A SNP molecular marker related to flower period of chrysanthemum and application thereof

Abstract

The present application belongs to the technical field of gene molecular marker, and particularly relates to a SNP molecular marker related to chrysanthemum flowering period and application thereof. The present application finds a SNP molecular marker significantly related to chrysanthemum flowering period on the chrysanthemum flowering period control gene BBX24, and enriches the chrysanthemum flowering period molecular marker database. Through research, it is found that based on the SNP molecular marker on the chrysanthemum flowering period control gene BBX24, the BBX24 gene detection can be carried out on chrysanthemum varieties of different flowering ecotypes, and then the flowering control gene BBX24 is rapidly and accurately detected in different germplasm resources such as summer chrysanthemum, autumn chrysanthemum and summer-autumn chrysanthemum, so as to realize the identification of different flowering ecotype chrysanthemums. The SNP molecular marker can be used for foreground selection in the early stage of molecular marker assisted breeding, reduce the size of breeding population, accelerate the breeding process, and is beneficial to the efficient application of the BBX24 gene in the biological breeding of chrysanthemum flowering period improvement.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of gene molecular markers, and particularly relates to a SNP molecular marker related to the flowering period of chrysanthemum and application thereof. BACKGROUND

[0002] Chrysanthemum is a precious ornamental flower bred through long-term artificial selection and is known as one of the "Four Gentlemen of Flowers" and has a cultivation history of more than 3,000 years in China. The flowering time of chrysanthemum varies with different varieties and seasons and can be divided into summer chrysanthemum, summer-autumn chrysanthemum, autumn chrysanthemum and winter chrysanthemum. Among them, summer chrysanthemum, also known as five-nine chrysanthemum, blooms once in June; summer-autumn chrysanthemum blooms once in June and September; autumn chrysanthemum is the most common type of chrysanthemum, has a flowering period from September to October and has a certain cold resistance; winter chrysanthemum, also known as winter chrysanthemum, usually blooms in November and is named for its blooming in a cold environment.

[0003] Chrysanthemum is a short-day plant and will stimulate flower bud differentiation and bloom under the condition of short-day in autumn, which is one of the reasons for the blooming of chrysanthemum in autumn. The blooming of chrysanthemum is mainly induced by short-day signals, and in the long-term evolution, chrysanthemum has differentiated into various types of adaptation to light or temperature sensitive blooming. Some types of chrysanthemum are more sensitive to photoperiod, while some types are more sensitive to temperature change, which is related to the difference in the blooming regulation genes thereof.

[0004] In order to better explore the chrysanthemum flowering pathway and excavate excellent genes controlling the chrysanthemum flowering ecotype, more chrysanthemum varieties of different blooming types are bred, and currently, the genes related to the flowering time of chrysanthemum are excavated through the method of gene screening. However, the traditional gene screening method often needs a large amount of time and plant resources, and chrysanthemum has the characteristics of high heterozygosity and high ploidy, which makes the identification and screening of the chrysanthemum flowering ecotype gene become particularly difficult. SUMMARY

[0005] The purpose of the present application is to provide a SNP molecular marker related to the flowering period of chrysanthemum and application thereof, the SNP molecular marker is significantly related to the flowering period control gene BBX24 of chrysanthemum and can be used for identifying the genotype of the flowering period control gene BBX24 of chrysanthemum and the flowering period of chrysanthemum, distinguishing chrysanthemum varieties and enriching the database of chrysanthemum flowering period molecular markers.

[0006] The present application provides a SNP molecular marker related to the flowering period of chrysanthemum, the SNP molecular marker is located at the 153th site of the coding region of BBX24 gene and the polymorphism is A / G; the accession number of the BBX24 gene in GenBank is KF385866.1.

[0007] Preferably, the nucleotide sequence comprising the SNP molecular marker is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

[0008] The application further provides a primer set for detecting the SNP molecular marker in the technical solution, comprising a universal primer and a multiplex primer, wherein the universal primer comprises BBX24-C1F, and the nucleotide sequence of the BBX24-C1F is shown as SEQ ID NO. 3; and the nucleotide sequence of the multiplex primer BBX24-C1R is shown as SEQ ID NO. 4.

[0009] The application further provides a kit, which comprises the primer set and PCR amplification reagents in the technical solution.

[0010] Preferably, the kit further comprises DNA extraction reagents.

[0011] The application further provides application of the SNP molecular marker in the technical solution or the primer set in the technical solution or the kit in the technical solution in identifying the genotype of the BBX24 gene.

