Swine hypoxia tolerance related SNP molecular marker based on WAS gene and application thereof

Abstract

The invention discloses a WAS gene-based pig hypoxia resistance related SNP molecular marker and application thereof, the SNP molecular marker is located at the 245th site of a WAS gene core promoter region nucleotide sequence, the basic group is A or T, and under the hypoxia condition, A is a dominant allele; and the nucleotide sequence of the core promoter region of the WAS gene is-1bp to-326bp of the sequence shown in SEQ ID NO. 15. Through high and low altitude transcriptome analysis of Tibetan pigs and a pig skeletal muscle satellite cell hypoxia model, it is found that the WAS gene plays an important role in pig hypoxia resistance, and a WAS gene promoter region is utilized to construct a dual-fluorescein reporter vector to determine an SNP site (g.-245Tgt; a). The invention provides the SNP molecular marker to assist the breeding method of the hypoxia-resistant pig breeds, a large amount of group scale sampling and determination are not needed, and the breeding efficiency of the hypoxia-resistant pig breeds is effectively improved.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a SNP molecular marker related to pig hypoxia tolerance based on WAS gene and its application. Background Art

[0002] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. It is usually a dimorphic marker and is the most widely distributed genetic polymorphic marker type in the genome. SNP has the advantages of large quantity, high frequency, and low mutation rate. Compared with traditional breeding methods, molecular breeding greatly accelerates the breeding efficiency. It is not affected by the environment. Through genetic background selection, it reduces linkage drag, thereby accelerating the breeding process and accuracy, allowing breeders to efficiently breed livestock and poultry varieties with excellent traits.

[0003] The WAS gene, or Wiskott-Aldrich Syndrome gene, is associated with Wiskott-Aldrich syndrome, an X-linked genetic disease that mainly affects the blood and immune systems. The WASP protein it encodes is a key molecule involved in cytoskeletal reorganization and signal transduction. It can participate in cell migration, adhesion, endocytosis and the formation of immune synapses by regulating the microfilament polymerization mediated by the Arp2 / 3 complex, and widely affects the function, development and signal transduction of immune cells. Studies have found that the WASP protein promotes the skeleton polymerization of muscle cells by regulating the Arp2 / 3 complex, but it is not clear whether it plays a role in hypoxia. Pig breeding is affected by different local climate environments (such as temperature, oxygen, etc.). Breeding pigs with strong stress resistance can increase production and reduce breeding costs. The breeding of hypoxia-resistant pigs is expected to improve the adaptability of commercial pigs or local pigs to the high-altitude ecological environment and accelerate the progress of genetic improvement. Summary of the invention

[0004] In view of the deficiencies in the prior art, the present invention aims to provide a WAS-based SNP molecular marker associated with pig hypoxia tolerance and its application, wherein the SNP molecular marker is located at the 245th position of the nucleotide sequence of the core promoter region of the WAS gene, and the base is A or T; the nucleotide sequence of the core promoter region of the WAS gene is -1bp to -326bp of the sequence shown in SEQ ID NO.15, and A is the dominant allele under hypoxic conditions.

[0005] In order to solve the above technical problems, the technical solution provided by the present invention is:

[0006] A SNP molecular marker related to hypoxia tolerance in pigs based on WAS gene.

[0007] The SNP molecular marker is located at the 245th position of the nucleotide sequence of the core promoter region of the WAS gene, and the base is A or T; the core promoter region of the WAS gene is -1bp to -326bp of the sequence shown in SEQ ID NO.15; the SNP site is located at 42774352bp of chromosome 23 of the international pig genome NCBI Sscrofa 11.1 version.

[0008] Preferably,

[0009] Under hypoxic conditions, A is the dominant allele.

[0010] A primer pair for amplifying the SNP molecular marker associated with pig hypoxia tolerance based on the WAS gene as described in claim 1,

[0011] The forward sequence of the primer pair is shown in SEQ ID NO.24;

[0012] The reverse sequence of the primer pair is shown as SEQ ID NO.25.

[0013] A reagent or kit containing primers for the above-mentioned SNP molecular markers related to pig hypoxia tolerance based on the WAS gene.

[0014] The application of the above-mentioned SNP molecular markers related to pig hypoxia tolerance in the assisted breeding of hypoxia-resistant pig breeds.

