Method for improving citrus yellow vein disease resistance by using ClPsaN gene

Abstract

The invention discloses a method for improving citrus yellow vein disease resistance by using a ClPsaN gene. The method comprises the following steps: (1) cloning a VIGS fragment of the citrus ClPsaN gene; (2) constructing two VIGS expression vectors of TRV and CLBV; and (3) transforming the citrus by the VIGS expression vector to obtain a citrus ClPsaN gene silenced VIGS plant. According to the invention, the VIGS vector of the Citrus ClPsaN gene is constructed, and then the Citrus is transformed, so that the obtained Citrus plant can show obvious resistance to the Citrus yellow vein clearing virus, the titer of the Citrus yellow vein clearing virus can be reduced by 22-34%, the accumulation amount of the virus protein is reduced by 35-50%, and the attack degree of the Citrus yellow vein clearing virus is obviously reduced; the TRV silencing of the citrus ClPsaN gene does not influence the phenotype of a citrus plant, and the citrus ClPsaN gene can be used as a candidate gene for citrus yellow vein disease resistance breeding together with a plurality of citrus yellow vein disease-resistant and susceptible genes by utilizing the cooperation of VIGS silencing, RNA interference, gene editing and other technologies.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biological gene technology, and in particular to a method for improving resistance to citrus yellow vein disease by utilizing the ClPsaN gene. Background Art

[0002] Citrus yellow vein clearing virus (CYVCV) is a viral disease that poses a serious threat to the citrus industry. The virus causes citrus yellow vein clearing disease (CYVCD), which can infect most citrus varieties and seriously threaten the lemon and other citrus industries. When citrus is infected by the disease, the tree will weaken and the yield will drop sharply. However, the prevention and control of this disease is relatively difficult. Currently, there is a lack of effective prevention and control agents, and prevention measures such as strict quarantine and strengthened management are the main ones.

[0003] After citrus plants are infected with CYVCV, they will show symptoms of yellowing and bright veins on the lateral veins, accompanied by wrinkled leaves and warping of young leaves. In the later stage, the leaves will curl, shrink, and become deformed, and the back of the leaves will be water-soaked. Occasionally, ring spots and vein necrosis will appear. This symptom is more obvious in the new leaves of spring and autumn shoots, and some leaves of tender shoots will fall off. The yellowing symptoms of mature leaves subside and turn green, but the wrinkled symptoms of the leaves have not recovered. The yellow veins are still obvious when viewed against the light, and long yellow spots of different lengths can be observed between the veins or near the lateral veins. At the same time, the expression of this symptom will be affected by temperature, visible between 18 and 24°C, and disappear after 32°C. The symptoms caused by the infection of citrus yellow vein virus in citrus directly affect the normal photosynthesis of the plant, weaken the growth of seedlings, greatly affect the quality and yield of citrus, and pose a threat to the citrus planting economy in various places.

[0004] Chloroplasts, as organelles unique to higher plants, not only provide carbon sources and energy for cells through photosynthesis, but are also important sites for the production of immune molecules such as reactive oxygen species, calcium ion signals, salicylic acid and jasmonic acid in plant cells. Chloroplast-mediated immune responses play an important role in resisting plant virus infection. Photosystem I (PSI) is a key complex in plant photosynthesis, which is mainly responsible for capturing light energy and converting it into chemical energy. With the deepening of photosynthesis research and the advancement of molecular biology technology, the structural components of the photosystem I complex have been analyzed one by one. In this process, scholars have discovered the peripheral accessory subunit of PSI, PsaN (Photosystem I Subunit N). PsaN was originally isolated by two scientists, Knoetzel and Simpson, in barley (Hordeum vulgare L.), and the full-length sequence of the gene was analyzed and named. Due to the complexity of PSI itself in higher plants, the research progress of PsaN has been relatively slow. It is known that the homology of PsaN in seed plants is as high as 79.22%, which indicates that PsaN has stability in the process of plant evolution and also implies its prominent position in photosynthesis. With the development of molecular biology technology, PsaN began to be resolved in a few algae, but the different number of amino acid residues in the PsaN subunit between it and higher plants led to differences in the position of PsaN. Current studies have found that PsaN gene expression is affected by multiple factors such as temperature and nutritional status. Through genetic transformation technology, the PsaN gene was overexpressed or silenced in Arabidopsis, and its expression level directly affected the assembly and photosynthetic efficiency of PSI. However, there are very few studies on the involvement of PSI in plant antiviral resistance, and there has been no report on the role of PsaN in disease infection. There has been no research and application of RNAi-mediated PsaN silencing to improve citrus resistance to citrus yellow vein disease.

