Application of rice OsFON879 protein and coding gene thereof in regulation and control of plant growth and development

Abstract

The invention discloses application of a rice OsFON879 protein and a coding gene thereof in regulation and control of plant growth and development. The invention provides an application of an OsFON879 protein or an OsFON879 gene in regulating and controlling the fertility of a plant. The regulation is positive regulation, the plant fertility is improved by increasing the content of the OsFON879 protein, and the plant fertility is improved by increasing the abundance of the OsFON879 gene. The invention also provides an application of the OsFON879 protein or the OsFON879 gene as an inhibition target in plant breeding. The target of the plant breeding is to cultivate plants with reduced fertility. The invention provides a new gene resource for researching the rice fertility mechanism, can be used for cultivating sterile new germplasm or fertile new germplasm, and has application value for rice germplasm improvement.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the application of rice OsFON879 protein and its encoding gene in regulating plant growth and development. Background Art

[0002] Angiosperms, or flowering plants, exhibit a diverse array of floral organ numbers and patterns, which are essential for their reproduction and diversification. The development of floral organs is governed by a combination of genetic and molecular mechanisms that determine the formation of sepals, petals, stamens, and pistils. Key transcription factors and signaling pathways, such as the ABC floral organ identity model and the KNOX, YABBY, and AGAMOUS gene families, have been identified as major players in specifying organ identity and number. Hormonal signaling, particularly auxins and gibberellins, plays an important role in regulating floral meristem size and organogenesis, and a complex balance between these factors ensures the correct development and patterning of floral organs.

[0003] The development of floral organs is a key link in the reproductive growth process of plants. The normal development of their number and morphology is crucial for plant reproduction and species continuation. In rice, multiple genes are involved in the regulation of floral organ number. These genes interact through complex molecular mechanisms to jointly affect the size and activity of floral meristems and the formation and differentiation of floral organ primordia. As a monocot, rice has a unique floral structure, including a pistil, six stamens, two lodicules and a pair of glumes, which are essential for pollination and seed formation. Changes in the number of these organs may lead to changes in the plant's ability to produce fertile seeds, thereby affecting overall productivity. In rice, several genes that affect the number of floral organs have been identified, including FON1, FON2 and FON4.

[0004] Although studies have shown that the regulation of rice floral organ number is related to a variety of genes, hormones and environmental factors, the understanding of its molecular mechanisms is still incomplete. In particular, in monocotyledons, many specific genes have not been fully studied. Summary of the invention

[0005] The purpose of the present invention is to provide application of rice OsFON879 protein and its encoding gene in regulating plant growth and development.

[0006] The present invention provides the use of OsFON879 protein or OsFON879 gene in regulating plant fertility.

[0007] The regulation is positive regulation, and an increase in the OsFON879 protein content increases plant fertility.

[0008] The regulation is positive regulation, and a decrease in the OsFON879 protein content reduces plant fertility.

[0009] The regulation is positive regulation, and the increased abundance of the OsFON879 gene increases the fertility of the plant.

[0010] The regulation is positive regulation, and the reduction in the abundance of the OsFON879 gene reduces the fertility of the plant.

[0011] The present invention also provides the use of OsFON879 protein or OsFON879 gene as an inhibition target in plant breeding; the goal of the plant breeding is to cultivate plants with reduced fertility.

[0012] The present invention also provides the use of a substance that inhibits OsFON879 protein or a substance that inhibits OsFON879 gene in plant breeding; the goal of the plant breeding is to cultivate plants with reduced fertility. Inhibiting the OsFON879 gene can specifically be inhibiting the expression of the OsFON879 gene. The substance that inhibits the expression of the OsFON879 gene can specifically be: a gene editing vector targeting the OsFON879 gene. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsFON879 gene. Specifically, the target of the sgRNA is: GCCCCGGTCGTCGCCTCGTC. The plant is a plant having the OsFON879 gene.