[0015] Preferably,

[0016] The core promoter region of the porcine WAS gene is detected, and recombinant plasmids pGL3-basic-WAS-P1, pGL3-basic-WAS-P2 and pGL3-basic-WAS-P3 are constructed by constructing porcine WAS gene promoter truncations P1, P2 and P3, and the relative luciferase activity of the recombinant plasmids is determined by dual luciferase activity; the nucleotide sequence of the truncation P1 is the 1-326 base sequence of SEQ ID NO.15; the nucleotide sequence of the truncation P2 is the 1-1183 base sequence of SEQ ID NO.15; and the nucleotide sequence of the truncation P3 is the 1-2000 base sequence of SEQ ID NO.15.

[0017] Preferably,

[0018] The forward sequences of the primer pairs for amplifying the porcine WAS gene promoter truncations P1, P2 and P3 are shown in SEQ ID NO.16, SEQ ID NO.17 and SEQ ID NO.18, and the reverse sequences are shown in SEQ ID NO.19.

[0019] A method for breeding hypoxia-resistant pig breeds, based on the above-mentioned SNP molecular marker, detects the SNP molecular marker located at the 245th position in the core promoter region of the WAS gene, and selects individuals with allele A at the site for breeding.

[0020] A method for identifying the above-mentioned SNP molecular markers related to pig hypoxia tolerance based on the WAS gene comprises the following steps:

[0021] 1) Establish a hypoxia model for the proliferation of porcine skeletal muscle satellite cells;

[0022] 2) Analyze the expression of WAS gene in the hypoxia model of pig skeletal muscle satellite cells by using the transcriptome data of different tissues of Tibetan pigs at high and low altitudes;

[0023] 3) qRT-PCR detection of the expression of WAS gene in proliferating satellite cells of hypoxic pig skeletal muscle;

[0024] 4) Construct porcine WAS gene promoter truncations P1, P2 and P3, and then construct recombinant plasmids pGL3-basic-WAS-P1, pGL3-basic-WAS-P2 and pGL3-basic-WAS-P3;

[0025] 5) Detect the activity of the porcine WAS gene promoter region;

[0026] 6) Transient cell transfection and dual luciferase activity assay to identify the mutation activity of the SNP site (g.-245A>T).

[0027] The beneficial effects of the present invention are:

[0028] The present invention obtains a molecular marker related to pig hypoxia tolerance based on the WAS gene, so that the breeding of hypoxia-resistant pig breeds can improve the adaptability of commercial pigs or local pigs to high-altitude ecological environments, accelerate the progress of genetic improvement work, and breed pig breeds with strong stress resistance to increase production and reduce breeding costs. It does not require a large amount of group-scale sampling and measurement, and can effectively improve the efficiency of breeding hypoxia-resistant pig breeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0030] Figure 1Figure 5 is the experimental result of high expression of WAS gene in the hypoxia model of porcine skeletal muscle satellite cells; A is the expression of hypoxia-related factors HIF1A, VEGF, and GLUT1 transcription levels by qRT-PCR after satellite cells were treated with different concentrations of cobalt chloride (0, 10, 25, 50, 100, and 200 μmol / L) for 24 h (n=3, *P<0.05, **P<0.01); B is the expression of WAS transcription level by qRT-PCR after satellite cells were treated with 50 μmol / L cobalt chloride (n=3, *P<0.05, **P<0.01).

[0031] Figure 2 The electrophoresis diagram of the PCR products of the WAS gene promoter truncations; A is the electrophoresis diagram of the truncated P1 amplification product, with a fragment size of 326 bp; B is the electrophoresis diagram of the truncated P2 amplification product, with a fragment size of 1183 bp; C is the electrophoresis diagram of the truncated P3 amplification product, with a fragment size of 2000 bp

[0032] Figure 3 It is the sequencing result analysis of pGL3-basic-WAS-P1; A is the sequencing sequence of pGL3-basic-WAS-P1; B is the sequencing peak graph of pGL3-basic-WAS-P1.

[0033] Figure 4 It is the sequencing result analysis of pGL3-basic-WAS-P2; A is the sequencing sequence of pGL3-basic-WAS-P2; B is the sequencing peak graph of pGL3-basic-WAS-P2.

[0034] Figure 5 It is the sequencing result analysis of pGL3-basic-WAS-P3; A is the sequencing sequence of pGL3-basic-WAS-P3; B is the sequencing peak graph of pGL3-basic-WAS-P3.