[0005] In view of this, this application is hereby filed. Summary of the invention

[0006] The present invention provides a method for improving the resistance of citrus to yellow vein disease by utilizing the ClPsaN gene. By transferring the VIGS vector of the citrus ClPsaN gene into citrus and reducing the transcription level of the citrus ClPsaN, the resistance of citrus to citrus yellow vein disease can be significantly improved and the incidence of citrus yellow vein disease can be reduced. The method has great application value in citrus breeding and can be used as a candidate gene for resistance breeding together with multiple citrus yellow vein virus resistance and susceptibility genes.

[0007] The present invention is achieved through the following technical solutions:

[0008] A method for improving resistance to citrus yellow vein disease by using the ClPsaN gene, wherein the resistance of citrus plants to citrus yellow vein disease is improved by regulating the expression level of the ClPsaN gene in the citrus plants, wherein the nucleotide sequence of the ClPsaN gene is shown in SEQ ID NO: 1.

[0009] In a specific embodiment, the specific method for regulating the expression level of the ClPsaN gene is: down-regulating the expression level of the ClPsaN gene in citrus plants.

[0010] In a specific embodiment, the expression level of the ClPsaN gene in citrus plants is down-regulated by using VIGS gene silencing technology.

[0011] In a specific implementation, the steps include:

[0012] (1) Cloning the VIGS fragment of the citrus ClPsaN gene;

[0013] (2) Construction of two VIGS expression vectors, TRV and CLBV;

[0014] (3) The VIGS expression vector was used to transform citrus to obtain VIGS plants in which the ClPsaN gene of citrus was silenced.

[0015] In a specific embodiment, in step (1), the cloning method of the VIGS fragment of the citrus ClPsaN gene is: extracting citrus total RNA, then reverse transcribing it into cDNA, and finally using high-fidelity enzyme PCR amplification to obtain the VIGS fragment of the citrus ClPsaN gene.

[0016] In a specific embodiment, the nucleotide sequence of the VIGS fragment of the citrus ClPsaN gene is shown in SEQ ID NO: 2.

[0017] In a specific embodiment, in step (1), the primers used for PCR amplification are ClPsaN-TRV-F, ClPsaN-TRV-R and ClPsaN-CLBV-F, ClPsaN-CLBV-R, and their nucleotide sequences are shown in SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6, respectively.

[0018] In a specific embodiment, in step (2), the method for constructing the VIGS expression vector is: the VIGS fragment of the citrus ClPsaN gene obtained in step (1) is connected with the TRV2 vector cut with EcoRΙ and BamHΙ and the CLBV vector cut with SmaΙ, respectively, and the competent Escherichia coli cells are transformed, the plasmid is extracted, and the VIGS expression vector of the ClPsaN gene is obtained.

[0019] In a specific embodiment, in step (3), the method for transforming citrus with the VIGS expression vector is: transforming the VIGS expression vector obtained in step (2) into Agrobacterium, preparing an Agrobacterium solution containing the VIGS expression vector, infecting sterile citrus seedlings, and obtaining VIGS plants in which the ClPsaN gene of citrus is silenced.