[0013] The present invention also provides a method for cultivating a plant with reduced fertility, comprising the following steps: mutating the segment "GGTCGTCGCCTCGTCCGGACCCCCGTGCA" in the OsFON879 gene in the plant genomic DNA into "GGTCGTCGCCTCGTCCCGGACCCCCGTGCA" in a homozygous mutation manner. The plant is a plant having the OsFON879 gene. A homozygous mutation means that the same mutation occurs on a pair of homologous chromosomes.

[0014] The present invention also provides a method for cultivating plants with reduced fertility, comprising the following steps: gene editing the OsFON879 gene in a recipient plant to obtain a gene-edited plant, and screening a plant with reduced fertility relative to the recipient plant from the gene-edited plant. The recipient plant is a plant having the OsFON879 gene. The gene editing is achieved by introducing a gene editing vector. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsFON879 gene. Specifically, the target of the sgRNA is: GCCCCGGTCGTCGCCTCGTC.

[0015] The present invention also provides a method for cultivating plants with reduced fertility, comprising the following steps: inhibiting the expression of the OsFON879 gene in a recipient plant to obtain a plant with reduced fertility relative to the recipient plant. Inhibiting the expression of the OsFON879 gene in the recipient plant can be achieved by introducing a substance that inhibits the expression of the OsFON879 gene into the recipient plant. The substance that inhibits the expression of the OsFON879 gene can be specifically: a gene editing vector targeting the OsFON879 gene. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsFON879 gene. Specifically, the target of the sgRNA is: GCCCCGGTCGTCGCCTCGTC. Inhibiting the expression of the OsFON879 gene in the recipient plant is specifically achieved by introducing a gene editing vector. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsFON879 gene. Specifically, the target of the sgRNA is: GCCCCGGTCGTCGCCTCGTC. The recipient plant is a plant having the OsFON879 gene.

[0016] The present invention also provides a method for cultivating plants with reduced fertility, comprising the following steps: reducing the fertility of the plants by reducing the content of OsFON879 protein in the plants.

[0017] The present invention also protects the use of biological materials related to the OsFON879 protein in cultivating transgenic plants with increased fertility. The plants are plants without the OsFON879 gene.

[0018] The present invention also provides a method for cultivating plants with increased fertility, comprising the following steps: introducing the OsFON879 gene into a recipient plant to obtain a plant with increased fertility relative to the recipient plant. The recipient plant is a plant that does not have the OsFON879 gene. The introduction of the OsFON879 gene into the recipient plant is specifically achieved by introducing a recombinant expression vector having the OsFON879 gene into the recipient plant.

[0019] Any of the above OsFON879 proteins is as follows (a1) or (a2) or (a3) ​​or (a4):

[0020] (a1) the protein shown in SEQ ID NO: 1;

[0021] (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0022] (a3) a protein related to plant fertility obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1);

[0023] (a4) A protein derived from rice, having 98% or more identity with (a1) and associated with plant fertility.

[0024] The labels may be specifically shown in Table 1.

[0025] Table 1 Tag sequences

[0026] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0027] Any of the above OsFON879 genes is a gene encoding the OsFON879 protein.

[0028] Any of the above OsFON879 genes is as follows (b1) or (b2) or (b3) or (b4):

[0029] (b1) a DNA molecule whose coding region is shown in SEQ ID NO: 2;

[0030] (b2) the DNA molecule shown in SEQ ID NO: 3;

[0031] (b3) a DNA molecule derived from rice and having 95% or more identity with (b1) or (b2) and encoding the protein;

[0032] (b4) A DNA molecule that hybridizes to the nucleotide sequence defined in (b1) or (b2) under stringent conditions and encodes the protein.

