​arable land affected by salinity is approximately 9.2 million hectares, accounting for 7.2% of the total arable land area in the country. Soil salinization is a significant obstacle to arable land productivity, inhibiting crop growth, reducing fertilizer utilization, and in severe cases, even leading to reduced yields or crop failure. However, the area of ​​saline-alkali arable land in my country is showing an increasing trend. This is partly due to the fact that some newly reclaimed arable land is saline-alkali land, and partly due to secondary soil salinization.

[0003] Rice is the second largest grain crop in my country in terms of planting area, and the area of ​​rice affected by salinity is increasing. Rice is a salt-sensitive crop; salt stress inhibits root growth, reduces the rate of photosynthesis, shortens stem growth, leads to a reduction in the number of effective panicles and grains per panicle, reduces yield, and affects rice quality.

[0004] To address the increasingly serious problem of salinity and alkalinity, breeding new salt-tolerant rice varieties is an important method to stabilize rice yields in saline-alkali land. Discovering salt-tolerance-related gene resources is a prerequisite for using modern bio-breeding techniques to cultivate new salt-tolerant rice varieties. Existing research has found that salt tolerance is a complex trait controlled by multiple genes; however, the scarcity of salt-tolerance-related gene resources with breeding value remains a bottleneck in using modern bio-breeding techniques to cultivate new salt-tolerant rice varieties. Summary of the Invention

[0005] The purpose of this invention is to disclose a rice salt tolerance-related gene and a salt tolerance-advantage haplotype, as well as the developed molecular marker and its application in the creation of new salt-tolerant rice lines.

[0006] This invention provides a rice salt tolerance-related gene, which is the protein kinase gene 1SPK1, and its encoded amino acid sequence is shown in SEQ ID NO: 2.

[0007] Preferably, its nucleotide sequence is as shown in SEQ ID NO: 1.

[0008] This invention provides the application of the rice salt tolerance-related genes in breeding salt-tolerant rice varieties or in identifying rice salt tolerance.

[0009] Specifically, it obtains rice varieties with reduced salt tolerance by knocking out the gene, or obtains rice varieties with enhanced salt tolerance by overexpressing the gene.

[0010] This invention provides a method for identifying SPK1 gene haplotypes, which determines the rice SPK1 haplotype by identifying the sequence of the rice SPK1 gene in rice.

[0011] Specifically, this includes identification of the SPK1 gene using the following CAPS primers:

[0012] Primer sequence 1: 5'-TCAAGTCCAGCGACGTCTTC-3'

[0013] Primer sequence 2: 5'-TACAGGCTTTCACTGGGACG-3';

[0014] The specific identification method is as follows: using the genomic DNA of the sample to be tested as a template, after PCR amplification with the above primers, the PCR product is digested with restriction endonuclease BmgBI, and the DNA fragment size is detected by electrophoresis; those showing two bands of 228 and 393 bp are hap1, those showing three bands of 45, 228, and 348 bp are hap2, and those showing four bands of 45, 228, 348, and 393 bp are hap1hap2 heterozygotes.

[0015] This invention provides a method for breeding salt-tolerant rice varieties, which involves introducing a salt-tolerant beneficial haplotype into a recipient variety through hybridization combined with molecular marker-assisted selection. The salt-tolerant beneficial haplotype is the rice SPK1 gene haplotype hap1.

[0016] Specifically, rice varieties with salt-tolerant haplotypes are identified as donors and introduced into backcross parents through hybridization; preferably, four consecutive backcrosses are performed.

[0017] More specifically, after each backcross, the F1 generation was identified using the following CAPS primers as heterozygous for the SPK1 gene as hap1hap2:

[0018] Primer sequence 1: 5'-TCAAGTCCAGCGACGTCTTC-3'

[0019] Primer sequence 2: 5'-TACAGGCTTTCACTGGGACG-3'.

[0020] The specific identification method is as follows: using the genomic DNA of the sample to be tested as a template, after PCR amplification with the above primers, the PCR product is digested with restriction endonuclease BmgBI, and the DNA fragment size is detected by electrophoresis; those showing two bands of 228 and 393 bp are hap1, those showing three bands of 45, 228, and 348 bp are hap2, and those showing four bands of 45, 228, 348, and 393 bp are hap1-hap2 heterozygotes.