[0020] In a specific embodiment, the VIGS plants are verified by PCR, and the primers used are TRV2-ClPsaN detection-F and TRV2-ClPsaN detection-R, CLBV-ClPsaN detection-F and CLBV-ClPsaN detection-R, and their nucleotide sequences are shown in SEQ ID No: 9 and SEQ ID No: 10, SEQ ID NO: 13 and SEQ ID NO: 14, respectively.

[0021] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0022] 1. A method for improving resistance to citrus yellow vein disease by using the ClPsaN gene provided in an embodiment of the present invention, by constructing a VIGS vector of the citrus ClPsaN gene and then transforming citrus, the obtained citrus plants can show obvious resistance to citrus yellow vein disease, the citrus yellow vein disease yellowing virus titer can be reduced by 22-34%, and the accumulation of viral proteins can be reduced by 35-50%, significantly reducing the incidence of citrus yellow vein disease;

[0023] 2. A method for improving resistance to citrus yellow vein disease by using the ClPsaN gene provided in an embodiment of the present invention can significantly reduce the incidence of citrus yellow vein disease and improve the resistance of citrus to yellow vein disease by VIGS silencing of the ClPsaN gene in citrus, and TRV silencing of the ClPsaN gene in citrus will not affect the phenotype of citrus plants;

[0024] 3. An embodiment of the present invention provides a method for improving resistance to citrus yellow vein disease by utilizing the ClPsaN gene. By silencing the ClPsaN gene, the resistance of citrus plants to yellow vein disease can be greatly improved, which has great application value for breeding citrus plants resistant to citrus yellow vein disease. The ClPsaN gene can be used as a candidate gene to collaborate with multiple citrus yellow vein disease-resistant and -susceptible genes to carry out breeding for citrus yellow vein disease resistance using VIGS silencing, RNA interference, gene editing and other technologies. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 Bioinformatics characteristic diagram of citrus ClPsaN provided in the embodiment of the present invention: A, prediction of the conserved domain of the citrus ClPsaN gene; B, prediction of the transmembrane region of the citrus ClPsaN gene; C, analysis of the conserved domain of the PsaN protein and analysis of the secondary structure of the ClPsaN protein; D, phylogenetic tree constructed based on the amino acid sequence of the PsaN protein, with the red five-pointed star marking the ClPasN protein;

[0027] Figure 2 The electrophoresis diagram of PCR amplification of the VIGS fragment of the citrus ClPsaN encoding gene provided in the embodiment of the present invention: VIGS represents the RNAi fragment of the ClPsaN encoding gene; M represents the DNA molecular weight standard, the same below;

[0028] Figure 3 VIGS vector structure diagram of citrus ClPsaN provided in the embodiment of the present invention: A, TRV vector structure diagram; B, CLBV vector structure diagram; 35S: plant constitutive promoter derived from cauliflower mosaic virus, CP: coat protein, RdRp: NA-dependent RNA polymerase, GFP: green fluorescent protein, MP: movement protein, NOS: opine synthase gene terminator, LB: left homology arm, RB: right homology arm;

[0029] Figure 4 PCR identification diagram of transgenic plants provided in the embodiment of the present invention: A, PCR detection diagram of TRV silenced plants; B, PCR detection diagram of CLBV silenced plants; CK: plant sample control without any treatment; P: plasmid control; M: DNA Marker; TRV2-GFP, TRV2-ClPsaN detection fragment 300bp, CLBV-GUS, CLBV-ClPsaN detection fragment 461bp;

[0030] Figure 5 qRT-PCR detection diagram of ClPsaN expression in VIGS plants provided in the embodiment of the present invention: A, TRV2-ClPsaN, plants transformed with the TRV vector of ClPsaN (the same below); B, CLBV-ClPsaN, plants transformed with the CLBV vector of ClPsaN; *, **, *** indicate significant differences P<0.05, P<0.01, P<0.001 (the same below), respectively;

[0031] Figure 6 VIGS plant phenotype diagrams provided in the embodiments of the present invention: A, TRV-silenced plant phenotype diagram; B, CLBV-silenced plant phenotype diagram;