[0035] Figure 6 is the relative luciferase activity of different promoter truncations of the WAS gene (n=3, *P<0.05, **P<0.01).

[0036] Figure 7 is the verification result of the WAS gene SNP site (g.-245T>A); A is the electrophoresis diagram of the reverse PCR product of the mutant fragment, and the fragment size is 5490bp; B is the sequencing peak diagram of pGL3-basic-WAS-SNP (g.-245T>A); C is the relative luciferase activity of the WAS gene SNP site (g.-245T>A) promoter expression vector (n=3, *P<0.05, **P<0.01). DETAILED DESCRIPTION

[0037] The preferred embodiments of the present invention are described below in conjunction with the accompanying drawings. It should be understood that the following embodiments are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0038] Example 1 Expression of WAS gene in the comparison of transcriptomes at high and low altitudes in Tibetan pigs

[0039] The transcriptome data of different tissues of Tibetan pigs at high and low altitudes were downloaded from NCBI "GEO DataSets" (heart: GSE114779; lung: GSE88409; skeletal muscle: GSE90510). Differential gene analysis was performed using DESeq2, and it was found that the pig WAS gene was an up-regulated differential gene, indicating that the WAS gene may play an important role in hypoxia tolerance.

[0040] Example 2 Expression of WAS gene in porcine satellite cells treated with hypoxia

[0041] (1) Isolation and culture of porcine skeletal muscle satellite cells in vitro

[0042] The longissimus dorsi muscle tissue of wild-type experimental pigs was collected, digested with collagenase II and Dispase II, isolated and purified by differential adhesion to obtain pig skeletal muscle satellite cells (PSCs). PSCs cells were cultured at 37°C and 5% CO2 in F12 medium containing 20% ​​(v / v) fetal bovine serum (FBS) and 0.1% (w / v) gentamicin / ampicillin.

[0043] (2) Construction of a hypoxic model of porcine skeletal muscle satellite cells

[0044] Porcine satellite cells were plated at 10 per well. 4 The cells were inoculated in 24-well plates and treated with different concentrations of cobalt chloride (0, 10, 25, 50, 100, 200 μmol / L) for 24 h. Figure 1 As shown in A, qRT-PCR detection found that the expression levels of hypoxia-related factors HIF1A, VEGF, and GLUT1 were significantly increased during the proliferation of porcine satellite cells treated with 50 μmol / L cobalt chloride and were greater than those at other concentrations. The hypoxia-related factors EPASI and EPO were also significantly increased compared with the control group. It is speculated that 50 μmol / L cobalt chloride is the optimal concentration for hypoxia treatment and is used as a hypoxia model for porcine skeletal muscle satellite cells in subsequent experiments.

[0045] (3) qRT-PCR detection of WAS gene expression in hypoxic pig skeletal muscle satellite cells

[0046] Subsequently, the expression changes of WAS gene during the proliferation of satellite cells treated with 50 μmol / L cobalt chloride hypoxia were detected. Figure 1 As shown in B, the qRT-PCR results showed that the expression level of WAS gene was significantly reduced, indicating that WAS may play an important role in the proliferation of pig skeletal muscle as a hypoxia-sensitive gene.

[0047] The steps of qRT-PCR are as follows: Use Trizol solution to lyse cells (add 500 μL of Trizol to one 24-well tube), extract total RNA, and reverse transcribe it into cDNA using RT-PCR technology. Design qPCR primers for specific genes, use 18S as an internal reference, amplify on a fluorescent quantitative PCR instrument, and detect mRNA expression levels. The detailed information of the primers used is as follows:

[0048] 18S-F: CCTGCGGCTTAATTTGACTC (SEQ ID NO. 1);

[0049] 18S-R: ATGCCAGAGTCTCGTTCGTT (SEQ ID NO. 2);

[0050] HIF1A-F:CTCCATTGCCTGCCTCTGAA(SEQ ID NO.3);

[0051] HIF1A-R:TGGGACTGTTAGGCTCAGGT (SEQ ID NO.4);

[0052] EPAS1-F:CTCCTGTCCCTCAGTTTGCTCT (SEQ ID NO.5);

[0053] EPAS1-R:TGCTGTGTCCTGTTAGCTCC (SEQ ID NO.6);

[0054] EPO-F:GCGCGCGAATGTCCT(SEQ ID NO.7);

[0055] EPO-R: CCATCGTGGCATTTTCGCC (SEQ ID NO. 8);

