Detection primer for SNP site rs116309149 related to abdominal aortic aneurysm and application of detection primer

Abstract

The invention relates to the field of gene detection, and discloses a detection primer for an abdominal aortic aneurysm related SNP site rs116309149 and application of the detection primer, and the detection primer comprises two non-specific outer side primers and two inner side primers for specifically detecting SNP mutation sites; the outer primer has sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2 or complementary sequences of the sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the inner side primer has sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4 or complementary sequences of the sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4. According to the detection primer and the application design of the detection primer, the primer which is specifically matched with the rs116309149 site based on an ARMS-PCR method is verified, a reaction system and reaction conditions are perfected and optimized based on the detection primer, amplification and detection of a target gene are successfully completed, and the positive significance is achieved for clinic.

Description

Technical Field

[0001] The present application relates to the field of gene detection, and more specifically, to a detection primer for an abdominal aortic aneurysm-related SNP site rs116309149 and an application thereof. Background Art

[0002] Abdominal aortic aneurysm (AAA) refers to localized dilation of the abdominal aorta to more than 3.0 cm, or an increase of more than 1.5 times the original diameter. The incidence of this type of disease increases with age. Among people aged 74 to 84, the incidence of AAA in men can reach 12.5%, while that in women can reach 5.2%. Most AAAs have no obvious symptoms, but when AAA ruptures, patients often have a typical triad of clinical symptoms: sudden hypotension, severe abdominal or back pain, and abdominal pulsating mass, and the mortality rate is very high. The main risk factors associated with AAA include male sex, smoking, age over 65 years old, coronary artery disease, hypertension, a history of myocardial infarction, peripheral artery disease, and a family history of AAA. Therefore, it is very necessary to develop an efficient, convenient, sensitive and specific detection method for high-risk groups.

[0003] Single nucleotide polymorphisms (SNPs) refer to the variation of a single nucleotide in the genome, including transitions, transversions, deletions and insertions, forming genetic markers. SNPs are known, heritable and detectable, and can be used to locate, clone and identify disease genes and find disease-related mutation sites. The rs116309149 site is located in human chr11:72139545 (GRCh38.p14), which encodes the FOLR3 gene. Previous studies have shown that mutations at these two sites are associated with the occurrence of AAA.

[0004] ARMS Chinese name is amplification refractory mutation system (ARMS). ARMS-PCR combines ARMS technology with gene PCR technology. Its basic principle is that when the 3' end base of the primer is completely complementary to the template, the primer can be extended normally. If the 3' end base of the primer is not complementary to the template base, that is, there is a mismatch, the primer extension is inhibited or even completely terminated. This method is often used to detect the variability of SNP sites.

[0005] It can be seen that the design of a primer for detecting the abdominal aortic aneurysm-related SNP site rs116309149 using the ARMS-PCR method and its application have potential clinical significance and can provide huge market value. Summary of the invention

[0006] The invention purpose of the present application is to provide a detection primer for the abdominal aortic aneurysm-related SNP site rs116309149 and its application. The detection primer and its application are designed to verify the primers that specifically match the rs116309149 site based on the ARMS-PCR method, and to improve the reaction system and reaction conditions so that the amplification and detection of the target gene can be successfully completed, which has positive clinical significance.

[0007] In order to achieve the above invention objectives, this application adopts the following technical solutions:

[0008] In a first aspect, the present application provides a detection primer for an abdominal aortic aneurysm-related SNP site rs116309149, wherein the detection primer comprises two non-specific outer primers and two inner primers for specifically detecting SNP mutation sites;

[0009] The outer primers have the sequences shown in SEQ ID NO: 1 (forward primer) and SEQ ID NO: 2 (reverse primer) or their complementary sequences;

[0010] The inner primers have the sequences shown in SEQ ID NO: 3 (forward primer) and SEQ ID NO: 4 (reverse primer) or their complementary sequences.

