Method and device for simultaneously detecting various gene mutations related to thalassemia

Abstract

The invention relates to a method and device for simultaneously detecting multiple gene mutations related to thalassemia, and the method comprises the following steps: obtaining nanopore sequencing data of a to-be-detected sample, the to-be-detected sample comprising amplification products of multiple PCR primer pairs for simultaneously detecting multiple gene mutations related to thalassemia; performing quality control screening on the nanopore sequencing data according to the amplification length of the multiple PCR primer pair to obtain first target sequencing data; according to the first target sequencing data, obtaining the sequence number of the amplification product of the PCR multiple primer pair, and according to the sequence number of the amplification product of the PCR multiple primer pair, determining the gene mutation information related to thalassemia of the to-be-detected sample. According to the application, deletion mutation and non-deletion mutation related to thalassemia can be detected at the same time, and the accuracy of HBA1 and HBA2 gene detection results is improved.

Description

Technical Field

[0001] The present application relates to the technical field of bioinformatics, and in particular, to a method and device for simultaneously detecting multiple gene mutations associated with thalassemia. Background Art

[0002] Thalassemia is the most common single gene genetic disease in the world. It is an autosomal recessive inheritance and is mainly distributed in the Mediterranean coast and Southeast Asian countries.

[0003] The human alpha-globin gene cluster is located on chromosome 16. The two genes HBA1 (alpha-1) and HBA2 (alpha-2) have the ability to encode globin in embryos and adults. The expression level of the HBA2 gene is about twice that of HBA1, and the pathogenic mutation on HBA2 is more obvious. Other genes are only translated and expressed in the embryonic period, or are pseudogenes.

[0004] The coding regions of HBA1 and HBA2 genes are exactly the same, with a few base differences in the 5' uncoding region (UTR) and intron region, and the main differences are concentrated in the 3'UTR. Mutations in HBA1 and HBA2 genes include deletion and non-deletion mutations. It has been found that about 50 deletions in the α-globin gene cluster region can lead to reduced or absent α-globin expression, of which the three most common deletion types are -α 3.7 , -α 4.2 and-- SEA There are two evolutionarily highly homologous regions of about 4 Kb in the HBA1 and HBA2 gene regions and nearby regions, which can be divided into X / Y / Z and X2 / Y2 / Z2 according to the sequence. The Z and Z2 regions are 3.7 Kb apart. Recombination between the two regions will cause the loss of one copy of the α-globin gene, resulting in -α 3.7 Deletion mutation. The X and X2 regions are 4.2 Kb apart, and recombination between the two regions can also lead to the deletion of one copy of the α-globin gene, resulting in -α 4.2 Deletion mutation. The SEA deletion region exceeds 19Kb and includes multiple genes including HBA1 and HBA2 in the α-globin gene cluster. Thai deletion type (-- THAI Deletion type) α-thalassemia 1 is a rare deletion type thalassemia, which lacks an α-globin gene cluster of about 33.5kb in length, and the range of the deletion is greater than - SEA Deletion mutations include α1, α2, and ζ globin genes, resulting in no production of α and ζ mRNA. Its 5' breakpoint is about 3kb upstream of the α globin gene start codon, and its 3' breakpoint is about 6.6kb downstream of the α globin gene start codon.

[0005] At least 70 point mutations that lead to reduced or absent α-globin expression have been reported. Among them, the three most common point mutation types are QS, CS and WS located on the HBA2 gene.

[0006] Molecular diagnostic methods can effectively detect mutations in the HBA1 / 2 gene region. Currently, the multiplex PCR system is used to detect thalassemia based on Pacbio's third-generation sequencing technology, and the amplified product is as long as 10 to 20 kbp. This method covers a lot of sites, but the product is too long and the test results are not stable enough. Even if the full-length fragment of the amplicon is sequenced completely, when performing bioinformatics analysis of the sequencing data, due to -α 3.7 , -α 4.2 It is difficult to obtain perfect alignment results when the two sides have very high homology regions. Various open source software for detecting structural variations, such as cuteSV and sniffles, cannot stably align -α 3.7 and -α 4.2 Replacing the upstream alignment software, such as ngmlr, lra, and minimap2, and combining them with various structural variation software, still failed to stably detect -α 3.7 and -α 4.2 At the same time, in the alignment process of the HBA2 gene, it is difficult to distinguish HBA2 from HAB1, and many fragments also have alignment errors.

[0007] Therefore, how to improve the accuracy of detecting HBA1 / 2 genes is a difficulty in detecting gene mutations related to thalassemia. Summary of the invention

[0008] In order to solve the above problems and improve the accuracy of HBA1 and HBA2 gene detection results, a first object of an embodiment of the present application is to provide a method for simultaneously detecting multiple gene mutations related to thalassemia, the method comprising:

[0009] Obtaining nanopore sequencing data of a sample to be tested, wherein the sample to be tested includes amplification products of a multiplex PCR primer pair for simultaneously detecting multiple gene mutations associated with thalassemia;

[0010] Performing quality control screening on the nanopore sequencing data according to the amplification length of the multiplex PCR primer pair to obtain first target sequencing data;

[0011] The sequence number of the product amplified by the multiplex PCR primer pair is obtained according to the first target sequencing data, and the gene mutation information related to thalassemia of the sample to be tested is determined according to the sequence number of the product amplified by the multiplex PCR primer pair.