[0033] The stringent conditions mentioned above may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0034] The OsFON879 protein-related biological material is any one of the following (c1) to (c4):

[0035] (c1) a nucleic acid molecule encoding an OsFON879 protein;

[0036] (c2) an expression cassette containing the nucleic acid molecule described in (c1);

[0037] (c3) a recombinant vector containing the nucleic acid molecule described in (c1) or a recombinant vector containing the expression cassette described in (c2);

[0038] (c4) A recombinant microorganism containing the nucleic acid molecule described in (c1), a recombinant microorganism containing the expression cassette described in (c2), or a recombinant microorganism containing the recombinant vector described in (c3).

[0039] The nucleic acid molecule encoding the OsFON879 protein may specifically be the OsFON879 gene.

[0040] The recombinant vector may specifically be a recombinant expression vector.

[0041] Any of the above-mentioned recombinant expression vectors can specifically be a recombinant plasmid obtained by inserting the double-stranded DNA shown in SEQ ID NO: 4 into the multiple cloning site (such as KpnI and XbaI restriction sites) of the pCAMBIA2300 vector.

[0042] Any of the above mentioned fertility is manifested as fruit setting rate.

[0043] Any of the above-mentioned reductions in fertility are manifested as a reduction in the fruit set rate.

[0044] Any of the above-mentioned increased fertility is manifested as an increase in fruit set rate.

[0045] Any of the above plants may be monocots or dicots.

[0046] Any of the above plants may be a plant of the Poaceae family.

[0047] Any of the above plants may be a rice plant.

[0048] Specifically, any of the above plants can be rice.

[0049] Specifically, any one of the above plants can be rice Dongjin.

[0050] The inventors of the present invention have found that the mutant rice obtained by introducing a gene editing vector into wild-type rice (targeting the OsFON879 gene for gene editing) has a phenotype of reduced fertility, and the introduction of the OsFON879 gene into the mutant rice can restore its fertility (i.e., the fertility of the complemented plant is increased relative to the mutant rice). The present invention provides a new gene resource for studying the fertility mechanism of rice, which can be used to cultivate new sterile germplasm or new fertile germplasm, and has application value for rice germplasm improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 Schematic diagram of the elements of the pCBSG032 vector.

[0052] Figure 2 This is the sequencing result of the os879 ​​mutant strain.

[0053] Figure 3 Schematic diagram of the elements of the pCAMBIA2300 vector.

[0054] Figure 4 These are phenotypic photos of plants and spikelets.

[0055] Figure 5These are the statistical results of seed setting rate, tiller number and grain number per spike; seed setting ratio: seed setting rate; Tiller number: tiller number; Grain number per spike: grain number per spike.

[0056] Figure 6 These are anatomical observation diagrams of floral organs; A corresponds to the wild-type plant, BF corresponds to the os879 ​​plant; Stamen: stamen; Carpel: carpel; Stigma: stigma. DETAILED DESCRIPTION

[0057] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0058] The experimental methods in the following examples are conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified. Unless otherwise specified, the quantitative tests in the following examples are repeated three times, and the results are averaged. Fruiting rate = number of full seeds ÷ (number of full seeds + number of empty seeds) × 100%.

[0059] pCBSG032 vector (elements schematic diagram see Figure 1 ): Weimi Biotechnology Co., Ltd. The pCBSG032 vector is described in the following literature: Tian Y, Zhong D, Li X, Shen R, Han H, Dai Y, Yao Q, Zhang X, Deng Q, Cao X, Zhu JK, Lu Y. High-throughput genome editing in rice with a virus-based surrogate system. J Integr Plant Biol. 2022 Oct 11. doi: 10.1111 / jipb.13381. Epub ahead of print. PMID: 36218268.

[0060] Rice Dongjin belongs to Oryza sativa L. subsp. japonica, also known as japonica rice Dongjin, and is an existing rice germplasm resource. In the embodiments, rice Dongjin plants are also known as wild-type plants, represented by WT.

[0061] The formula of N6 basic medium is shown in Table 2.