[0011] SEQ ID NO: 1 is as follows: ACTGTCGCACCTCCTACAC (forward primer);

[0012] SEQ ID NO: 2 is as follows: GACTCAAAGGTGCTGCAGAG (reverse primer);

[0013] SEQ ID NO: 3 is as follows: TGGGGTTGGGAGGGGTGAGG (forward primer);

[0014] SEQ ID NO:4 is as follows: CCTTAGCTTCTGGGCCATAT (reverse primer).

[0015] Two inner primers for specific detection of SNP mutation sites correspond to the polymorphism of SNP site rs116309149 (A / G).

[0016] Since the 3′ end of the mutant reverse primer SEQ ID NO.4 will have a weak mismatch (T / G) with the wild-type template, in order to improve the specificity and accuracy of the detection, a strong mismatch (T / T) was artificially introduced into the third-to-last base of the primer; the reaction system and reaction conditions were optimized, and the PCR annealing temperature was appropriately increased and maintained at 56°C; the amplification and detection of the target gene were successfully completed, significantly improving the specificity and accuracy of the detection, which has potential clinical significance.

[0017] In order to improve the specificity and accuracy of primers, the following points should be noted during primer design:

[0018] When the base at the 3' end of the primer is completely complementary to the template, the primer can be extended normally. If the base at the 3' end of the primer is not complementary to the template base, that is, there is a mismatch, the primer extension is inhibited or even completely terminated.

[0019] To improve primer specificity, an additional mismatch base can be introduced at the third base from the 3′ end so that the primer can amplify the target sequence normally, while non-target fragments are not amplified.

[0020] Furthermore, the 3′-end base mismatch can be divided into strong mismatch (G / A, C / T, T / T), medium mismatch (A / A, G / G, C / C) and weak mismatch (C / A, G / T) according to its strength; if the 3′-end is a strong mismatch, a weak mismatch base should be artificially introduced or no mismatch base should be introduced. Similarly, for medium mismatches and weak mismatches at the 3′-end, a medium mismatch and a strong mismatch base should be artificially introduced.

[0021] When testing homozygous wild-type or mutant samples, a non-specific DNA product and a specific DNA primer of different lengths will be generated, while when testing heterozygous mutant samples, a non-specific DNA product and two specific DNA primers of different lengths will be generated.

[0022] In a second aspect, the present application provides the use of the detection primers for the abdominal aortic aneurysm-related SNP site rs116309149 described in the first aspect in the preparation of a reagent or kit for detecting abdominal aortic aneurysm or a mutation in the abdominal aortic aneurysm-related SNP site rs116309149.

[0023] In a third aspect, the present application provides a kit for detecting abdominal aortic aneurysm or abdominal aortic aneurysm-related SNP site rs116309149 mutation, the kit comprising:

[0024] RNase-free water and buffer;

[0025] 2×SYBR Green Master Mix;

[0026] The detection primer described in the first aspect;

[0027] Positive quality control, including 500 copies of the positive plasmid pUC57-3040 of the wild-type and mutant SNP sites rs116309149;

[0028] Negative quality control, nucleic acid-free water.

[0029] In a fourth aspect, the present application provides a method for using the kit described in the third aspect, comprising the following steps:

[0030] Step 1: Extraction of sample DNA;

[0031] Step 2: Prepare the reaction system, perform ARMS-PCR, and detect the genotype of the SNP site rs116309149 in the sample DNA;

[0032] Step 3: Analysis of test results and their effectiveness.

[0033] Furthermore, in step 2, the reaction conditions of ARMS-PCR are: maintaining 50°C for 2 min, 95°C for 2 min; 40 cycles of 95°C for 15 s, 56°C for 15 s, and 72°C for 60 s.

[0034] Furthermore, in step 3, if the two positive quality controls produce a nonspecific band and a specific band respectively, and the negative quality control produces no band, it means that the experimental results are valid.