[0012] The present application creatively performs quality control on nanopore sequencing data based on the amplification length of multiple PCR primer pairs, requiring the sequencing fragment length to be within a specific length to reduce nonspecific amplification data, which can improve the accuracy of subsequent HBA1 and HBA2 gene mutation information.

[0013] In one embodiment, the multiplex PCR primer pair includes α for detecting HBA1 and HBA2 gene deletion mutations. 3.7 Primer pair, α 4.2 primer pair, SEA primer pair and THAI primer pair, obtaining the sequence number of the product amplified by the multiple PCR primer pair according to the first target sequencing data, and determining the gene mutation information related to thalassemia of the sample to be tested according to the sequence number of the product amplified by the multiple PCR primer pair specifically includes:

[0014] Obtain α based on the first target sequencing data 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, SEA primer pair, and THAI primer pair;

[0015] According to α 3.7 Primer pair, α 4.2 The sequence number of the amplified products of the primer pair, SEA primer pair, and THAI primer pair determines whether the sample to be tested has a target deletion mutation;

[0016] Among them, the target deletion mutations include -α 3.7 Deletion mutation, -α 4.2 Deletion mutation, -- SEA Deletion mutations and -- THAI At least one of the deletion mutations.

[0017] In one embodiment, the multiplex PCR primer pair further includes an HBA1 primer pair and an HBA2 primer pair for detecting non-deletion mutations of the HBA1 and HBA2 genes, and the sequence number of the amplified product of the multiplex PCR primer pair is obtained according to the first target sequencing data, and the gene mutation information related to thalassemia of the sample to be tested is determined according to the sequence number of the amplified product of the multiplex PCR primer pair, which specifically includes:

[0018] According to the first target sequencing data, obtain the HBA1 primer pair, HBA2 primer pair, α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, SEA primer pair, and THAI primer pair;

[0019] If the number of sequences of the amplified products of the HBA1 primer pair and the HBA2 primer pair is not less than the second preset threshold, then according to α 3.7 Primer pair, α 4.2The sequence numbers of the products amplified by the primer pair, the SEA primer pair, and the THAI primer pair determine whether the sample to be tested has one of the target deletion mutations;

[0020] If the number of sequences of the amplified products of the HBA1 primer pair and the HBA2 primer pair is lower than the second preset threshold, then according to α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, the SEA primer pair and the THAI primer pair determine whether the sample to be tested has two of the target deletion mutations.

[0021] In one embodiment, the multiplex PCR primer pair further includes an HBB primer pair for detecting the HBB gene, obtaining the sequence number of the amplified product of the multiplex PCR primer pair according to the first target sequencing data, and determining the gene mutation information related to thalassemia of the sample to be tested according to the sequence number of the amplified product of the multiplex PCR primer pair specifically includes:

[0022] According to the first target sequencing data, the HBB primer pair, α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, SEA primer pair, and THAI primer pair;

[0023] If the number of sequences of the amplified product of the HBB primer pair is not less than the second preset threshold, according to α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, SEA primer pair and THAI primer pair indicate whether the sample to be tested has a target deletion mutation.

[0024] In one embodiment, according to α 3.7 Primer pair, α 4.2 The sequence numbers of the amplified products of the primer pair, SEA primer pair and THAI primer pair and whether the sample to be tested has a target deletion mutation include:

[0025] If α 3.7 Primer pair, α 4.2 If the number of sequences of the product amplified by the primer pair, SEA primer pair or THAI primer pair exceeds a first preset threshold, it is determined that the sample to be tested has a target deletion mutation corresponding to the primer pair.

[0026] In one embodiment, the method further comprises:

[0027] Compare the first target sequencing data with the reference genome to obtain second target sequencing data whose alignment quality meets preset conditions and has not been deduplicated;

[0028] Acquire non-deletion mutation information and / or haplotype information of a target gene according to the second target sequencing data, wherein the target gene includes at least one gene among the HBB gene, the HBA1 gene, and the HBA2 gene;

[0029] Optionally, the alignment quality of the second target sequencing data is not less than 30.

[0030] In one embodiment, the first target sequencing data satisfies at least one of the following conditions (1) to (2):

[0031] (1) The read length of the first target sequencing data is 800 bp to 3000 bp;

[0032] (2) The base quality Q of the first target sequencing data is not less than 10.

[0033] The second object of the present application is to provide a device for simultaneously detecting multiple gene mutations related to thalassemia, comprising:

[0034] Sequencing data acquisition module: used to obtain nanopore sequencing data of the sample to be tested, the sample to be tested includes amplification products of multiple PCR primer pairs, and the amplification products of the multiple PCR primer pairs include amplification products of multiple PCR primer pairs for simultaneously detecting multiple gene mutations related to thalassemia;

[0035] Sequencing data quality control module: used to perform quality control screening on the nanopore sequencing data according to the amplification length of the multiplex PCR primer pair to obtain first target sequencing data;

[0036] The first mutation information detection module is used to obtain the sequence number of the product amplified by the multiple PCR primer pair according to the first target sequencing data, and determine the gene mutation information related to thalassemia of the sample to be tested according to the sequence number of the product amplified by the multiple PCR primer pair.

[0037] The present application also relates to a computer device, comprising a memory and a processor, wherein the memory stores a computer program, and wherein the processor implements the steps of the above method when executing the computer program.

[0038] The present application also relates to a computer-readable storage medium having a computer program stored thereon, wherein the computer program implements the steps of the above method when executed by a processor.