[0021] The salt tolerance-related gene SPK1 and its favorable salt tolerance haplotypes disclosed in this invention can be introduced into rice recipient varieties through hybridization for the breeding of new salt-tolerant rice varieties. This invention also discloses a method for identifying SPK1 gene haplotypes, which can be used to determine rice recipient varieties suitable for improvement and for assisted selection in hybrid offspring. This targeted design improvement can accelerate the breeding of new salt-tolerant rice varieties. Attached Figure Description

[0022] Figure 1 The results show the identification of SPK1 gene knockout rice plants.

[0023] Figure 2 The results of functional identification of the rice SPK1 gene are shown. The maturity phenotype (A), plant height (B), and yield per plant (C) of wild-type and spk1 CRISPR mutants under normal and 0.3% salt stress treatments are also presented. In (B) and (C), the different letters under the violin plots represent the least significant difference (LSD) analysis, which showed significant differences at p = 0.05.

[0024] Figure 3 The results of haplotype analysis of the rice SPK1 gene are shown. (A) Rice SPK1 gene haplotypes; (B) Plant height of rice varieties with three SPK1 gene haplotypes under normal conditions; (C) Plant height under salt stress treatment; (D) Yield per plant of rice varieties with three SPK1 gene haplotypes under normal conditions; (D) Yield per plant under salt stress treatment. p-values ​​were calculated using t-tests for different haplotypes.

[0025] Figure 4 This shows the results of field salt tolerance identification of the rice SPK1 haplotype hap1 introduced line. Different letters under the violin diagram represent the least significant difference (LSD) analysis, which showed a significant difference at p = 0.05. Detailed Implementation

[0026] The present invention will be described below through specific embodiments in order to better understand the present invention, but this does not constitute a limitation thereof.

[0027] Example 1: Cloning of the salt-induced phosphokinase SPK1 gene

[0028] 1. Salt stress treatment of rice

[0029] Seeds of the salt-tolerant rice variety IL1 were treated at 42℃ for 3 days, soaked at room temperature for 2 days, and then sown in nutrient soil. When the rice seedlings were 2 weeks old, they were treated with 150 mM NaCl. Roots and leaves of the seedlings were collected at 0, 1, 2, and 3 hours after treatment, washed with water, wiped dry with gauze, and frozen in liquid nitrogen. Simultaneously, root and leaf tissues from the control group (without salt stress treatment) were collected at the corresponding time points.

[0030] 2. Transcriptome sequencing

[0031] Total RNA was extracted from the above tissues, and mRNA was enriched by Oligo dT. After library construction, raw Fastq sequencing data were obtained by sequencing on an Illumina NovaSeq next-generation sequencer.

[0032] 3. Transcriptome data analysis

[0033] High-quality Fastq sequencing data were obtained after quality control. The data were aligned to the rice reference genome IRGSP1.0 using Hisat2, gene expression abundance was calculated using StringTie, and differentially expressed genes were analyzed using DESeq2. Differentially expressed genes were identified based on a fold change ≥2 and FDR <0.05.

[0034] Transcriptome analysis revealed that a gene encoding rice protein kinase was expressed at a level more than 3 times higher in roots than in leaves, and its expression was induced by salt stress. This gene was named Salt-Induced Protein Kinase 1 (SPK1).

[0035] SPK1 cDNA was amplified from rice root cDNA using PCR primers 5'-ATGTCCCCCCCTATGCCGCTG-3' and 5'-TCAAGGAAGATGGTGATGC AG-3', ligated into a T-vector, and sequenced to reveal the coding sequence of the SPK1 gene for IL1 as shown in SEQ ID NO: 1.