[0032] Figure 7 The incidence of Citrus Yellow Vein Virus inoculated into leaves of VIGS plants provided in the embodiments of the present invention: A, 20 days after the TRV-silenced plants were inoculated with Citrus Yellow Vein Virus; B, 30 days after the CLBV-silenced plants were inoculated with Citrus Yellow Vein Virus;

[0033] Figure 8 Protein accumulation of leaves of VIGS plants inoculated with citrus yellow vein virus provided in the embodiments of the present invention: A, accumulation of CYVCV CP 20 days after TRV-silenced plants were inoculated with citrus yellow vein virus; B, accumulation of CYVCV CP 30 days after CLBV-silenced plants were inoculated with citrus yellow vein virus; Coomassie Brilliant Blue (CBB) staining was used to verify whether the loading amount was consistent, grayscale values ​​were calculated by ImageJ, and Student's t-test was used for data statistical analysis;

[0034] Fig. 9 Determination of virus titer of leaves of VIGS plants after inoculation with Citrus Yellow Vein Virus provided in the embodiments of the present invention: A, determination of virus titer of leaves of TRV-silenced plants 20 days after inoculation with Citrus Yellow Vein Virus; B, determination of virus titer of leaves of CLBV-silenced plants 30 days after inoculation with Citrus Yellow Vein Virus. DETAILED DESCRIPTION

[0035] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments and drawings. The exemplary embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention.

[0036] In the following description, a large number of specific details are set forth in order to provide a thorough understanding of the present invention. However, it is apparent to one of ordinary skill in the art that these specific details are not necessarily employed to practice the present invention. In other embodiments, in order to avoid obscuring the present invention, well-known structures, circuits, materials, or methods are not specifically described.

[0037] Throughout the specification, references to "one embodiment," "an embodiment," "an example," or "an example" mean that a particular feature, structure, or characteristic described in conjunction with the embodiment or example is included in at least one embodiment of the present invention. Therefore, the phrases "one embodiment," "an embodiment," "an example," or "an example" appearing in various places throughout the specification do not necessarily all refer to the same embodiment or example. In addition, particular features, structures, or characteristics may be combined in one or more embodiments or examples in any suitable combination and / or sub-combination. In addition, it will be appreciated by those of ordinary skill in the art that the figures provided herein are for illustrative purposes and that the figures are not necessarily drawn to scale. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0038] In the description of the present invention, the directions or positional relationships indicated by terms such as “front”, “rear”, “left”, “right”, “up”, “down”, “vertical”, “horizontal”, “high”, “low”, “inside” and “outside” are based on the directions or positional relationships shown in the accompanying drawings and are only for the convenience of describing the present invention and simplifying the description. They do not indicate or imply that the device or element referred to must have a specific direction, be constructed and operated in a specific direction. Therefore, they should not be understood as limiting the scope of protection of the present invention.

[0039] Example 1

[0040] Bioinformatics analysis of citrus ClPsaN

[0041] like Figure 1 As shown, InterPro (https: / / www.ebi.ac.uk / interpro / ) was used to predict the conserved domain of ClPsaN; DeepTMHMM (https: / / dtu.biolib.com / ) was used to predict the transmembrane region of ClPsaN; Swiss-model (https: / / swissmodel.expasy.org / ) was used to predict the secondary structure of ClPsaN, and the above results were imported into ESPript 3.0 (https: / / espript.ibcp.fr / ) for visualization adjustment; MEGA 11 software was used to construct the phylogenetic tree of PSAN using the lead-joining method and a bootstrap value of 1000 repetitions.