[0035] In summary, this application has the following beneficial effects:

[0036] The present invention provides a detection primer for an abdominal aortic aneurysm-related SNP site rs116309149 and an application thereof. The QIAGEN kit is used to extract DNA, design specific primers, and improve the reaction system and reaction conditions to successfully complete the amplification and detection of the target gene, which has potential clinical significance and can provide huge market value. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The schematic diagram of the primer construction of the present invention.

[0038] Figure 2 This is a schematic diagram of a sample construction of Example 1 of the present invention. DETAILED DESCRIPTION

[0039] The technical scheme and effects of the present application are further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the invention, rather than to limit the invention.

[0040] Example 1

[0041] This embodiment provides a detection primer for abdominal aortic aneurysm-related SNP site rs116309149 and its application.

[0042] The detection primers include 2 non-specific outer primers and 2 inner primers for specifically detecting SNP mutation sites;

[0043] The outer primers have the sequences shown in SEQ ID NO: 1 (forward primer) and SEQ ID NO: 2 (reverse primer) or their complementary sequences;

[0044] SEQ ID NO: 1 is as follows: ACTGTCGCACCTCCTACAC (forward primer);

[0045] SEQ ID NO: 2 is as follows: GACTCAAAGGTGCTGCAGAG (reverse primer);

[0046] The inner primers have the sequences shown in SEQ ID NO: 3 (forward primer) and SEQ ID NO: 4 (reverse primer) or their complementary sequences;

[0047] SEQ ID NO: 3 is as follows: TGGGGTTGGGAGGGGTGAGG (forward primer);

[0048] SEQ ID NO:4 is as follows: CCTTAGCTTCTGGGCCATAT (reverse primer).

[0049] Two inner primers for specific detection of SNP mutation sites correspond to the polymorphism of SNP site rs116309149 (A / G).

[0050] Since the 3′ end of the mutant reverse primer SEQ ID NO.4 will have a weak mismatch (T / G) with the wild-type template, in order to improve the specificity and accuracy of the detection, a strong mismatch (T / T) was artificially introduced into the third-to-last base of the primer; the reaction system and reaction conditions were optimized, and the PCR annealing temperature was appropriately increased and maintained at 56°C; the amplification and detection of the target gene were successfully completed, significantly improving the specificity and accuracy of the detection, which has potential clinical significance.

[0051] The primers provided by the present invention are designed based on the amplification refractory mutation system (ARMS). In order to improve the specificity and accuracy of the primers, the following points should be noted during the primer design process:

[0052] 1: When the base at the 3' end of the primer is completely complementary to the template, the primer can be extended normally. If the base at the 3' end of the primer is not complementary to the template base, that is, there is a mismatch, the primer extension is inhibited or even completely terminated.

[0053] Second: In actual experiments, a mismatch between a single base at the 3' end of the primer and the template may still lead to amplification, resulting in a false positive rate. To improve the specificity of the primer, an additional mismatch base can be introduced at the third base from the last at the 3' end, so that the primer can amplify the target sequence normally, while the non-target fragment will not be amplified. Base mismatches at the 3' end can be divided into strong mismatches (G / A, C / T, T / T), medium mismatches (A / A, G / G, C / C) and weak mismatches (C / A, G / T) according to their strength. If the 3' end is a strong mismatch, a weak mismatch base should be artificially introduced or no mismatch base should be introduced. Similarly, for medium mismatches and weak mismatches at the 3' end, a medium mismatch and a strong mismatch base should be artificially introduced.

[0054] Testing of homozygous wild-type or mutant samples will generate a non-specific DNA product and a specific DNA primer of different lengths, while testing of heterozygous mutant samples will generate a non-specific DNA product and two specific DNA primers of different lengths. Figure 1 shown.

[0055] The application method of the detection primer comprises the following steps:

[0056] 1. Extraction of sample DNA.