[0012] The application further provides application of the SNP molecular marker in the technical solution or the primer set in the technical solution or the kit in the technical solution in identifying the flowering period of chrysanthemum.

[0013] Preferably, the identifying the flowering period of chrysanthemum comprises distinguishing chrysanthemum varieties, and the chrysanthemum varieties comprise summer chrysanthemum, autumn chrysanthemum and summer-autumn chrysanthemum.

[0014] The application further provides a method for identifying the flowering period of chrysanthemum and / or distinguishing chrysanthemum varieties, comprising the following steps:

[0015] extracting genomic DNA of chrysanthemum to be detected;

[0016] performing PCR amplification on the genomic DNA as a template by using the primer set in the technical solution to obtain a PCR amplification product;

[0017] sequencing the PCR amplification product to obtain a sequencing sequence;

[0018] According to the sequencing sequence, the flowering period of the to-be-tested chrysanthemum is predicted: when the base at the 153th site of the coding region of the BBX24 gene is A, the flowering period of the to-be-tested chrysanthemum is from mid-June to mid-July, and the chrysanthemum is summer chrysanthemum; when the base at the 153th site of the coding region of the BBX24 gene is G, the flowering period of the to-be-tested chrysanthemum is from mid-September to late October, and the chrysanthemum is autumn chrysanthemum; when the bases A and G at the 153th site of the coding region of the BBX24 gene both exist, the flowering period of the to-be-tested chrysanthemum is from mid-June to early August or from late September to early October, and the chrysanthemum is summer-autumn chrysanthemum.

[0019] The application further provides application of the SNP molecular marker, the primer set, the kit or the method in molecular marker assisted breeding of chrysanthemum flowering period improvement.

[0020] Beneficial effects:

[0021] The application provides a SNP molecular marker related to chrysanthemum flowering period, the SNP molecular marker is located at the 153th site of the coding region of a BBX24 gene, and the polymorphism is A / G; the BBX24 gene has a GenBank accession number of KF385866.1. The application finds a SNP molecular marker significantly related to chrysanthemum flowering period on a chrysanthemum flowering period control gene BBX24, and enriches a chrysanthemum flowering period molecular marker database. Through research, it is found that based on the SNP molecular marker on the chrysanthemum flowering period control gene BBX24, BBX24 gene detection can be performed on chrysanthemum varieties of different flowering ecotypes, and then flowering control genes BBX24 in summer chrysanthemum, autumn chrysanthemum and summer-autumn chrysanthemum and other different germplasms can be quickly and accurately detected, so that different flowering period chrysanthemums can be identified, and chrysanthemum varieties can be distinguished. The SNP molecular marker can be used for foreground selection in early molecular marker assisted breeding, reduce the size of a breeding population, accelerate the breeding process, and is beneficial to efficient application of the BBX24 gene in biological breeding of chrysanthemum flowering period improvement. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows.

[0023] Figure 1 It is the cloning and alignment result of the BBX24 gene in different flowering types of chrysanthemums in Example 1; wherein CmBBX24a and CmBBX24b respectively represent the genes when the base at the 153th site of the coding region of the BBX24 gene is A and G. DETAILED DESCRIPTION

[0024] The application provides a SNP molecular marker related to the flowering period of chrysanthemum, wherein the SNP molecular marker is located at the 153th site of the coding region of a BBX24 gene, and the polymorphism is A / G; the accession number of the BBX24 gene in GenBank is KF385866.1.

[0025] In the application, as an embodiment, the nucleotide sequence (1-155bp) containing the SNP molecular marker is shown in SEQ ID NO. 1 or SEQ ID NO. 2.

[0026] The nucleotide sequence shown in SEQ ID NO. 1 is as follows: 5'-ATGAAGATTCAGTGTGATGT GTGAAAAAGCTCCAGCAACATTGATATGTTGTGCAGATGAAGCTGCTTT GTGTGCAAGATGTGATGTGGAAGTTCATGCAGCCAATAAGCTTGCTAGCAAA CATCAAAGGCTTTTGTTGCAGCAATCTTTATC-3';

[0027] The nucleotide sequence shown in SEQ ID NO. 2 is as follows: 5'-ATGAAGATTCAGTGTGATGT GTGAAAAAGCTCCAGCAACATTGATATGTTGTGCAGATGAAGCTGCTTT GTGTGCAAGATGTGATGTGGAAGTTCATGCAGCCAATAAGCTTGCTAGCAA ACATCAAAGGCTTTTGTTGCAGCAATCTTTGTC-3'.

[0028] In the nucleotide sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, the bold italic bases are the positions of the above-mentioned SNP molecular marker.