[0056] VEGF-F:CAACGACGAAGGTCTGGAGT (SEQ ID NO.9);

[0057] VEGF-R:CAAGGCCCACAGGGATTTTCTT (SEQ ID NO. 10);

[0058] GLUT1-F:ATCCTCATCGCCCAGGTATTT(SEQ ID NO.11);

[0059] GLUT1-R:CGGTTCTCCTCATTGCGGTT (SEQ ID NO. 12);

[0060] WAS-F:AGAACATACCCTCTGCGCTC(SEQ ID NO.13);

[0061] WAS-R: AGGTACAGCTGAACAACCGC (SEQ ID NO. 14);

[0062] Example 3 Construction of pig WAS gene promoter truncations

[0063] (1) Prediction of TSS site in the 5' flanking sequence of the porcine WAS gene and truncation of the promoter sequence

[0064] The 2000bp sequence at the 5' end of the WAS gene was analyzed by bioinformatics using the websites BDGP, ​​Promoter2.0, TSSG, and TSSWW to predict the transcription start site (TSS). Based on the existing VCF samples of Tibetan pigs and Yorkshire pigs, the SNP sites in the promoter region of the WAS gene were found through the two population selection analysis methods of Fst and Xpehh, and the promoter sequence of the WAS gene was truncated.

[0065] (2) Primer design for different truncated fragments of the promoter

[0066] According to the first 2000bp of the WAS gene (Gene ID: 445527) in the NCBI database, the nucleotide sequence of which is shown in SEQ ID NO.15, the promoter truncation-specific primers were designed by SnapGene, the upstream and downstream primers contained KpnⅠ and XhoⅠ restriction sites, respectively, and the downstream primer (WAS-R) remained unchanged, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. A total of three WAS gene promoter truncations were constructed, and the sizes of the promoter fragments were P1 (-326 / -1), P2 (-1183 / -1) and P3 (-2000 / -1).

[0067] The first 2000 bp sequence of the WAS gene is as follows (SEQ ID NO.15):