[0062] Table 2

[0063]

[0064] Callus induction medium (pH 5.8): On the basis of N6 basic medium, inositol (to make its concentration in the medium 100 mg / L), 2,4-D (to make its concentration in the medium 2 mg / L), proline (to make its concentration in the medium 2.878 g / L), enzymatic hydrolyzed casein (to make its concentration in the medium 300 mg / L), sucrose (to make its concentration in the medium 30 g / L) and plant gel (to make its concentration in the medium 2.6 g / L) were added.

[0065] Co-cultivation medium (pH 5.2): On the basis of N6 basic medium, acetosyringone (to make its concentration in the medium 100 μM), glucose (to make its concentration in the medium 10 g / L) and plant gel (to make its concentration in the medium 2.6 g / L) were added.

[0066] Screening medium (pH 5.8): On the basis of N6 basic medium, hydrolyzed casein (so that its concentration in the medium is 500 mg / L), 2,4-D (so that its concentration in the medium is 2 mg / L), proline (so that its concentration in the medium is 2.8 g / L), sucrose (so that its concentration in the medium is 30 g / L), G418 (so that its concentration in the medium is 150 mg / L), cephalosporin (so that its concentration in the medium is 500 mg / L) and plant gel (so that its concentration in the medium is 2.6 g / L) are added.

[0067] Differentiation medium (pH 5.8): On the basis of N6 basic medium, add kinetin (to make its concentration in the medium 2 mg / L), NAA (to make its concentration in the medium 0.02 mg / L), sucrose (to make its concentration in the medium 30 g / L), sorbitol (to make its concentration in the medium 30 g / L), acid hydrolyzed casein (to make its concentration in the medium 2 g / L) and plant gel (to make its concentration in the medium 2.6 g / L).

[0068] Rooting medium (pH 5.8): contains 1 / 4 concentration of MS inorganic salt, 1× concentration of MS vitamin, 0.5 mg / L NAA, 1 mg / L paclobutrazol, 2.6 g / L plant gel, and the balance is water.

[0069] The formula of AAM infection solution (pH 5.2) is shown in Table 3.

[0070] Table 3

[0071]

[0072]

[0073] Example 1. Discovery of proteins and genes

[0074] By using the Affymetrix GeneChip rice genome chip, the inventors established a dynamic gene expression profile (GEP) of the early development of rice stamens. Systematic analysis of the GEP data revealed new expression patterns of some important developmental genes, including the gene LOC_Os03g12879, which is specifically highly expressed in rice stamens. Database transcriptome analysis also showed that LOC_Os03g12879 is preferentially expressed during stamen development. These data indicate that LOC_Os03g12879 may play a role in stamen development. The inventors further found that the LOC_Os03g12879 gene has neither homologous genes nor conserved domains in rice and other species, and is an orphan gene. Its structure was predicted by Alfafold and found to be disordered. The protein encoded by the LOC_Os03g12879 gene is shown in SEQ ID NO: 1, and the protein is named FON879 protein. The gene encoding the FON879 protein is named FON879 gene.

[0075] Sequencing confirmed that the genomic DNA of rice Dongjin contained the DNA segment shown in SEQ ID NO: 3, and the cDNA of rice Dongjin contained the DNA segment shown in SEQ ID NO: 2, encoding the FON879 protein shown in SEQ ID NO: 1.

[0076] Example 2: Preparation of mutant plants

[0077] In this example, wild-type plants were used as starting plants to prepare CRISPR / Cas9-mediated site-directed gene-edited plants with the FON879 gene as the target gene.

[0078] 1. Preparation of recombinant plasmid

[0079] Target design principles: ① The knockout site is located in the CDS region and is as close to the front end of the protein or the important functional domain as possible; ② Try to cover a higher proportion of transcripts; ③ There is no off-target or the off-target is located in the intergenic region; ④ Targets with higher editing efficiency are preferred; ⑤ The sequence has a relatively balanced GC content and is not easy to form secondary structures.

[0080] The selected target sequence is (PAM is underlined): GCCCCGGTCGTCGCCTCGTC CGG .