[0057] In this example, a QIAGEN commercial kit was used to extract sample DNA. The specific extraction steps were as follows:

[0058] Take 1.6mL of saliva sample in a 2mL centrifuge tube, place in a 50℃ water bath for 15min, centrifuge at 12000g for 5min, remove the supernatant, add 180μL PBS to wash the precipitate, then add 20μL proteinase K and 200μL buffer AL, vortex to mix, incubate at 56℃ for 60min, then add 200μL anhydrous ethanol, vortex to mix, centrifuge, transfer to the QIAamp Mini spin column, centrifuge at 6000g for 1min, and replace with a new collection tube; add 500μL buffer AW1, centrifuge at 6000g for 1min, and replace with a new collection tube; add 500μL buffer AW2, centrifuge at 20000g for 3min, replace with a new collection tube, centrifuge at full speed, and finally add 60μL buffer AE to elute the sample.

[0059] 2. PCR amplification.

[0060] The primers for the PCR reaction are:

[0061] SEQ ID NO: 1 is as follows: ACTGTCGCACCTCCTACAC (forward primer);

[0062] SEQ ID NO: 2 is as follows: GACTCAAAGGTGCTGCAGAG (reverse primer);

[0063] SEQ ID NO: 3 is as follows: TGGGGTTGGGAGGGGTGAGG (forward primer);

[0064] SEQ ID NO:4 is as follows: CCTTAGCTTCTGGGCCATAT (reverse primer).

[0065] Prepare 8 PCR tubes and put in the reaction system liquid: 3.6μM RNase-free water, 5μM 2×SYBR GreenMaster Mix, 0.4μM Primer Mix. Add 1μM sample DNA, wild-type positive plasmid, mutant positive plasmid, and nuclease-free water to the 8 tubes respectively, and set up double replicates in two tubes for each reaction. The reaction conditions of the ARMS-PCR are: maintain 50℃ for 2min, 95℃ for 2min; 40 cycles of 95℃ for 15s, 56℃ for 15s, and 72℃ for 60s.

[0066] Among them, positive quality control includes 500 copies of the positive plasmid pUC57-3040 of the wild-type and mutant SNP sites rs116309149;

[0067] Negative quality control, nucleic acid-free water.

[0068] 3. Analysis of test results and their effectiveness.

[0069] (1) According to the ratio of 1.5% agarose solution, weigh an appropriate amount of agarose powder, put it into a conical flask, and add an appropriate amount of 0.5×TBE electrophoresis buffer. Then heat it in a microwave oven until it is completely dissolved and the solution is transparent. Shake it slightly to obtain a gel solution. Cool it to about 60℃, and add an appropriate amount of ethidium bromide to the gel solution to a concentration of 0.5μg / ml.

[0070] (2) Take a plexiglass rubber plate slot, seal it tightly around the slot with transparent tape, and add a small amount of glue to seal the gap between the tape and the slot.

[0071] (3) Place the glue tank horizontally, insert a comb at one end, and slowly pour glue liquid that has cooled to about 60°C into the tank to form a uniform and horizontal glue surface.

[0072] (4) After the gel has solidified, carefully pull out the comb, tear off the transparent tape, and place the sample well end on the cathode segment into the electrophoresis tank.

[0073] (5) Add 0.5× TBE electrophoresis buffer into the tank until the liquid level covers the gel surface.

[0074] (6) Carefully mix the sample to be tested on a clean glass slide according to the following amount and add it to the sample loading well of the gel using a pipette: 1 μl loading buffer (6×) + 5 μl DNA sample to be tested.

[0075] (7) Connect the electrophoresis instrument and electrophoresis tank, and turn on the power supply. Adjust the voltage output to a maximum of 5 V / cm and start electrophoresis. Place the sample end at the cathode end. Adjust the voltage based on experience to make the bands clear.

[0076] (8) Observe the movement of the bromophenol blue band (blue). When it moves to about 1 cm from the front edge of the gel plate, stop electrophoresis.

[0077] (9) Staining: Take out the glue tank, carefully slide out the glue block, place it horizontally on a piece of plastic wrap or other support, put it into the EB solution for staining, and soak it completely for about 30 minutes.