[0068] GCTTGGGTCCCTGTTGTGGTGAGGGTTTAATTCCTGGCCCAGGAATGTCCA

[0069] CAGGCTTAGGGCACAGCCAAAACAAATAAACAAACAAAACACCACAACTC

[0070] TTTTTCTCTTCAAGTTGTTTGTAATCAAGTTGATGATGATGTATAATTTAAAG

[0071] GACTACAAACATATAAAGCAAGCTATACTTATTGGAGGTTTGTTATTTAAAA

[0072] AAAAAATTTTTTTTTGGTCTTTTTAGAGCCATACCTGCAGCATATGGAGGTT

[0073] CCCAGGCTAGGGGTCAAATCAGTGCTACAGCTGCCGGCCTGCGCCACAGC

[0074] CACAGCAATGCCAGATCCAAGCCGTGTCTGAAACCTACATCACAGCTCACG

[0075] GCAATGCCAGATCCTTAACCCACTGAGCGAGGCCAGGGATTGAACCTGCGT

[0076] CCTCATGGATACCAGTCAGATTTGTTCCTGCTGAGCCACGACAGGCTCTCCT

[0077] ATTTATTGGAGTTTTTTTTTTAAATCCTTTTATTTTATTCAAATAGACTCATCC

[0078] TTTAATTCATAAGCTAAAGACCTTCCATTTCTGTCTTCTTTAATTGTATCACT

[0079] TTGGGGTGTTTTTCTGTAAAAAGAAACTATATAGCGTATTGCATGTTGGTTC

[0080] ATACCATACTATAAGCATTAGGGCAAGATCTCAAAAACAATGCACCCCTCAC

[0081] CAACTGTGGACCCTGAGTGTAGATACAAAATTGAAGTATATGTTACAAATCC

[0082] GGTCACCATCAGAAACATTTAGTGATGACCAAGTGCTCACACTTTAACTGA

[0083] CCTTTCGATTTTTTTCTACCCAGCACCTCAAGTGCCCATATGCACACTTGTA

[0084] ATAGAATCAGAGCTGATACAAAGGCCTGCTTGTGTTTTCAGCAGTGGAGGC

[0085] AGTGCTGGGCATACACTTGGAGTTTCTGAGTGAATTAAGAGAAATTTGTCC

[0086] CGTCTGGTGAAAGCGGGAGACTCAGGGCACAGGCTTCCTAAAATTGGGGG

[0087] CACTGTGTTAAATGATCAACAGTCCCCTCCCTTTCAGCATGTGACTGACCC

[0088] AGGCCAGTGAACTGGGGCCCCACCTATACCATCTATATCCCTGTGAATCATG

[0089] TATGTATTTATATTTATATAATGCATATAATCTAGACTTATAGTTTAGTTTACATA

[0090] TATAATGTAAACATTGCAGACTTTAAAGTAGGTATCACTGTGATGTACATTA

[0091] AATAACACCTAGCAATCATAGCAATCCTGTCGTGGTCTGACCAGGCCTAAC

[0092] CATCGCTTTGCACAACATTGAATACTGGGTAAAGTTTGTATTCTCTTAAATA

[0093] CATTTTGTCAAAGGCCTCGCTGTCAGGGCTTTGAACTCCTGTAATTTTGTAC

[0094] CAGTCTTTTCAGGAGTAAAATTAATAATTTTAGTACATCATATCTGAAGACC

[0095] ACAAGATGTTCACCGCAATTTTCAGTCCTGGCCCAACTGTGCTCATCCTATT

[0096] GTGGCAAGATGTACTTTTATTTAAAGTAACTTCTGAGAGTTTTCCTAAAACT

[0097] CAAAGAACGCCTTTTGTTTTGACTAGAGAATAATGAATGCAAGAACCCCTG

[0098] GGCAGTGGCAAGAAAACCCTAGTGGGATAGTTACAGAGTTTACGATTGTAT

[0099] GGCTCAGTGCACTAGGCACCACGCCCTGGTGTGTGATCTTACTAACCCCCA

[0100] GGAGTAAACATTAATTTTTACCCCTTCTACACGTAAACAATCTGAACCTCCG

[0101] AGGCGGTATTCGAACCCATCACACGAAAGCCCCAAAGTGCAGCTTAAGAG

[0102] GCCAGGCACAAGGGTCTGGCACCCACTGCGCATGCTCCGAACCCGTGACC

[0103] AATGGAAGCCCGGAGCGCGGAAGCGGAGGCGGGGCTGTGTTATTCTCCGA

[0104] ACCCTTGCAGCTTCAAAGAAGAGCTGGGAGGAGAATTTGACTATCGACCA

[0105] ATCAGAGCCCTGGATCCTGCTCTCCCCACCCCTGAGCCAATTACCGGCTCC

[0106] GCTGCTTAGCGAGCTACTTCGAAATTAAGGAATAGAGGGGAC

[0107] The detailed information of the primers used is as follows:

[0108] Forward primer:

[0109] WAS-P1-F: 5'CGGGGTACCCAATCTGAACCTCCGAGGCG3' (SEQ ID NO.16)

[0110] WAS-P2-F: 5'CGGGGTACCCAGAGCTGATACAAAGGCCTGCT3' (SEQ ID NO.17)

[0111] WAS-P3-F: 5'CGGGGTACCGCTTGGGTCCCTGTTGTGGTG3' (SEQ ID NO.18)

[0112] Reverse Primer:

[0113] WAS-R: 5'CCGCTCGAGGTCCCCTCTATTCCTTAATTTCGAAGTAGCT3' (SEQ ID NO.19)

[0114] (3) Amplification of different truncated fragments of the promoter region and purification and recovery of products

[0115] 50μL PCR reaction system: KOD FOX Buffer 25μL, 2Mm dNTP 10μL, 1.5μL each of 10μM forward and reverse primers, 1μL template DNA, 1μL KOD FOX, and 10μL sterile water.

[0116] The amplification conditions were as follows: pre-denaturation at 94°C for 3 min, denaturation at 98°C for 15 s, annealing at 57°C for 15 s, extension at 68°C for 60 s, 35 cycles, termination extension at 68°C for 5 min, and cooling at 16°C for 2 min.

[0117] In this embodiment, a kit was used to extract pig genomic DNA. The extraction method was referred to the instructions of the blood / cell tissue genomic DNA extraction kit (Tian Gen), and the DNA concentration was determined by NanoDrop1000 micro-volume UV spectrophotometer.