[0081] 1. Prepare single-stranded DNA molecules F and R, and then anneal them to obtain double-stranded DNA molecules with sticky ends.

[0082] F: ggcaGCCCCGGTCGTCGCCTCGTC;

[0083] R: aaacGACGAGGCGACGACCGGGGC.

[0084] 2. Take the pCBSG032 vector, digest it with the restriction endonuclease BsaI, and recover the vector backbone (i.e., a large linear fragment of about 1.6 kb).

[0085] 3. The double-stranded DNA molecule with sticky ends obtained in step 1 is connected to the vector backbone obtained in step 2 to obtain a recombinant plasmid, which is the gene editing vector. The gene editing vector has been sequenced and verified.

[0086] 2. Preparation of mutant plants using CRSPR / Cas9 technology

[0087] 1. Callus induction and subculture

[0088] Take mature seeds of rice Dongjin, peel off the husk, disinfect with 75% ethanol solution for 1 minute, then rinse with sterile water, then disinfect with 30% sodium hypochlorite solution for 20 minutes, then wash thoroughly with sterile water, use sterile filter paper to absorb the moisture on the surface of the seeds, and then transfer the seeds to callus induction medium for culture to obtain callus tissue for Agrobacterium infection.

[0089] 2. Preparation of Agrobacterium suspension

[0090] The gene editing vector prepared in step 1 was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium. The recombinant Agrobacterium was cultured and the cells were collected and suspended with AAM infection solution to obtain OD 600nm The value is 0.3-0.5 for Agrobacterium suspension.

[0091] 3. Agrobacterium infection

[0092] Take the callus obtained in step 1, immerse it in the Agrobacterium suspension prepared in step 2, and infect it at room temperature for 20 minutes (shake it from time to time during the period), then take out the callus, absorb the excess bacterial solution with sterile filter paper, and then transfer it to the co-cultivation medium covered with a layer of sterile filter paper, and culture it in the dark at 26°C for 3 days.

[0093] 4. Screening and cultivation

[0094] After completing step 3, take the callus tissue, rinse it twice with sterile water, then rinse it once with carbenicillin solution, remove excess water with a pipette, transfer it to sterile filter paper, air-dry the surface moisture on a clean bench, and then transfer it to a screening medium containing hygromycin. Culture it in the dark at 28-30℃ for 3-4 weeks. At this time, positive calli with bright yellow color and 1-2 mm diameter can be observed.

[0095] 5. Differentiation and regeneration

[0096] Take the positive callus obtained in step 4, transfer it to the differentiation medium, and culture it under alternating light and dark conditions (16h light / 8h dark) at 28-30°C. After about 10 days of culture, green spots can be observed on the callus, and seedlings will differentiate after another 10 days of culture. Culture until the differentiated seedlings are 2-3 cm tall.

[0097] 6. Rooting

[0098] Take the seedlings obtained in step 5, transfer them to rooting medium, and culture them at 28-30° C. with alternating light and dark conditions (16 h light / 8 h dark). The rooted seedlings are T0 generation plants.

[0099] 3. Identification of Mutation Forms

[0100] The T0 generation plants obtained in step 2 are self-pollinated and seeds are harvested, and the seeds are cultivated into plants, namely the T1 generation plants.

[0101] The leaves of T1 plants were taken to extract genomic DNA, and PCR amplification was performed using a primer pair consisting of J218182-F1 and J218182-R1, and then the amplified products were recovered and sequenced. Mutants were screened based on the sequencing results.

[0102] J218182-F1: TGGCGGATCTACCATAGGA;

[0103] J218182-R1:CCCCTAAACAACCTGGGACC.

[0104] A homozygous mutant strain was screened from the T1 generation plants and was named os879 ​​mutant strain.