[0039] The present application also relates to a computer program product, comprising a computer program, characterized in that the steps of the above method are implemented when the computer program is executed by a processor. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0041] Figure 1 A flowchart of a method for simultaneously detecting multiple gene mutations associated with thalassemia provided in an embodiment of the present application;

[0042] Figure 2 A structural block diagram of a device for simultaneously detecting multiple gene mutations associated with thalassemia provided in an embodiment of the present application;

[0043] Figure 3 An internal structure diagram of a computer device provided in an embodiment of the present application;

[0044] Figure 4 A flowchart of the method for simultaneously detecting multiple gene mutations associated with thalassemia provided in Example 1 of the present application;

[0045] Figure 5 The barcode 8, 9, 10, 12, 13, 14, 15 and 16 CD 41 / 42 IGV visualization results provided in Example 3 of the present application;

[0046] Figure 6 The barcode21 CD 41 / 42IGV visualization result provided in Example 4 of the present application;

[0047] Figure 7 The barcode 22 (A>G) IGV visualization result provided in Example 4 of the present application;

[0048] Figure 8 The barcode23 IVS-Ⅱ-654 (C>T) IGV visualization result provided in Example 4 of the present application;

[0049] Fig. 9 Barcode 25α provided in Example 4 of this application QS IGV visualization results;

[0050] Fig.10 Barcode 26α provided in Example 4 of this application CS IGV visualization results;

[0051] Fig.11 The barcode27 HbE, CD16 IGV visualization results provided in Example 4 of the present application;

[0052] Fig.12 The barcode28 (A>G) IGV visualization result provided in Example 4 of the present application;

[0053] Fig.13 The barcode29 IVS-I-1 (G>A) IGV visualization result provided in Example 4 of the present application;

[0054] Fig.14 The barcode31 CD17 IGV visualization result provided in Example 4 of the present application;

[0055] Fig.15 This is the genetic map provided in Example 6 of the present application. DETAILED DESCRIPTION

[0056] References to embodiments of the present application will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present application. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present application without departing from the scope or spirit of the present application. For example, a feature described or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0057] Therefore, it is intended that the present application covers such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present application are disclosed in or are apparent from the following detailed description. It will be appreciated by those of ordinary skill in the art that this discussion is merely a description of exemplary embodiments and is not intended to limit the broader aspects of the present application.

[0058] In order to at least partially solve the above technical problems, the first aspect of the present application provides a method for simultaneously detecting multiple gene mutations associated with thalassemia, as shown in the flowchart: Figure 1 As shown, the method includes:

[0059] S10: Obtaining nanopore sequencing data of a sample to be tested, where the sample to be tested includes amplification products of a multiplex PCR primer pair for simultaneously detecting multiple gene mutations associated with thalassemia;

[0060] In the present application, the sample to be tested is derived from a mammal.

[0061] As used herein, the term "mammal" includes any diploid animal including humans, tigers, wolves, mice, deer, minks, monkeys, tapirs, sloths, zebras, dogs, foxes, bears, elephants, leopards, musk deer, cows, lions, pandas, warts, pigs, antelopes, reindeers, koalas, rhinos, lynxes, pangolins, giraffes, pandas, anteaters, gorillas, manatees, otters, civets, dolphins, walruses, platypuses, hedgehogs, Arctic foxes, polar bears, kangaroos, armadillos, hippos, seals, whales, weasels, and rabbits.

[0062] ONT sequencing (Oxford Nanopore Technologies, referred to as ONT), that is, nanopore sequencing technology, is a third-generation sequencing technology based on electrical signal recognition of base sequences. Before sequencing, small linker molecules are connected to both ends of the nucleic acid fragments through library construction. These linkers help the DNA chain to be captured by the anchor protein near the nanopore and assist the nucleic acid fragments to pass through the nanopore protein. Nanopore proteins will generate different electrical signals when passing through different base sequences. By real-time detection of these electrical signals, the corresponding base type can be obtained to complete the sequencing of nucleic acid molecules.

[0063] Multiplex PCR (mPCR) is also called composite PCR. Its basic principle is the same as conventional PCR. The difference is that two or more pairs of primers are added to the multiplex PCR reaction system. Each pair of primers binds to the corresponding position of the template, and PCR reactions of multiple nucleic acid fragments are amplified simultaneously.

[0064] In some embodiments, in order to achieve simultaneous detection of HBA1, HBA2 and HBB genes, the multiplex PCR primer pair includes primers for detecting HBA1 and HBA2 genes-α 3.7 Missing-α 3.7 Primer pairs for detecting HBA1 and HBA2 genes-α 4.2 Missing-α 4.2 Primer pairs for detecting HBA1 and HBA2 genes -- SEA Missing -- SEA Primers and for detecting HBA1 and HBA2 genes -- THAI Missing -- THAI Primer pair, HBB primer pair for detecting HBB gene, and HBA1 primer pair and HBA2 primer pair for detecting non-deletion mutations of HBA1 and HBA2 genes, so as to realize simultaneous detection of multiple gene mutations related to thalassemia.

[0065] This application can detect non-deletion mutations in HBB, HBA1, and HBA2 genes, and can also detect the most common -α 3.7 , -α 4.2 , --SEA And the less common -- THAI Deletion mutations.

[0066] S20: performing quality control screening on the nanopore sequencing data according to the amplification length of the multiplex PCR primer pair to obtain first target sequencing data;

[0067] Specifically, when the present application performs quality control on nanopore sequencing data, the length of the sequencing fragment is required to be within a specific length according to the amplification length of the multiple PCR primer pairs, so as to reduce non-specific amplification data and improve the accuracy of subsequent HBA1 and HBA2 gene mutation information.