[0118] The PCR products were identified by 1% agarose gel electrophoresis. Figure 2 As shown, Figure 2 A is the electrophoresis of the amplified products of truncated P1 and P2, the size of the truncated P1 fragment is 326 bp, and the size of the truncated P1 fragment is 1183 bp; Figure 2 B is the electrophoresis diagram of the amplified product of truncated P3, with a fragment size of 2000 bp. After verifying that the band was in the correct position, the Magen agarose gel DNA recovery kit was used for gel excision, recovery and purification. All operations were performed in accordance with the kit instructions.

[0119] (4) Enzyme digestion and ligation of different truncated fragments of the promoter region with pGL3-basic plasmid

[0120] The gel-cutting product was double-digested with KpnⅠ and XhoⅠ at 37℃ for 3h. The system was: 1μL each of KpnⅠ and XhoⅠ, 1μg of gel-cutting product, 5μL of 10x Cutsmart Buffer, and made up to 50μL with sterile water.

[0121] The pGL3-basic plasmid was double-digested with KpnⅠ and XhoⅠ at 37℃ overnight. The system was: 1μL each of KpnⅠ and XhoⅠ, 1μg of pGL3-basic plasmid, 5μL of 10x Cutsmart Buffer, and sterile water was added to 50μL. The gel-cutting product after double digestion with KpnⅠ and XhoⅠ and the pGL3-basic plasmid after double digestion with KpnⅠ and XhoⅠ were purified using a PCR product purification kit (Magen).

[0122] The purified gel recovery product and the purified pGL3-basic plasmid were ligated with the NEB T4 ligase kit. The ligation system was: T4 Buffer 2 μL, Vecter (4 kb) 50 ng (0.020 pmol), Insert (1 kb) 37.5 ng (0.060 pmol), T4 ligase 1 μL, and sterile water was added to 20 μL. The ligation was carried out at 16°C overnight to obtain recombinant plasmids pGL3-basic-WAS-P1, pGL3-basic-WAS-P2 and pGL3-basic-WAS-P3.

[0123] (5) Transformation of recombinant plasmids pGL3-basic-WAS-P1, pGL3-basic-WAS-P2 and pGL3-basic-WAS-P3

[0124] Add 10 μL of recombinant plasmids pGL3-basic-WAS-P1, pGL3-basic-WAS-P2 and pGL3-basic-WAS-P3 to 100 μL of DH5α competent cells, place on ice for 30 minutes, heat shock at 42°C for 90 seconds, and then ice bath for 2 minutes. Add 500 μL of LB liquid medium without antibiotics and shake culture at 37°C for 30 minutes. Spread 200 μL evenly on LB solid medium plates containing ampicillin (100 mg / ml) and culture overnight at 37°C for 12-16 hours.

[0125] (6) Positive clone screening and sequencing identification

[0126] Pick a single colony on the plate and streak it for colony PCR detection. The 20μL system is: 0.4μL of forward and reverse primers, 10μL of 2xTaq Mix, and 9.2μL of sterile water. The amplification conditions are: 94℃ pre-denaturation for 3min, 94℃ denaturation for 15s, 57℃ annealing for 30s, 72℃ extension for 60s / kb, 30 cycles, 72℃ termination extension for 2min, and 16℃ cooling for 5min. After 1% agarose gel electrophoresis, select positive single clones. The detailed information of the primers used is as follows:

[0127] Forward Primer:

[0128] P1-F: 5'CGGGGTACCGGCACCCAGCTATTGCTAGTTCT 3' (SEQ ID NO.20)

[0129] P2-F: 5'CGGGGTACCTGCCCTGGACCCTGCTG 3' (SEQ ID NO.21)

[0130] P3-F: 5'CGGGGTACCGCTTGGGTCCCTGTTGTGGTG3' (SEQ ID NO.22)

[0131] Reverse Primer:

[0132] LucNrev-R:5'CCTTATGCAGTTGCTCTCC 3'(SEQ ID NO.23)

[0133] Sequencing: The above positive monoclonal bacterial solution was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were spliced ​​and sequenced using SnapGene software. The results are as follows: Figure 3 , Figure 4 As shown, Figure 3 is the sequencing result analysis of pGL3-basic-WAS-P1; Figure 3 A is the sequencing sequence of pGL3-basic-WAS-P1; Figure 3 B is the sequencing peak diagram of pGL3-basic-WAS-P1; Figure 4 is the sequencing result analysis of pGL3-basic-WAS-P2; Figure 4 A is the sequencing sequence of pGL3-basic-WAS-P2; Figure 4 B is the sequencing peak diagram of pGL3-basic-WAS-P2; Figure 5 is the sequencing result analysis of pGL3-basic-WAS-P3; Figure 5 A is the sequencing sequence of pGL3-basic-WAS-P3; Figure 5B is the sequencing peak diagram of pGL3-basic-WAS-P3. The above results show that the WAS gene promoter truncation dual-fluorescein reporter gene plasmid was successfully constructed.