[0029] The application further provides a primer set for detecting the SNP molecular marker in the above-mentioned technical solution, comprising a universal primer and a compatible primer BBX24-C1R, wherein the universal primer comprises BBX24-C1F, the nucleotide sequence of the BBX24-C1F is shown in SEQ ID NO. 3; and the nucleotide sequence of the compatible primer BBX24-C1R is shown in SEQ ID NO. 4. The BBX24-C1R in the application is used for amplifying the BBX24 gene sequence with A and G (R is a compatible base amplifying A / G) of the SNP molecular marker.

[0030] The nucleotide sequences shown in SEQ ID NO. 3-SEQ ID NO. 4 are as follows:

[0031] SEQ ID NO. 3: 5'-ATGAAGATTCAGTGTGATGTGTGTGAA-3';

[0032] SEQ ID NO. 4: 5'-GARAAAGATTGCTGCAACAAAAGCCTT-3'.

[0033] The application further provides a kit comprising the primer set in the above technical solution and PCR amplification reagents. As an implementation form, the kit of the application can further comprise DNA extraction related reagents. The application does not have special limitations on the source and specifications of the PCR amplification reagents and the DNA extraction related reagents, and the related reagents obtained from conventional commercial channels in the art can be used.

[0034] The application further provides application of the SNP molecular marker in the above technical solution or the primer set in the above technical solution or the kit in the above technical solution in identifying the genotype of the BBX24 gene.

[0035] The application further provides application of the SNP molecular marker in the above technical solution or the primer set in the above technical solution or the kit in the above technical solution in identifying the flowering period of chrysanthemum. As an implementation form, the identification of the flowering period of chrysanthemum in the application can be used to distinguish chrysanthemum varieties; the chrysanthemum varieties are summer chrysanthemum, autumn chrysanthemum and summer-autumn chrysanthemum.

[0036] The application further provides a method for identifying the flowering period of chrysanthemum and / or distinguishing chrysanthemum varieties, comprising the following steps:

[0037] extracting genomic DNA of the chrysanthemum to be tested;

[0038] performing PCR amplification on the genomic DNA as a template by using the primer set in the above technical solution to obtain a PCR amplification product;

[0039] sequencing the PCR amplification product to obtain a sequencing sequence;

[0040] predicting the flowering period of the chrysanthemum to be tested according to the sequencing sequence: when the base at the 153rd site of the coding region of the BBX24 gene is A, the flowering period of the chrysanthemum to be tested is from mid-June to mid-July, which is summer chrysanthemum; when the base at the 153rd site of the coding region of the BBX24 gene is G, the flowering period of the chrysanthemum to be tested is from mid-September to late October, which is autumn chrysanthemum; when the bases A and G at the 153rd site of the coding region of the BBX24 gene both exist, the flowering period of the chrysanthemum to be tested is from mid-June to early August or from late September to early October, which is summer-autumn chrysanthemum.

[0041] The application discovers a SNP molecular marker significantly related to the chrysanthemum flowering period on the chrysanthemum flowering period control gene BBX24, and enriches the chrysanthemum flowering period molecular marker database. It is found through research that the SNP molecular marker on the chrysanthemum flowering period control gene BBX24 can be used for BBX24 gene detection of chrysanthemum varieties of different flowering ecotypes, so as to quickly and accurately detect the flowering control gene BBX24 in different germplasm resources such as summer chrysanthemum, autumn chrysanthemum and summer-autumn chrysanthemum, so as to realize the identification of chrysanthemum varieties of different flowering periods. The SNP molecular marker can be used for early selection in molecular marker assisted breeding, reduce the size of the breeding population, speed up the breeding process, and is beneficial to the efficient application of the BBX24 gene in the biological breeding of chrysanthemum flowering period improvement

[0042] Based on the above advantages, the application also provides the application of the SNP molecular marker in the chrysanthemum flowering period improvement molecular marker assisted breeding.

[0043] In order to further illustrate the application, the technical solutions provided by the application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the application.

[0044] Example 1

[0045] Discovery of the SNP molecular marker on the chrysanthemum flowering period control gene BBX24:

[0046] 1. Cloning the target gene BBX24 sequence in different flowering ecotype chrysanthemum varieties, and extracting the SNP site, the specific steps are as follows:

[0047] 1) According to the coding region sequence of the target gene BBX24 (GenBank accession number KF385866.1), the primer sequence shown in SEQ ID NO. 3-SEQ ID NO. 4 is used for amplification.