[0042] The nucleotide sequence of ClPsaN gene is SEQ ID NO: 1:

[0043] ATGGCAGCCATGAACTCTAGTGTACTCGCATGCAACTATGCTATTTCAGGCAGTGCTGGATCATCTGAGCTCAATGCAAAGATTGTTTCAGTTTCAACCCCGGCTGTGCATGGCCACAAAATGCCTGT GATCAGAGCTCAACAAGTTGATGTTTCAAAAGAATCAAGAGGAACTGATGGAAGGAGAGCTGCCATGGCTCTTCTAGCAGTTACCCTTTTCACCACAGCTACTGCTGCTGCTTCTTCTGCTAATGCTG GGGTCATCGATGAATACCTTGAGAGAAGCAAGCCAACAAGGAATTGAATGACCAGAAGAGATTGGCAACAAGTGGTGCAAACTTTGCCAGAGCATACACTGTTCAATTTGGCACATGCAAGTTCCCTGAGAACTTCACAGGCTGCCAAGATCTTGCCAAGCAAAAGAAAGTGCCATTCATCTCGGATGATTTGGAATTGGAGTGCAAAGGGAAAGATAAATACAAGTGTGGTTCCAATGTTTTCTGGAAATGGTGA

[0044] Example 2

[0045] Cloning of RNAi fragment of ClPsaN encoding gene

[0046] 1. RNA Extraction and cDNA Synthesis

[0047] Total RNA was extracted from citrus (Eureka lemon) leaves using the CTAB method, and its concentration was measured using a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A), and the cDNA was stored at -20°C for future use.

[0048] 2.VIGS fragment amplification

[0049] The VIGS fragment of the ClPsaN encoding gene was cloned from citrus cDNA using the primers ClPsaN-TRV-F (SEQ ID NO: 3), ClPsaN-TRV-R (SEQ ID NO: 4), ClPsaN-CLBV-F (SEQ ID NO: 5), ClPsaN-CLBV-R (SEQ ID NO: 6) and the high-fidelity enzyme PrimeSTARMaxDNAPolymerase (TaKaRa, CAT: R045Q). The length of the fragment was 300 bp (SEQ ID NO: 2) (as shown in Figure 2 Under ultraviolet light, cut the agarose gel block containing the target fragment with a clean blade, and use a kit (BioFlux, CAT: BSC02M1) to recover the DNA fragment.

[0050] PCR amplification program: 98°C, 3 min; 98°C, 10 s, 55°C, 30 s, 72°C, 15 s, 35 cycles; extension at 72°C for 10 min.

[0051] Nucleotide sequence of the VIGS fragment of Citrus ClPsaN gene SEQ ID NO: 2:

[0052] AGCTCAACAAGTTGATGTTTCAAAAGAATCAAGAGGAACTGATGGAAGGAGAGCTGCCATGGCTCTTCTAGCAGTTACCCTTTTCACCACAGCTACTGCTGCTGCTTCTTCTGCTAATGCTGGGGTCATCGATGAATACCTTGAGAGAAG CAAAGCCAACAAGGAATTGAATGACCAGAAGAGATTGGCAACAAGTGGTGCAAACTTTGCCAGAGCATACACTGTTCAATTTGGCACATGCAAGTTCCCTGAGAACTTCACAGGCTGCCAAGATCTTGCCAAGCAAAAGAAAGTGCCATT

[0053] The nucleotide sequence of primer ClPsaN-TRV-F is SEQ ID NO: 3:

[0054] GTGAGTAAGGTTACCGAATTCAATGGCACTTTTCTTTTGCTTGG

[0055] The nucleotide sequence of primer ClPsaN-TRV-R is SEQ ID NO: 4:

[0056] CGTGAGCTCGGTACCGGATCCAGCTCAACAAGTTGATGTTTCAAA

[0057] The nucleotide sequence of primer ClPsaN-CLBV-F is SEQ ID NO: 5:

[0058] CTCTTAGAAATGTAGCCCGGGAATGGCACTTTTCTTTTGCTTGG

[0059] The nucleotide sequence of primer ClPsaN-CLBV-R is SEQ ID NO: 6:

[0060] TGCCAGAATTCGGGACCCGGGAGCTCAACAAGTTGATGTTTCAAA

[0061] Example 3

[0062] VIGS vector construction

[0063] The VIGS vector TRV2 was digested with EcoRΙ and BamHI, and CLBV was digested with SmaΙ, and the fragments were recovered by gel ligation. The fragments were ligated to the corresponding fragments and transformed into competent E. coli cells. The plasmids were extracted to obtain the VIGS expression vectors TRV2-ClPsaN and CLBV-ClPsaN (as shown in Figure 2A). Figure 3 As shown in the figure, GFP: green fluorescent protein; RdRp: NA-dependent RNA polymerase; MP: movement protein; CP: coat protein; 35S: plant constitutive promoter from cauliflower mosaic virus; NOS: opine synthase gene terminator; LB: left homology arm; RB: right homology arm. The vectors TRV2-ClPsaN and CLBV-ClPsaN were transformed into Agrobacterium to prepare the Agrobacterium bacterial solution containing the VIGS expression vector of the ClPsaN gene.

[0064] Example 4

[0065] Transformation of citrus with VIGS vector

[0066] 1. Activation of Agrobacterium tumefaciens

[0067] Take 500 μL TRV1 and TRV2-GFP (control) and TRV2-ClPsaN Agrobacterium culture liquid respectively and add them to 50 mL liquid LB medium (containing kanamycin) and culture at 28°C and 200 r / min until OD 600 =1.0; collect the cells, resuspend them in MMA (10 mM MgCl2, 10 nM MES, 100 μM acetosyringone) liquid, and adjust the OD 600=1.0; TRV1 was mixed with TRV2 and TRV2-ClPsaN vector at a volume ratio of 1:1, and incubated at room temperature in the dark for 1 h.

[0068] Take 500 μL of CLBV-GUS (control) and CLBV-ClPsaN Agrobacterium culture liquid and add them to 50 mL of liquid LB medium (containing kanamycin) and culture at 28°C and 200 r / min until OD 600 =1.0; collect the cells, resuspend them in MMA (10 mM MgCl2, 10 nM MES, 100 μM acetosyringone) liquid, and adjust the OD 600 =1.0, incubate at room temperature in the dark for 1 h.

[0069] 2. Agrobacterium infection

[0070] Immerse sterile seedlings with radicles growing to 3 cm in Agrobacterium solution and evacuate with a vacuum pump for 1 min; rinse with sterile water 3 to 5 times, plant in soil and culture at 25°C with a light / dark cycle of 16h / 8h, and water regularly.

[0071] Example 5

[0072] Identification and phenotypic observation of VIGS plants

[0073] 1.PCR identification

[0074] One month later, tissues were collected to extract DNA and total RNA, and primer pairs TRV2-GFP detection-F (SEQ ID NO: 7) / TRV2-GFP detection-R (SEQ ID NO: 8), TRV2-ClPsaN detection-F (SEQ ID NO: 9) / TRV2-ClPsaN detection-R (SEQ ID NO: 10), CLBV-GUS detection-F (SEQ ID NO: 11) / CLBV-GUS detection-R (SEQ ID NO: 12), CLBV-ClPsaN detection-F (SEQ ID NO: 13) / CLBV-ClPsaN detection-R (SEQ ID NO: 14). NO: 14) was verified by PCR: the primer pairs TRV2-GFP detection-F / R and TRV2-ClPsaN detection-F / R could amplify 300 bp bands in TRV2-GFP and TRV2-ClPsaN positive plants, respectively; the primer pairs CLBV-GUS detection-F / R and CLBV-ClPsaN detection-F / R could amplify 461 bp bands in CLBV-GUS and CLBV-ClPsaN positive plants, respectively (e.g. Figure 4). A: TRV silenced plant PCR detection image; B: CLBV silenced plant PCR detection image; CK: plant sample control without any treatment; P: plasmid control; M: DNA Marker.

[0075] PCR reaction conditions: 98°C, 3 min; 98°C, 10 s, 55°C, 30 s, 72°C, 15 s, 35 cycles; 72°C extension for 10 min.