[0078] (10) Place a new piece of plastic wrap on the sample stage of the UV analyzer, remove the bubbles and lay it flat, then place the stained gel on it. Close the sample chamber door, turn on the UV lamp (360nm or 254nm), and observe through the observation hole.

[0079] If the two positive quality controls produce one nonspecific band and one specific band respectively and the negative quality control produces no band, the experimental results are valid.

[0080] By comparing the sample DNA with the specific bands of the two positive quality controls, the genotype and homozygosity of the sample DNA SNP site rs116309149 can be analyzed. Figure 2 As shown in the figure, samples 1 and 3 are abdominal aortic aneurysm samples and mutant positive plasmid samples, respectively, and samples 2 and 4 are normal abdominal aorta samples and wild-type mutant plasmid samples, respectively.

[0081] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

Claims

1. A detection primer for the abdominal aortic aneurysm-related SNP site rs116309149, characterized in that: The detection primers include 2 non-specific outer primers and 2 inner primers for specifically detecting SNP mutation sites; The outer primers have the sequences shown in SEQ ID NO: 1 (forward primer) and SEQ ID NO: 2 (reverse primer) or their complementary sequences; The inner primers have the sequences shown in SEQ ID NO: 3 (forward primer) and SEQ ID NO: 4 (reverse primer) or their complementary sequences.

2. The detection primer of the abdominal aortic aneurysm-related SNP site rs116309149 according to claim 1, characterized in that: A strong mismatch (T / T) was artificially introduced into the third to last base of the mutant reverse primer SEQ ID NO.4; and the reaction system and reaction conditions were optimized, and the PCR annealing temperature was appropriately increased and maintained at 56°C.

3. The detection primer of the abdominal aortic aneurysm-related SNP site rs116309149 according to claim 1, characterized in that: When the base at the 3′ end of the primer is completely complementary to the template, the primer can be extended normally; An additional mismatch base is introduced at the third base from the 3′ end so that the primer can amplify the target sequence normally, but the non-target fragment is not amplified.

4. The detection primer of the abdominal aortic aneurysm-related SNP site rs116309149 according to claim 3, characterized in that: The 3′-end base mismatch can be divided into strong mismatch (G / A, C / T, T / T), medium mismatch (A / A, G / G, C / C) and weak mismatch (C / A, G / T) according to its strength; if the 3′-end is a strong mismatch, a weak mismatch base should be artificially introduced or no mismatch base should be introduced. For medium and weak mismatches at the 3′-end, a medium mismatch and a strong mismatch base should be artificially introduced.

5. Use of the detection primers for the abdominal aortic aneurysm-related SNP site rs116309149 according to any one of claims 1 to 4 in the preparation of a reagent or kit for detecting abdominal aortic aneurysm or a mutation in the abdominal aortic aneurysm-related SNP site rs116309149.

6. A kit for detecting abdominal aortic aneurysm or abdominal aortic aneurysm-related SNP site rs116309149 mutation, characterized in that: The kit comprises: RNase-free water and buffer; 2×SYBR Green Master Mix; And the detection primer according to any one of claims 1 to 4; Positive quality control, including 500 copies of the positive plasmid pUC57-3040 of the wild-type and mutant SNP sites rs116309149; Negative quality control, nucleic acid-free water.

7. The method for using the kit according to claim 6, characterized in that: The steps include: Step 1: Extraction of sample DNA; Step 2: Prepare the reaction system, perform ARMS-PCR, and detect the genotype of the SNP site rs116309149 in the sample DNA; Step 3: Analysis of test results and their effectiveness.

8. The method of use according to claim 7, characterized in that: In step 2, the reaction conditions of ARMS-PCR are: maintaining 50° C. for 2 min, 95° C. for 2 min; 40 cycles of 95° C. for 15 s, 56° C. for 15 s, and 72° C. for 60 s.

9. The method of use according to claim 7, characterized in that: In step 3, if the two positive quality controls produce a nonspecific band and a specific band respectively, and the negative quality control produces no band, it means that the experimental results are valid.

Images