[0068] In some specific embodiments, quality control conditions can be set according to the amplification length of the multiplex PCR primer pair to require that the first target sequencing data is in the range of 800 bp to 3000 bp and the base quality Q is not less than 10.

[0069] S30: Obtaining the sequence number of the product amplified by the multiplex PCR primer pair according to the first target sequencing data, and determining the gene mutation information related to thalassemia of the sample to be tested according to the sequence number of the product amplified by the multiplex PCR primer pair;

[0070] Specifically, the number of sequences of the amplification products of each primer pair refers to the number of sequencing fragments in the first target sequencing data that contain both the upstream primer sequence and the downstream primer sequence of the primer pair.

[0071] In some embodiments, the multiplex PCR primer pair includes an α3.7 primer pair for detecting HBA1, HBA2 gene-α3.7 deletion, an α3.7 primer pair for detecting HBA1, HBA2 gene-α 4.2 Deletion α4.2 primer pair and for detecting HBA1, HBA2 genes -- SEA Missing SEA primer pairs and detection of HBA1, HBA2 genes - THAI The missing THAI primer pair, obtaining the sequence number of the amplified product of the multiple PCR primer pair according to the first target sequencing data, and determining the gene mutation information related to thalassemia of the sample to be tested according to the sequence number of the amplified product of the multiple PCR primer pair specifically includes:

[0072] Obtain α based on the first target sequencing data 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, SEA primer pair, and THAI primer pair;

[0073] According to α 3.7 Primer pair, α 4.2 The sequence number of the amplified products of the primer pair, SEA primer pair, and THAI primer pair determines whether the sample to be tested has a target deletion mutation;

[0074] Among them, the target deletion mutations include -α 3.7 Deletion mutation, -α 4.2 Deletion mutation, -- SEA Deletion mutations and -- THAI At least one of the deletion mutations.

[0075] Specifically, if α 3.7 Primer pair, α 4.2 If the number of sequences of the product amplified by the primer pair, SEA primer pair or THAI primer pair exceeds a first preset threshold, it is determined that the sample to be tested has a target deletion mutation corresponding to the primer pair.

[0076] In some specific implementation schemes, the first preset threshold is 15.

[0077] In some embodiments, the multiplex PCR primer pair includes an HBA1 primer pair and an HBA2 primer pair for detecting non-deletion mutations of HBA1 and HBA2 genes, and the sequence number of the amplified product of the multiplex PCR primer pair is obtained according to the first target sequencing data. The gene mutation information related to thalassemia of the sample to be tested is determined according to the sequence number of the amplified product of the multiplex PCR primer pair, and specifically includes:

[0078] According to the first target sequencing data, obtain the HBA1 primer pair, HBA2 primer pair, α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, SEA primer pair, and THAI primer pair;

[0079] If the number of sequences of the amplified products of the HBA1 primer pair and the HBA2 primer pair is not less than the second preset threshold, then according to α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, the SEA primer pair, and the THAI primer pair determine whether the sample to be tested has one of the target deletion mutations;

[0080] If the number of sequences of the amplified products of the HBA1 primer pair and the HBA2 primer pair is lower than the second preset threshold, then according to α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, the SEA primer pair and the THAI primer pair determine whether the sample to be tested has two of the target deletion mutations.

[0081] In some specific implementation schemes, the second preset threshold is 50.

[0082] It should be noted that due to -α 3.7 , -α 4.2It is difficult to obtain perfect alignment results when there are very high homologous regions on both sides. The reason is that the sequence that should appear in region A is aligned to region B due to high homology, and because region B is originally on a PCR product, it cannot be directly split into two fragments during alignment. This is also the reason for the two deletions. During cell meiosis, due to the local misalignment of chromosome pairing, the fragments are lost during crossover. Therefore, the visualization method cannot perfectly observe the broken fragments.

[0083] The present application detects deletion mutations by counting the sequence numbers of primer amplification products, thereby avoiding alignment errors caused by the high homology between the HBA2 and HBA1 genes and their flanking regions, and improving the accuracy of the HBA1 and HBA2 gene deletion mutation detection results.

[0084] In some embodiments, the multiplex PCR primer pair further includes an HBB primer pair for detecting the HBB gene, and obtaining the sequence number of the amplified product of the multiplex PCR primer pair according to the first target sequencing data, and determining the gene mutation information related to thalassemia of the sample to be tested according to the sequence number of the amplified product of the multiplex PCR primer pair specifically includes:

[0085] According to the first target sequencing data, the HBB primer pair, α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, SEA primer pair, and THAI primer pair;

[0086] If the number of sequences of the amplified product of the HBB primer pair is not less than the second preset threshold, according to α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, SEA primer pair and THAI primer pair indicate whether the sample to be tested has a target deletion mutation.

[0087] The human beta-globin gene cluster is located on chromosome 11, of which only the HBB (beta) gene encodes globin in adults, and the other four genes are expressed during embryonic development or at very low levels in adults. The HBB primer pair is mainly excellent for detecting non-deletion mutations of the HBB gene, including single point mutations, small insertions and deletions, etc.