[0036] Example 2: Creation of rice SPK1 gene knockout mutant

[0037] SEQ1 was input into CRISPR P (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) and searched using the rice reference genome RAP-DB to obtain the TGCTGCTATCCGCTGTCCGACGG sgRNA sequence. 5'-GGCAGCTGCTATCCGCTGTCCGA-3' and 5'-TCGGACAGCGGATAGCAGCCAAA-3' were chemically synthesized. The two chemically synthesized DNA fragments were mixed and annealed to obtain double-stranded oligoDNA, which was then ligated into a BsaI-digested Crispr-Cas vector using T4 DNA ligase to obtain the SPK-CRISPR vector.

[0038] The SPK1-CRISPR vector was introduced into Agrobacterium, then transformed into rice callus tissue. After resistance screening, the regenerated plants were transplanted to the field to bear fruit.

[0039] Sequencing of the SPK1 gene in SPK1-CRISPR transgenic rice plants revealed a single-base T insertion near the sgRNA sequence, which leads to a frameshift mutation. Figure 1 ).

[0040] Example 3: Functional identification of rice SPK1 gene

[0041] To investigate the function of the rice SPK1 gene, we examined the effects of SPK1 gene mutation on rice plant growth and yield under normal and salt stress treatments. The methods were as follows: Wild-type and SPK1 gene CRISPR-edited mutant rice seeds were treated at 42℃ for 3 days, sown in seedbeds, and covered with plastic film for warmth and moisture retention. At one month of age, seedlings were transplanted into a salt pond with a salt content of 0.3%, with a plant spacing of 15 cm and a row spacing of 25 cm. A salt-free control was also included. Rice plant height was measured after grain filling. At maturity, individual panicles were harvested, threshed, dried, and weighed. Figure 2 The results showed that the spk1 mutant was 8 cm shorter than the wild type under normal conditions and 5 cm shorter under 0.3% salt stress. The grain yield of the spk1 mutant was approximately 20% lower than the wild-type control under both normal and salt stress conditions. This indicates that the rice SPK1 gene is involved in the regulation of rice growth and yield.

[0042] Example 4: Analysis of Salt-Tolerant Haplotypes of the SPK1 Gene in Natural Rice Resources

[0043] 1. Resequencing of the genome of rice natural resources

[0044] We collected 600 representative rice accessions and identified their genotypes using next-generation high-throughput sequencing (NGS). The process is as follows: Sequencing data Fastq files were obtained from the Illumina NGS platform and aligned to the rice reference genome IRGSP1.0 using BWA. SNP / Indel analysis was performed according to the GATK workflow to obtain data related to rice SNP / Indel variant sites.

[0045] 2. Construction of SPK1 gene haplotypes in rice natural resources

[0046] Polymorphism analysis of the SPK1 gene in 600 rice natural resources revealed 10 non-synonymous variant sites. Based on the different combinations of these variant sites in rice natural resources, they can be divided into three main haplotypes (hap1, hap2, hap3) (Table 1 and ...). Figure 3 (A)

[0047] Table 1 SPK1 genotypes

[0048]

[0049] 3. Field salt tolerance identification of different SPK1 gene haplotypes in rice from different natural resources

[0050] Field trials were conducted to identify agronomic traits of different SPK1 haplotype rice varieties under normal and salt stress conditions. The methods were as follows: Rice seeds were soaked at room temperature for one day, then sown in a seedbed and covered with plastic film for warmth and moisture retention. At 4 weeks of age, seedlings were transplanted individually, with a plant spacing of 15 cm and a row spacing of 25 cm. Fifteen days after transplanting, the seedlings were irrigated with a 0.3% saline solution until maturity. The salinity of the paddy field was continuously monitored during this period, and the saline concentration was adjusted to maintain it at 0.3-0.4%. After maturity, individual plants were harvested, dried, threshed, and weighed. Ten replicates were performed for each variety, and the average yield was calculated. A freshwater irrigation control group was also included.

[0051] The results are as follows Figure 3 As shown in the BE study, under normal and 0.3% salt stress conditions, compared with SPK1 haplotype hap1 and hap3 rice varieties, haplotype hap2 rice variety had a plant height reduced by 4-15 cm (4-17%) and a yield per plant reduced by 1.2-3.0 g (4-

[0052] (10%). This indicates that rice varieties with the SPK1 gene haplotypes hap1 and hap3 have significantly higher yields than those with the haplotype hap2. In rice breeding, preferentially using hap1 to replace hap2 will help improve rice yields under normal and salt stress conditions.