[0134] (7) Extraction of recombinant plasmids pGL3-basic-WAS-P1, pGL3-basic-WAS-P2 and pGL3-basic-WAS-P3

[0135] The recombinant plasmids pGL3-basic-WAS-P1, pGL3-basic-WAS-P2 and pGL3-basic-WAS-P3 with correct sequencing results were extracted using the Omega Endo-free Plasmid Mini Kit II kit, and all operations were performed according to the kit instructions.

[0136] Example 4 Detection of activity of the porcine WAS gene promoter region

[0137] (1) Transient cell transfection

[0138] PK15 cells were inoculated into 24-well cell culture plates, with 3 replicates per group, and transfection was performed when the cell density reached about 70%. DNA / liposome complexes were prepared, and the liposomes were allowed to stand for 5 minutes. An equal volume of plasmid solution and liposome solution were mixed (as shown in Table 1), and the mixture was gently pipetted and mixed, and the mixture was allowed to stand for 20 minutes to form DNA / liposome complexes.

[0139] Table 1 Connection system of target sequence and pGL3-basic vector

[0140]

[0141]

[0142] DNA / liposome complex was added dropwise to each well, shaken and cultured in a 37°C cell culture incubator for 6 hours, then replaced with complete culture medium and continued to culture. Fluorescence intensity was detected after 48 hours.

[0143] (2) Dual luciferase activity assay

[0144] According to the instructions of the Biyuntian Dual Luciferase Reporter Gene Assay Kit II (RG029S), the luciferase activity of the corresponding groups was detected. The relative luciferase activity value of each group was equal to the average value of the ratio of the firefly luciferase to the Renilla luciferase detection value of each independent experiment in each group. The activity of the control pGL3-basic was determined as 1. The relative luciferase activity results of different promoter truncations of the WAS gene are shown in Figure 6 As shown, the truncation P1 has the highest activity and is significantly higher than other truncation forms, indicating that -1bp to -326bp is the core promoter region.

[0145] Example 5 Verification of SNP sites of pig WAS gene

[0146] (1) Design of mutation primers

[0147] According to the results of the previous population selection analysis, a SNP site (g.-245T>A) in the core promoter region of the WAS gene was selected for verification, and the specific primers were designed as follows:

[0148] WAS-SNP(g.-245T>A)-F:

[0149] TGCAGCTTAAGTGGCCAGGCACAAGGGTCTGG(SEQ ID NO.24)

[0150] WAS-SNP(g.-245T>A)-R:

[0151] TGGCCACTTAAGCTGCACTTTGGGGCTTTCGT(SEQ ID NO.25)

[0152] (2) Amplification of target plasmid pGL3-basic-WAS-P1 and product purification and recovery

[0153] 50μL PCR reaction system: KOD FOX Buffer 25μL, 2Mm dNTP 10μL, 1.5μL each of 10μM forward and reverse primers, recombinant plasmid pGL3-basic-WAS-P1 DNA 1ng, KOD FOX 1μL, aseptically make up to 50μL.

[0154] The amplification conditions were as follows: pre-denaturation at 94°C for 3 min, denaturation at 98°C for 15 s, annealing at 57°C for 15 s, extension at 68°C for 60 s, 35 cycles, termination extension at 68°C for 5 min, and cooling at 16°C for 2 min.

[0155] The PCR products were identified by 1% agarose gel electrophoresis, and the WAS gene SNP site (g.-245T>A) was verified as follows Figure 7 As shown, Figure 7 A is the electrophoresis diagram of the reverse PCR product of the mutant fragment, and the fragment size is 5490bp; after verifying that the band is in the correct position, the Magen agarose gel DNA recovery kit is used for gel excision recovery and purification, and all operations are performed according to the kit instructions.