[0105] Compared with the genomic DNA of the wild-type plant, the coding region of the FON879 gene in the genomic DNA of the os879 ​​mutant strain has a nucleotide C inserted (i.e., the following mutation occurred in both homologous chromosomes: from "GGTCGTCGCCTCGTCCGGACCCCCGTGCA" to "GGTCGTCGCCTCGTCCCGGACCCCCGTGCA"), resulting in a frame shift and failure to translate normal proteins. Sequencing results are shown in Figure 2 .

[0106] Example 3: Preparation of complementary plants

[0107] 1. Preparation of recombinant plasmid

[0108] The double-stranded DNA shown in SEQ ID NO: 4 was inserted into the pCAMBIA2300 vector (see the schematic diagram of the elements of the pCAMBIA2300 vector for details). Figure 3 ) between the KpnI and XbaI restriction sites to obtain a recombinant plasmid. The recombinant plasmid has been sequenced and verified.

[0109] 2. Preparation of complementary plants

[0110] The mature seeds obtained by self-pollination of the os879 ​​mutant obtained in Example 2 were used to replace the mature seeds of rice Dongjin, the recombinant plasmid prepared in step 1 was used to replace the gene editing vector, and the screening medium containing kanamycin was used to replace the screening medium containing hygromycin. The rest was the same as step 2 of Example 2.

[0111] 3. Screening of homozygous transgenic plants

[0112] The T0 generation plants obtained in step 2 are self-pollinated and seeds are harvested, and the seeds are cultivated into plants, namely the T1 generation plants.

[0113] Transgenic plants are selected from the T1 generation plants, namely the T1 generation transgenic plants.

[0114] The T1 generation transgenic plants are self-pollinated and seeds are harvested, and the seeds are cultivated into plants, namely the T2 generation plants.

[0115] For a certain T1 generation transgenic plant, if all T2 generation plants obtained by self-pollination are transgenic plants, the T1 generation transgenic plant is a homozygous transgenic plant, and all self-pollinated offspring of the plant are homozygous transgenic plants.

[0116] Method for screening or identifying transgenic plants: Take leaves of the plant, extract genomic DNA, and use a primer pair consisting of GP2300KanF and GP2300KanR (primers target the kanamycin resistance gene on the vector, and the target fragment is 328bp) for PCR amplification. If an amplification product of the expected size is obtained, the plant is a transgenic plant.

[0117] GP2300KanF: TGTCATACCACTTGTCCGCC;

[0118] GP2300KanR: ATCGAGCTGTATGCGGAGTG.

[0119] Example 4, Property Comparison

[0120] Test plants: wild-type plants, plants grown from seeds obtained by self-pollination of the os879 ​​mutant obtained in Example 2 (referred to as os879 ​​plants or 03g12879 plants), and T2 generation homozygous transgenic plants obtained in Example 3 (referred to as Os879oE plants or 03g12879oE / 03g12879 plants).

[0121] The test plants were cultured normally under parallel conditions. At maturity, the fruit setting rate, tillering number and ear grain number were detected and counted.

[0122] Phenotypic photos of plants at heading stage are shown in Figure 4 The phenotypic photos of spikelets are shown in Figure 4 The statistical results of seed setting rate, tillering number and number of grains per ear are shown in Figure 5 (The number of samples for each test plant was 10 plants). There was no significant difference in morphology among the test plants at the seedling stage. There was no significant difference in the number of tillers and the number of grains per ear among the test plants at the mature stage. There was no significant difference in the fruit setting rate between the wild-type plants and the Os879oE plants. The fruit setting rate of the os879 ​​plants was significantly lower than that of the wild-type plants.

[0123] The flower organs of wild-type plants and os879 ​​plants were taken for anatomical observation. Compared with wild-type plants, the flower organ development of os879 ​​plants was significantly abnormal. Among the 50 florets of os879 ​​plants counted: 24% of the flowers had a decrease in the number of stamens (the minimum was 4), 30% of the flowers had an increase in the number of stamens (the maximum was 9); 32% of the flowers had 2 carpels, 12% of the flowers had 3 carpels, and 70% of the flowers had an increase in the number of stigmas. In addition, some florets of os879 ​​plants showed an increase in palea. Based on the above phenotypes, it can be inferred that the FON879 gene is involved in the determination of the number of rice flower organs, and its mutation causes changes in the number of stamens and pistils.