[0088] Specifically, the sequence number of the product amplified by the HBB primer pair can be used as a quality control parameter for detecting deletion mutations of the HBA1 gene and the HBA2 gene. When the sequence number of the product amplified by the HBB primer pair in the first target sequencing data is lower than the second preset threshold, it indicates that there may be problems in the library construction and sequencing process of the sample to be tested, and resampling and testing are required.

[0089] It is understandable that, in addition to the HBB gene, the sequence numbers of the amplification products of primer pairs of other genes can also be used as quality control parameters for detecting deletion mutations of the HBA1 gene and the HBA2 gene, except for the sequence numbers of other conventional internal reference gene primer pairs.

[0090] S50: aligning the first target sequencing data with the reference genome to obtain second target sequencing data whose alignment quality meets a preset condition and has not been deduplicated;

[0091] Specifically, when comparing with the reference genome, the comparison quality of the second target sequencing data is not less than 30, and no deduplication processing is performed.

[0092] The reference genome is a representative sequence of a species. The choice of reference genome varies depending on the source of the sample to be tested.

[0093] In some specific embodiments, when the sample to be tested is derived from a human, the reference genome is a human reference genome, such as human reference genome hg38.

[0094] The present application can reduce the alignment errors of the homologous regions of the HBA2 and HBA1 genes by performing quality control on the alignment quality after data alignment, thereby improving the accuracy of subsequent acquisition of HBA1 and HBA2 mutation information.

[0095] S60: According to the non-deletion mutation information and / or haplotype information obtained from the second target sequencing data, the target gene includes at least one of the HBB gene, the HBA1 gene, and the HBA2 gene;

[0096] Specifically, non-deletion mutations include point mutations and deletion mutations of small fragments of the amplified region, such as a 3kb deletion mutation.

[0097] In some specific embodiments, obtaining non-target deletion mutation information and / or haplotype information of the target gene according to the second target sequencing data includes:

[0098] Determine a non-deletion mutation of the target gene according to the second target sequencing data;

[0099] The SNP information and non-deletion mutation information of the target gene are annotated according to the non-deletion mutation of the target gene.

[0100] It should be noted that after obtaining the comparison data with the genome, the present application does not perform deduplication processing on the sequencing data. As long as the comparison quality is improved, as much sequencing data as possible is retained to improve the accuracy of the subsequent annotation of SNP information and point mutation information.

[0101] In some embodiments, after determining the non-target deletion mutation of the target gene according to the second target sequencing data, the method further comprises:

[0102] The haplotype of the target gene is determined based on the non-deletion mutation of the target gene.

[0103] It can be understood that the present application uses nanopore sequencing technology to perform complete amplicon sequencing of the thalassemia-related HBB, HBA1, and HBA2 genes, without the need to interrupt the DNA like the second-generation sequencing, so that the complete information of the two alleles of the gene can be obtained, thereby obtaining the complete haplotype of the HBB, HBA1, and HBA2 genes.

[0104] This application is based on nanopore sequencing technology, which can complete the sequencing of 24 samples within 30 minutes and the detection of 96 samples within 2 hours, and can distinguish the genotypes of the alleles of the HBB, HBA1, and HBA2 genes.

[0105] The second aspect of the present application provides a device for simultaneously detecting multiple gene mutations associated with thalassemia, comprising:

[0106] Sequencing data acquisition module: used to obtain nanopore sequencing data of the sample to be tested, the sample to be tested includes the amplification product of the multiple PCR primer pair for simultaneously detecting multiple gene mutations related to thalassemia;

[0107] Sequencing data quality control module: used to perform quality control screening on nanopore sequencing data according to the amplification length of the multiple PCR primer pairs to obtain the first target sequencing data;

[0108] The first mutation information detection module is used to obtain the sequence number of the product amplified by the multiple PCR primer pair according to the first target sequencing data, and determine the gene mutation information related to thalassemia of the sample to be tested according to the sequence number of the product amplified by the multiple PCR primer pair.

[0109] In some embodiments, the device further comprises:

[0110] Sequencing data comparison module: used to compare the first target sequencing data with the reference genome to obtain the second target sequencing data whose comparison quality meets the preset conditions;

[0111] The second mutation information detection module is used to obtain non-target deletion mutation information and / or haplotype information of the target gene according to the second target sequencing data.

[0112] For the specific definition of the device for simultaneously detecting multiple gene mutations associated with thalassemia, please refer to the definition of the method for simultaneously detecting multiple gene mutations associated with thalassemia above, which will not be repeated here. Each module in the above-mentioned device for simultaneously detecting multiple gene mutations associated with thalassemia can be implemented in whole or in part by software, hardware and a combination thereof. The above-mentioned modules can be embedded in or independent of the processor in the computer device in the form of hardware, or can be stored in the memory in the computer device in the form of software, so that the processor can call and execute the operations corresponding to the above modules.

[0113] In some embodiments, a computer device is provided, which may be a server 104 or a terminal 102, and its internal structure diagram may be as follows: Figure 4 As shown. The computer device includes a processor, a memory and a communication interface connected through a system bus. When the computer device is a terminal, it also includes a display screen and an input device connected to the system bus. Among them, the processor of the computer device is used to provide computing and control capabilities. The memory of the computer device includes a non-volatile storage medium and an internal memory. The non-volatile storage medium stores an operating system and a computer program. The internal memory provides an environment for the operation of the operating system and the computer program in the non-volatile storage medium. The network interface of the computer device is used to communicate with an external terminal through a network connection. When the computer program is executed by the processor, a method for simultaneously detecting multiple gene mutations related to thalassemia is implemented. The display screen of the computer device can be a liquid crystal display screen or an electronic ink display screen, and the input device of the computer device can be a touch layer covered on the display screen, or a key, trackball or touchpad set on the computer device housing, or an external keyboard, touchpad or mouse, etc.