[0053] Example 5: Application of the favorable haplotype hap1 in the rice SPK1 gene

[0054] Analysis using the method described in Example 4 revealed that the SPK1 gene in rice variety Shengdao 14 is hap2, while that in rice variety IR29 is hap1. To demonstrate whether introducing the SPK1 gene hap1 into Shengdao 14 could improve salt tolerance, we used IR29 as the donor and Shengdao 14 as the backcross parent, performing four consecutive backcrosses. After each backcross, the F1 generation was identified using the following CAPS primers as heterozygous for the SPK1 gene hap1hap2.

[0055] Primer sequence 1: 5'-TCAAGTCCAGCGACGTCTTC-3'

[0056] Primer sequence 2: 5'-TACAGGCTTTCACTGGGACG-3'

[0057] The specific identification method is as follows: using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using the above primers. The PCR product is then digested with restriction endonuclease BmgBI, and the DNA fragment size is detected by electrophoresis. The fragments exhibiting two bands (228 and 393 bp) are hap1; those exhibiting three bands (45, 228, and 348 bp) are hap2; and those exhibiting four bands (45, 228, 348, and 393 bp) are hap1hap2 heterozygotes.

[0058] The Shengdao 14SPK1 gene-introduced line, obtained from 200 segregating plants of the F2 generation (BC4F2) after four backcrosses, was identified using the method described above. Salt tolerance was then tested in the field using the method described in Example 3. The results are as follows: Figure 4 As shown. Under control conditions, the yield per plant of the hap1 introduced line was 12.5% ​​higher than that of Shengdao 14, and under 0.3% salt stress treatment, the yield per plant of the hap1 introduced line was 22.1% higher than that of Shengdao 14. This indicates that SPK1hap1 can provide the yield of rice under normal and salt stress conditions.

Claims

1. A method of identifying SPK1 gene haplotype, characterized in that, The rice SPK1 haplotype was determined by identifying the sequence of the rice SPK1 gene in rice. comprising identifying with the following CAPS primers SPK1 Gene: Primer sequence 1: 5'-TCAAGTCCAGCGACGTCTTC-3' Primer sequence 2: 5'-TACAGGCTTTCACTGGGACG-3'; The identification method is as follows: using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using the above primers. The PCR product is digested with restriction endonuclease BmgBI, and the DNA fragment size is detected by electrophoresis. The fragments showing two bands of 228 and 393 bp are hap1, the fragments showing three bands of 45, 228, and 348 bp are hap2, and the fragments showing four bands of 45, 228, 348, and 393 bp are hap1-hap2 heterozygotes.

2. A method of breeding a salt-tolerant rice variety, characterized in that, Salt-tolerant advantageous haplotypes were introduced into recipient varieties using a hybridization method combined with molecular marker-assisted selection. The salt-tolerant advantageous haplotype is haplotype hap1 of the rice SPK1 gene, whose nucleotide sequence is shown in SEQ ID NO: 3 and whose encoded protein sequence is shown in SEQ ID NO:

4.

3. The method of claim 2, wherein, Rice varieties with salt-tolerant haplotypes were identified as donors and introduced into backcross parents through hybridization.

4. The method of claim 3, wherein, 4 consecutive backcrosses.

5. The method of claim 4, wherein, After each backcross, the F1 cells were identified using the following CAPS primers. SPK1 Genetic type hap1hap2 heterozygote: Primer sequence 1: 5'-TCAAGTCCAGCGACGTCTTC-3'; Primer sequence 2: 5'-TACAGGCTTTCACTGGGACG-3'.

6. The method as described in claim 5, characterized in that, The identification method is as follows: using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using the above primers. The PCR product is digested with restriction endonuclease BmgBI, and the DNA fragment size is detected by electrophoresis. The fragments showing two bands of 228 and 393 bp are hap1, the fragments showing three bands of 45, 228, and 348 bp are hap2, and the fragments showing four bands of 45, 228, 348, and 393 bp are hap1-hap2 heterozygotes.