[0124] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Application of OsFON879 protein or OsFON879 gene in regulating plant fertility; The OsFON879 protein is as follows (a1) or (a2) or (a3) ​​or (a4): (a1) the protein shown in SEQ ID NO: 1; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) a protein related to plant fertility obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1); (a4) a protein derived from rice that has 98% or more identity with (a1) and is associated with plant fertility; The OsFON879 gene is a gene encoding the OsFON879 protein.

2. The use according to claim 1, characterized in that: The OsFON879 gene is as follows (b1) or (b2) or (b3) or (b4): (b1) a DNA molecule whose coding sequence is shown in SEQ ID NO: 2; (b2) the DNA molecule shown in SEQ ID NO: 3; (b3) a DNA molecule derived from rice and having 95% or more identity with (b1) or (b2) and encoding the protein; (b4) A DNA molecule that hybridizes to the nucleotide sequence defined in (b1) or (b2) under stringent conditions and encodes the protein.

3. Use of OsFON879 protein or OsFON879 gene as an inhibition target in plant breeding; the goal of plant breeding is to cultivate plants with reduced fertility; the OsFON879 protein is the OsFON879 protein described in claim 1; the OsFON879 gene is the OsFON879 gene described in claim 1 or 2.

4. Use of a substance inhibiting OsFON879 protein or a substance inhibiting OsFON879 gene in plant breeding; the goal of the plant breeding is to cultivate plants with reduced fertility; the OsFON879 protein is the OsFON879 protein described in claim 1; the OsFON879 gene is the OsFON879 gene described in claim 1 or 2.

5. A method for cultivating plants with reduced fertility, comprising the following steps: mutating the segment "GGTCGTCGCCTCGTCCGGACCCCCGTGCA" in the OsFON879 gene in the plant genomic DNA into "GGTCGTCGCCTCGTCCCGGACCCCCGTGCA" in a homozygous mutation manner; the OsFON879 gene is the OsFON879 gene described in claim 1 or 2.

6. A method for cultivating plants with reduced fertility, comprising the following steps: gene editing the OsFON879 gene in a recipient plant to obtain gene-edited plants, and screening plants with reduced fertility relative to the recipient plant from the gene-edited plants; the OsFON879 gene is the OsFON879 gene described in claim 1 or 2.

7. A method for cultivating plants with reduced fertility, comprising the following steps: inhibiting the expression of the OsFON879 gene in a recipient plant to obtain a plant with reduced fertility relative to the recipient plant; the OsFON879 gene is the OsFON879 gene described in claim 1 or 2.

8. A method for cultivating plants with reduced fertility, comprising the following steps: reducing the fertility of the plants by reducing the content of OsFON879 protein in the plants; the OsFON879 protein is the OsFON879 protein described in claim 1.

9. Application of OsFON879 protein-related biomaterials in cultivating transgenic plants with increased fertility; The OsFON879 protein-related biological material is any one of the following (c1) to (c4): (c1) a nucleic acid molecule encoding an OsFON879 protein; (c2) an expression cassette containing the nucleic acid molecule described in (c1); (c3) a recombinant vector containing the nucleic acid molecule described in (c1) or a recombinant vector containing the expression cassette described in (c2); (c4) a recombinant microorganism containing the nucleic acid molecule described in (c1), a recombinant microorganism containing the expression cassette described in (c2), or a recombinant microorganism containing the recombinant vector described in (c3); The OsFON879 protein is the OsFON879 protein described in claim 1.

10. A method for cultivating a transgenic plant with increased fertility, comprising the following steps: introducing an OsFON879 gene into a recipient plant to obtain a plant with increased fertility relative to the recipient plant; the OsFON879 gene is the OsFON879 gene described in claim 1 or 2.

Images