[0114] Those skilled in the art will understand that Figure 4 The structure shown in the figure is only a block diagram of a part of the structure related to the solution of the present application, and does not constitute a limitation on the computer device to which the solution of the present application is applied. The specific computer device may include more or fewer components than those shown in the figure, or combine certain components, or have a different arrangement of components.

[0115] The present application also provides a computer device, which includes a memory and a processor, wherein the memory stores a computer program, and when the processor executes the computer program, the steps of the method for simultaneously detecting multiple gene mutations related to thalassemia are implemented.

[0116] The present application also provides a computer-readable storage medium having a computer program stored thereon, which, when executed by a processor, implements the steps of the above-mentioned method for simultaneously detecting multiple gene mutations associated with thalassemia.

[0117] The present application also provides a computer program product, which includes a computer program, and when the computer program is executed by a processor, the steps of the method for simultaneously detecting multiple gene mutations related to thalassemia are implemented.

[0118] It should be noted that the user information (including but not limited to user device information, user personal information, etc.) and data (including but not limited to data used for analysis, stored data, displayed data, etc.) involved in this application are all information and data authorized by the user or fully authorized by all parties.

[0119] Those skilled in the art can understand that all or part of the processes in the above-mentioned embodiment methods can be completed by instructing the relevant hardware through a computer program, and the computer program can be stored in a non-volatile computer-readable storage medium. When the computer program is executed, it can include the processes of the embodiments of the above-mentioned methods. Among them, any reference to the memory, database or other medium used in the embodiments provided in the present application can include at least one of non-volatile and volatile memory. Non-volatile memory can include read-only memory (ROM), magnetic tape, floppy disk, flash memory, optical memory, high-density embedded non-volatile memory, resistive random access memory (ReRAM), magnetoresistive random access memory (MRAM), ferroelectric random access memory (FRAM), phase change memory (PCM), graphene memory, etc. Volatile memory can include random access memory (RAM) or external cache memory, etc. As an illustration and not limitation, RAM can be in various forms, such as static random access memory (SRAM) or dynamic random access memory (DRAM). The database involved in each embodiment provided in this application may include at least one of a relational database and a non-relational database. Non-relational databases may include distributed databases based on blockchains, etc., but are not limited to this. The processor involved in each embodiment provided in this application may be a general-purpose processor, a central processing unit, a graphics processor, a digital signal processor, a programmable logic device, a data processing logic device based on quantum computing, etc., but are not limited to this.

[0120] The implementation scheme of the present application will be described in detail below with reference to examples.

[0121] In some embodiments, the multiplex PCR primer pairs in Table 1 are used to amplify the sample, ONT library is constructed, and ultra-precise basecalling is selected for sequencing. After the sequencing is completed, the fastq file with the barcode separated is directly obtained, that is, the original fastq file.

[0122] Table 1

[0123] Primer name Primer sequence (5'-3') HBA2-F GTATTTACCTAGCAAGTCTTCCATCAGATAGC HBA2-R GGATAGAGAGAACCCAGGCACACA 3.7-F GTATTTACCTAGCAAGTCTTCCATCAGATAGC 3.7-R TGAAAAGTCTGGGAATAAAACTCGGGAAAGA 4.2-F CTTTGGGCTGGGAGGAATCTAGGG 4.2-R AGTATAGATGGGGTTTCTACATGTTGATCAGG SEA-F CCAGCTCCTGTCCCACTGCC SEA-R CTGCAGTACCAGTAAATCTCGCCAAAGA THAI-F CTTCCCAGGACAGTGAGCAAGACAG THAI-R CTCGTGACCTTATGATTTGCCCGC HBB-F CCTAACTTTTCATACTAAGCCCAGTCCTTCC HBB-R GTAAGTATTTTGCATATTCTGGAGACGCAGG

[0124] The analysis steps of this embodiment are as follows: use NanoPlot to perform basic statistics on the original fastq file, and draw the length and abundance distribution map of sequencing reads. Use NanoFilt to perform quality control on the original fastq file, and the minimum base quality allowed is Q10, delete sequences less than 800bp or greater than 3000bp, and generate quality-controlled fastq files. Use minimap2 software to align the quality-controlled fastq file to the hg38 genome. Add the -x map-ont parameter in the software to obtain the aligned file sam. Use samtools software to convert the aligned sam file into a bam file, and select to retain reads with an alignment quality higher than 30 for retention. By screening the alignment quality of the sam file, the situation of incorrect alignment of the homologous regions of the HBA2 and HBA1 genes can be avoided. Do not perform de-duplication on the bam file.

[0125] Non-deletion detection: Use clair3 to detect non-deletion mutations (SNV Indel detection), and the input file is a bam file. The selected model is: "ont_guppy5", the selected platform is "ont", and the output file is the original VCF. Use snpEff to annotate the original VCF, and the annotated databases are: GRCh38.99, dbSNP's 00-All.vcf.gz, and the real-time updated clinvar database. At the same time, use SnpSift's varType tool to determine the type of variation (heterozygous and pure). Use a self-written script to organize the results.

[0126] Haplotype detection: Using the original VCF file generated above as input, the whatshap software was used to perform haplotype typing.