[0076] The nucleotide sequence of primer TRV2-GFP detection-F is SEQ ID NO: 7:

[0077] TCCAGCGAGTGGAAGTCCGA

[0078] The nucleotide sequence of primer TRV2-GFP detection-R is SEQ ID NO: 8:

[0079] ATGGCGGACTTGAAGAAGTC

[0080] The nucleotide sequence of primer TRV2-ClPsaN detection-F is SEQ ID NO: 9:

[0081] CGGACGAGTGGACTTAGATT

[0082] The nucleotide sequence of primer TRV2-ClPsaN detection-R is SEQ ID NO: 10:

[0083] GGAAGGAGAGCTGCCATGGCTCTT

[0084] The nucleotide sequence of primer CLBV-GUS detection-F is SEQ ID NO: 11:

[0085] ATTCCAACTGAAGCTGATGGGAG

[0086] The nucleotide sequence of primer CLBV-GUS detection-R is SEQ ID NO: 12:

[0087] AGCACGATACGCTGGCCTGCCCAA

[0088] The nucleotide sequence of primer CLBV-ClPsaN detection-F is SEQ ID NO: 13:

[0089] ATTCCAACTGAAGCTGATGGGAG

[0090] The nucleotide sequence of primer CLBV-ClPsaN detection-R is SEQ ID NO: 14:

[0091] GGAAGGAGAGCTGCCATGGCTCTT

[0092] 2.qRT-PCR Analysis

[0093] Primers ClPsaN-RT-F (SEQ ID NO: 15) and ClPsaN-RT-R (SEQ ID NO: 16) were used for qRT-PCR to verify whether ClPsaN was successfully silenced. The gene expression level of plants transfected with TRV2-GFP and CLBV-GUS vectors was set to 1. If the ClPsaN gene expression level of plants containing the target fragment vector was less than 1, gene silencing occurred. After identification, the ClPsaN transcription level decreased by 46-66% (such as Figure 5 shown).

[0094] qRT-PCR reaction conditions: 95°C for 3 min, 95°C for 15 s; 60°C for 15 s, 72°C for 15 s, 40 cycles.

[0095] The nucleotide sequence of primer ClPsaN-RT-F is SEQ ID NO: 15:

[0096] AACTGATGGAAGGAGAGCTGC

[0097] The nucleotide sequence of primer ClPsaN-RT-R is SEQ ID NO: 16:

[0098] TGACCCCAGCATTAGCAGAAG

[0099] 3. Phenotypic Observation

[0100] The phenotype of ClPsaN gene VIGS plants was observed. It was found that the TRV vector-silenced plants had no obvious abnormalities in appearance and growth. The CLBV vector-silenced plants showed chlorosis and mottled albinism symptoms compared with the control leaves (e.g. Figure 6 shown).

[0101] Example 6

[0102] Evaluation of resistance of VIGS plants

[0103] After silencing the ClPsaN gene for 30-45 days, half of the plants were selected for injection and inoculation with citrus yellow vein virus, and the other half were inoculated with an empty vector control.

[0104] 1. Phenotypic Observation

[0105] After 20-30 days of cultivation, the symptoms of yellowing and bright veins in the plants inoculated with CYVCV and ClPsaN gene silencing were observed. In the plants inoculated with CYVCV after silencing ClPsaN gene with CLBV, the symptoms of ClPsaN gene silencing were masked by the symptoms of CYVCV (e.g. Figure 7 shown).

[0106] 2. Viral protein accumulation detection

[0107] Total protein from plant leaves was extracted, 5× protein loading buffer was added in proportion, and the protein was denatured in a boiling water bath for 10 min. It was then used for Western blot experiments, incubated with CYVCV CP-specific antibodies, and grayscale analysis was performed to quantify protein expression levels. The experimental results showed that the accumulation of CYVCV CP protein decreased by 35-50% (e.g. Figure 8 Coomassie Brilliant Blue (CBB) staining was used to verify whether the loading amount was consistent, and the gray value was calculated by Image J. The data were statistically analyzed using Student's t-test.