[0156] (3) Dpn I digestion of amplified product

[0157] Add 1 μL of Dpn I enzyme to the amplified product, gently pipette to mix, centrifuge briefly, and place at 37°C for 1-2 hours. Then perform 1% agarose gel electrophoresis and gel recovery, remove the plasmid template to obtain the PCR-generated product. For single-base mutations, the optimal amount of Dpn I digestion product = [0.02 × number of fragment base pairs] ng

[0158] (4) Homologous recombination

[0159] Reaction system: 50-400 ng of Dpn I digestion product, 4 μL of 5xCEⅡBuffer, 2 μL of ExnaseⅡ, add sterile water to 20 μL, gently pipette to mix, centrifuge briefly, incubate at 37℃ for 30 min, and then immediately cool on ice.

[0160] The recombinant plasmid pGL3-basic-WAS-P1 was transformed, sequenced and extracted according to the same steps as in Example 3. The sequencing peak of pGL3-basic-WAS-SNP (g.-245T>A) is shown in Figure 7 As shown in B, it indicates that the single point mutation plasmid of the SNP site was successfully constructed.

[0161] The cell transient transfection and dual luciferase activity assay were performed in the same manner as in Example 4. The relative luciferase activity of the WAS SNP site (g.-245T>A) promoter expression vector was determined (n=3, *P<0.05, **P<0.01). Figure 7 As shown in C, the activity of the control pGL3-basic was determined to be 1, and the mutation activity of the SNP site (g.-245T>A) was significantly increased and higher than that of the unmutated fragment, indicating that the SNP site (g.-245T>A) has an impact on the expression activity of the WAS gene and plays an important role in pigs' tolerance to hypoxia.

[0162] Therefore, the present invention obtains a SNP molecular marker related to pig hypoxia tolerance, g.-245T>A.

[0163] The contents not described in detail in this specification belong to the prior art known to professional and technical personnel in this field.

[0164] Finally, it should be noted that the above description is only a preferred example of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A SNP molecular marker related to pig hypoxia tolerance based on WAS gene, characterized in that: The SNP molecular marker is located at the 245th position of the nucleotide sequence of the core promoter region of the WAS gene, and the base is A or T; the nucleotide sequence of the core promoter region of the WAS gene is -1bp to -326bp of the sequence shown in SEQ ID NO.15; the SNP site is located at 42774352bp of chromosome 23 of the international pig genome NCBI Sscrofa 11.1 version.

2. The SNP molecular marker based on the WAS gene and related to pig hypoxia tolerance according to claim 1, characterized in that: Under hypoxic conditions, A is the dominant allele.

3. The primer pair for amplifying the SNP molecular marker related to pig hypoxia tolerance based on the WAS gene according to claim 1, characterized in that: The forward sequence of the primer pair is shown in SEQ ID NO.24; The reverse sequence of the primer pair is shown as SEQ ID NO.

25.

4. A reagent or kit containing primers for SNP molecular markers related to pig hypoxia tolerance based on the WAS gene as described in claim 1.

5. Use of the SNP molecular markers related to pig hypoxia tolerance based on the WAS gene as described in any one of claims 1 to 4 in the assisted breeding of hypoxia-resistant pig breeds.

6. The SNP molecular marker related to pig hypoxia tolerance based on WAS gene according to claim 1, characterized in that: The core promoter region of the porcine WAS gene is detected, and the recombinant plasmids pGL3-basic-WAS-P1, pGL3-basic-WAS-P2 and pGL3-basic-WAS-P3 are constructed by constructing porcine WAS gene promoter truncations P1, P2 and P3, and the relative luciferase activity of the recombinant plasmids is determined by dual luciferase activity; the nucleotide sequence of the truncation P1 is the 1-326 base sequence of SEQ ID NO.15; the nucleotide sequence of the truncation P2 is the 1-1183 base sequence of SEQ ID NO.15; and the nucleotide sequence of the truncation P3 is the 1-2000 base sequence of SEQ ID NO.

15.

7. The SNP molecular marker associated with pig hypoxia tolerance based on the WAS gene according to claim 6, characterized in that: The forward sequences of the primer pairs for amplifying the porcine WAS gene promoter truncations P1, P2 and P3 are shown in SEQ ID NO.16, SEQ ID NO.17 and SEQ ID NO.18, and the reverse sequences are shown in SEQ ID NO.

19.

8. A method for breeding hypoxia-tolerant pig breeds based on the SNP molecular markers of claim 1, characterized in that: The SNP molecular marker at position 245 in the core promoter region of the WAS gene is detected, and individuals with allele A at the site are selected for breeding.

Images