[0127] Deletion mutation detection: Use the sequence of multiple PCR primer pairs to perform statistics on the fastq file after quality control, such as detection-- SEA The primer pair is SEA-F and SEA-R, and this pair of primers needs to appear in one read at the same time; statistics are performed while allowing one base mismatch, and the software used is the grep function of seqkit.

[0128] After obtaining the statistical results of the primers, perform a threshold judgment on the statistical results. The total number of sequence sequencing fragments needs to be greater than 600 (the multiplex PCR results will have at most 4 bands, so the sequencing depth of each band is 150X, which meets the detection of deletion and non-deletion types). HBB, HBA1, and HBA2 genes should be detected in most samples (except for the case of -α / -α), and the threshold set for HBB, HBA1, and HBA2 is 50. The threshold set for deletion mutations is 15, and the specific judgment method is shown in Table 2. Summarize the deletion threshold judgment results and non-deletion results, and add common clinical names to the results through a self-built database.

[0129] Table 2

[0130]

[0131]

[0132] It should be noted that the possible situations of -- / -α are:-- SEA / -α 3.7 , -- SEA / -α 4.2 , -- THAI / -α 3.7 , -- THA I / -α 4.2 . -α / -α possible situations are: -α 3.7 / -α 3.7 , -α 3.7 / -α 4.2 , -α 4.2 / -α 4.2 When the number of sequences with only -α is above the threshold, while HBA2 is below the threshold, and HBB is above the threshold, a homozygous mutation of -a, i.e. -α / -α, is considered.

[0133] In some embodiments, the sample is from a carrier, and the α-thalassemia-α 3.7 For static carriers, the detection method of Example 1 of the present application was used for detection, and the detection results are shown in Table 3.

[0134] Table 3

[0135] name GENE Genome_change var_type genotype CLNSIG <![CDATA[-α 3.7 ]]> HBA2,HBA1 g.173384-177187del DEL HET Pathogenic

[0136] Example 3

[0137] The samples in this embodiment come from a family, in which barcode13 sample is a proband, carrying the c.124_126del^127_129del (CD 41 / 42) mutation. The other family members are collected and tested. Barcode12 is the mother of barcode13, barcode15 is the brother of barcode13, barcode14 is the husband of barcode13, barcode16 is the daughter of barcode13, barcode9 and barcode10 are the two nieces of barcode13, and barcode8 is the brother-in-law of barcode13. The test results are shown in Table 4.

[0138] It should be noted that the cells marked with “-” in the following Table 4 indicate that no HBB gene mutation was detected in the samples with the corresponding barcode numbers.

[0139] Table 4

[0140]

[0141]

[0142] The IGV results of barcode 89, 10, 12, 13, 14, 15 and 16 gene tests are as follows Figure 5 shown.

[0143] In some embodiments, the purchased thalassemia non-deletion standard is subjected to gene testing, and the IGV results of the barcode 21, 22, 23, 25, 36, 37, 28, 29, 31 gene testing are as follows: Figures 6 to 14 The specific mutation detection results are shown in Table 5, and all results are consistent with expectations.

[0144] Table 5

[0145]

[0146] In some embodiments, the purchased thalassemia deletion standards were tested, and the test results are shown in Table 6. The statistical results of the deletion thalassemia standard primers are shown in Table 7. The test results of all standards were consistent with expectations.

[0147] Table 6

[0148] barcode name GENE Genome_change var_type genotype CLNSIG 13 <![CDATA[-α 3.7 ]]> HBA2,HBA1 g.173548T>C SNP HET Pathogenic 14 <![CDATA[-α 4.2 ]]> HBA2,HBA1 g.173598T>C SNP HET Pathogenic 15 <![CDATA[ SEA ]]> HBA2,HBA1 g.165402-184702del DEL HET Pathogenic 16 <![CDATA[ THAI ]]> HBA2,HBA1 g.5226943C>T SNP HET Pathogenic

[0149] Table 7

[0150]

[0151]

[0152] Example 6

[0153] This embodiment draws a genetic map based on the detection results in Example 3, such as Fig.15 As shown. At the same time, according to the haplotype information, it can be known that the M1 from the mother (barcode12) is inherited to the daughter (barcode13) and the son (barcode15), and the daughter and the son respectively obtain one of the father's haplotypes F. The specific results are shown in Tables 8 to 10. The mother (barcode12) 5224973 site, 5226762 site, 5227411 site M2 haplotype combination M2: A, del, G is inherited to the daughter (barcode13). The mother 5224973 site, 5226762 site M2 haplotype combination M2: A, del, inherited to the son (barcode15). It shows that the detection method of this embodiment has the ability to distinguish haplotypes, and can effectively identify: genes with two variant sites, and the two sites are located on the same haplotype, providing more identification basis for complex genetic phenomena.

[0154] Table 8

[0155]

[0156] Table 9

[0157]

[0158] Table 10

[0159]

[0160]

[0161] The technical features of the above embodiments may be combined arbitrarily. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0162] The above embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims.

Claims

1. A method for simultaneously detecting multiple gene mutations associated with thalassemia, characterized in that the method include: Acquiring nanopore sequencing data of a sample to be tested, wherein the sample to be tested includes amplification products of a multiplex PCR primer pair for simultaneously detecting multiple gene mutations associated with thalassemia; Performing quality control screening on the nanopore sequencing data according to the amplification length of the multiplex PCR primer pair to obtain first target sequencing data; The sequence number of the product amplified by the multiplex PCR primer pair is obtained according to the first target sequencing data, and the gene mutation information related to thalassemia of the sample to be tested is determined according to the sequence number of the product amplified by the multiplex PCR primer pair.