[0108] 3. Virus titer detection

[0109] qRT-PCR was performed using primers CYVCV CP-RT-F (SEQ ID NO: 17) and CYVCV CP-RT-R (SEQ ID NO: 18) to verify the citrus yellow vein virus titer. After identification, the citrus yellow vein virus content was reduced by 22-34% (eg Fig. 9 shown).

[0110] The nucleotide sequence of primer CYVCV CP-RT-F is SEQ ID NO: 17:

[0111] TCCAACTCACAAACCCAGCG

[0112] The nucleotide sequence of primer CYVCV CP-RT-R is SEQ ID NO: 18:

[0113] ATGGGCTCTTGGTTTTCCTT

[0114] It can be seen that the interference of ClPsaN gene can greatly reduce the accumulation of citrus yellow vein virus and alleviate the incidence of citrus yellow vein disease. This gene can be used independently for disease resistance molecular breeding, or it can be used together with other disease resistance or disease susceptibility genes for citrus yellow vein disease resistance molecular breeding.

[0115] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for improving resistance to citrus yellow vein disease using the ClPsaN gene, characterized in that: By regulating the expression level of the ClPsaN gene in citrus plants, the resistance of citrus plants to citrus yellow vein disease is improved. The nucleotide sequence of the ClPsaN gene is shown in SEQ ID NO:

1.

2. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 1, characterized in that: The specific method for regulating the expression level of the ClPsaN gene is: down-regulating the expression level of the ClPsaN gene in citrus plants.

3. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 2, characterized in that: The VIGS gene silencing technology was used to down-regulate the expression level of the ClPsaN gene in citrus plants.

4. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 1, characterized in that: The specific steps include: (1) Cloning the VIGS fragment of the citrus ClPsaN gene; (2) Construction of two VIGS expression vectors, TRV and CLBV; (3) The VIGS expression vector was used to transform citrus to obtain VIGS plants in which the ClPsaN gene of citrus was silenced.

5. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 4, characterized in that: In step (1), the cloning method of the VIGS fragment of the citrus ClPsaN gene is: extracting citrus total RNA, then reverse transcribing it into cDNA, and finally using high-fidelity enzyme PCR amplification to obtain the VIGS fragment of the citrus ClPsaN gene.

6. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 5, characterized in that: The nucleotide sequence of the VIGS fragment of the citrus ClPsaN gene is shown in SEQ ID NO:

2.

7. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 5, characterized in that: In step (1), the primers used for PCR amplification are ClPsaN-TRV-F, ClPsaN-TRV-R and ClPsaN-CLBV-F, ClPsaN-CLBV-R, and their nucleotide sequences are shown in SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6, respectively.

8. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 5, characterized in that: In step (2), the method for constructing the VIGS expression vector is as follows: the VIGS fragment of the citrus ClPsaN gene obtained in step (1) is connected with the TRV2 vector cut with EcoRΙ and BamHΙ and the CLBV vector cut with SmaΙ, respectively, and the resulting vectors are transformed into competent Escherichia coli cells, and the plasmid is extracted to obtain the VIGS expression vector of the ClPsaN gene.

9. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 5, characterized in that: In step (3), the method for transforming citrus with the VIGS expression vector is as follows: the VIGS expression vector obtained in step (2) is transformed into Agrobacterium, an Agrobacterium liquid containing the VIGS expression vector is prepared, and the Agrobacterium liquid is infected with sterile citrus seedlings to obtain VIGS plants in which the ClPsaN gene of citrus is silenced.

10. The method for improving resistance to citrus yellow vein disease using the ClPsaN gene according to claim 9, characterized in that: It also includes verifying the VIGS plants by PCR, using primers TRV2-ClPsaN detection-F and TRV2-ClPsaN detection-R, CLBV-ClPsaN detection-F and CLBV-ClPsaN detection-R, whose nucleotide sequences are shown in SEQ ID No: 9 and SEQ ID No: 10, SEQ ID NO: 13 and SEQ ID NO: 14, respectively.

Images