2. The method according to claim 1, characterized in that The multiplex PCR primer pair includes α for detecting HBA1 and HBA2 gene deletion mutations. 3.7 Primer pair, α 4.2 Primer pairs, SEA primer pairs and THAI primer pairs, the obtaining of the sequence number of the product amplified by the multiplex PCR primer pairs according to the first target sequencing data, and determining the gene mutation information related to thalassemia of the sample to be tested according to the sequence number of the product amplified by the multiplex PCR primer pairs specifically includes: Obtain α according to the first target sequencing data 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, SEA primer pair, and THAI primer pair; According to α 3.7 Primer pair, α 4.2 The sequence number of the amplified products of the primer pair, SEA primer pair, and THAI primer pair determines whether the sample to be tested has a target deletion mutation; Wherein, the target deletion mutation includes -α 3.7 Deletion mutation, -α 4.2 Deletion mutation, -- SEA Deletion mutations and -- THAI At least one of the deletion mutations.

3. The method according to claim 2, characterized in that The multiplex PCR primer pair also includes an HBA1 primer pair and an HBA2 primer pair for detecting non-deletion mutations of HBA1 and HBA2 genes. The step of obtaining the sequence number of the amplified product of the multiplex PCR primer pair according to the first target sequencing data and determining the thalassemia-related gene mutation information of the sample to be tested according to the sequence number of the multiplex PCR primer pair amplified product specifically includes: According to the first target sequencing data, the HBA1 primer pair, the HBA2 primer pair, and the α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, SEA primer pair, and THAI primer pair; If the number of sequencing fragments of the amplified products of the HBA1 primer pair and the HBA2 primer pair is not less than the second preset threshold, then according to α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, the SEA primer pair, and the THAI primer pair determine whether the sample to be tested has one of the target deletion mutations; If the number of sequencing fragments of the amplified products of the HBA1 primer pair and the HBA2 primer pair is lower than the second preset threshold, then according to α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, the SEA primer pair and the THAI primer pair determine whether the sample to be tested has two of the target deletion mutations.

4. The method according to claim 2, characterized in that: The multiplex PCR primer pair also includes an HBB primer pair for detecting the HBB gene, and the step of obtaining the sequence number of the amplified product of the multiplex PCR primer pair according to the first target sequencing data, and determining the gene mutation information related to thalassemia of the sample to be tested according to the sequence number of the amplified product of the multiplex PCR primer pair specifically includes: According to the first target sequencing data, the HBB primer pair, α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, SEA primer pair, and THAI primer pair; If the number of sequences of the amplified product of the HBB primer pair is not less than the second preset threshold, according to α 3.7 Primer pair, α 4.2 The sequence numbers of the products amplified by the primer pair, SEA primer pair and THAI primer pair indicate whether the sample to be tested has a target deletion mutation.

5. The method according to any one of claims 2 to 4, characterized in that: According to α 3.7 Primer pair, α 4.2 The sequence numbers of the amplified products of the primer pair, SEA primer pair and THAI primer pair and whether the sample to be tested has a target deletion mutation include: If α 3.7 Primer pair, α 4.2 If the number of sequences of the product amplified by the primer pair, SEA primer pair or THAI primer pair exceeds a first preset threshold, it is determined that the sample to be tested has a target deletion mutation corresponding to the primer pair.

6. The method according to claim 1, characterized in that The method further comprises: Compare the first target sequencing data with the reference genome to obtain second target sequencing data whose alignment quality meets a preset condition and has not been deduplicated; Acquire non-deletion mutation information and / or haplotype information of a target gene according to the second target sequencing data, wherein the target gene includes at least one gene among the HBB gene, the HBA1 gene, and the HBA2 gene; Optionally, the alignment quality of the second target sequencing data is not less than 30.

7. The method according to claim 1, characterized in that The first target sequencing data satisfies at least one of the following conditions (1) to (2): (1) The read length of the first target sequencing data is 800 bp to 3000 bp; (2) The base quality Q of the first target sequencing data is not less than 10.

8. A device for simultaneously detecting multiple gene mutations related to thalassemia, characterized in that: include: A sequencing data acquisition module: used to acquire nanopore sequencing data of a sample to be tested, wherein the sample to be tested includes amplification products of a multiplex PCR primer pair for simultaneously detecting multiple gene mutations associated with thalassemia; A sequencing data quality control module: used to perform quality control screening on the nanopore sequencing data according to the amplification length of the multiplex PCR primer pair to obtain first target sequencing data; Mutation information detection module: used to obtain the sequence number of the product amplified by the multiple PCR primer pair according to the first target sequencing data, and determine the gene mutation information related to thalassemia of the sample to be tested according to the sequence number of the product amplified by the multiple PCR primer pair.

9. A computer device comprising a memory and a processor, wherein the memory stores a computer program, wherein: When the processor executes the computer program, the steps of the method according to any one of claims 1 to 7 are implemented.

10. A computer-readable storage medium having a computer program stored thereon, characterized in that: When the computer program is executed by a processor, the steps of the method according to any one of claims 1 to 7 are implemented.

11. A computer program product, comprising a computer program, characterized in that When the computer program is executed by a processor, the steps of the method according to any one of claims 1 to 7 are implemented.

Images