[0048] 2) Extract the RNA of chrysanthemum varieties 'Xingfang', 'Xiahuang' and 'Yeku' respectively, set 3 biological replicates for each variety, and reverse the obtained RNA to cDNA.

[0049] 3) The cloning primer in step 1) is used for PCR amplification of the cDNA of different chrysanthemum varieties to obtain the target gene BBX24 sequence, and the PCR amplification system is shown in Table 1.

[0050] Table 1 PCR amplification system

[0051] Ingredients Volume 2x PhantaMax Buffer 25 μL Forward Primer 2 μL Reverse Primer 2 μL cDNA 2 μL Deionized Water 17 μL dNTP 1 μL PhantaMax Super-Fidelity DNA Polymerase 1 μL

[0052] The reaction procedure of PCR amplification is as follows: 95℃, 3 min, 1 cycle; 95℃, 15 s, 58℃, 15 s, 72℃, 1 min / kb, 35 cycles; 72℃, 5 min, 1 cycle.

[0053] 4) The obtained target gene BBX24 sequence construction vector plasmid was transformed into E. coli, positive clones were picked and sequenced, and the target gene BBX24 sequences cloned from 'Xingfang', 'Xiahuang' and 'Yeju' were obtained, respectively.

[0054] 5) The target gene BBX24 sequences cloned from 'Xingfang', 'Xiahuang' and 'Yeju' were subjected to sequence alignment, and the results are shown in Figure 1

[0055] Figure 1 It can be concluded that 1 SNP molecular marker site BBX24-C capable of identifying BBX24 is found. The BBX24-C site is located at the 153th base of the coding region of BBX24 gene, and the base sequences are A or G, respectively; by verifying in different flowering types of chrysanthemum, BBX24-C1 is selected as the SNP molecular marker of chrysanthemum flowering control gene BBX24.

[0056] Example 2

[0057] The SNP molecular marker in Example 1 was used to detect the flowering type of chrysanthemum varieties, and the steps were as follows:

[0058] Based on the SNP molecular marker obtained in Example 1, a primer set was designed for the detection of the flowering type of chrysanthemum varieties, and the primer sequences were as follows:

[0059] SEQ ID NO. 3 (BBX24-C1F): 5'-ATGAAGATTCAGTGTGATGTGTGTGAA-3';

[0060] SEQ ID NO. 4 (BBX24-C1R): 5'-GARAAAGATTGCTGCAACAAAAGCCTT-3'.

[0061] The chrysanthemum varieties are shown in Table 3, and 3 biological replicates of each variety were set for detection;

[0062] The detection steps are as follows:

[0063] 1) DNA extraction: genomic DNA was extracted from chrysanthemum leaves by CTAB method;

[0064] 2) PCR reaction system: The genomic DNA extracted in step 1) was subjected to PCR amplification detection by the above amplification primer pair, and the amplification product was sequenced. ​​

[0065] PCR amplification reaction system was 50 μL PCR reaction system, and the reaction system was the same as Table 1. The PCR amplification procedure was as follows: 95℃, 3 min, 1 cycle; 95℃, 15 s, 58℃, 15 s, 72℃, 1 min / kb, 35 cycles; 72℃, 5 min, 1 cycle.

[0066] 3) The amplification sequencing results are shown in Table 3:

[0067] Table 3: Chrysanthemum varieties and amplification sequencing results in Example 2

[0068]

[0069]

[0070] Note: The bold italic bases in Table 3 are the bases at the 152nd bp of the BBX24 gene coding region, and the detection results of the three biological repeat samples of each variety in Table 3 are consistent.

[0071] As can be seen from Table 3, the varieties carrying the BBX24 gene detect base A at the BBX24-C1(153) SNP site as early-flowering BBX24 type, such as summer chrysanthemum variety 'Xiahuang'; the varieties carrying the BBX24 gene detect base A and G at the BBX24-C1(153) SNP site as summer-autumn BBX24 type, such as summer-autumn chrysanthemum variety 'Xingfang'; and the varieties carrying the BBX24 gene detect base G at the BBX24-C1(153) SNP site as late-flowering BBX24 type, such as wild chrysanthemum. BBX24-C1 can be used for efficient detection of chrysanthemum flowering control gene BBX24.

[0072] From the above results, it can be concluded that the SNP site (153) developed for chrysanthemum BBX24 gene can be used for rapid detection of chrysanthemum flowering period.

[0073] The SNP molecular marker is significantly related to chrysanthemum flowering control gene BBX24 and chrysanthemum flowering period, and can be used for identifying the genotype of chrysanthemum flowering control gene BBX24 and the flowering period of chrysanthemum, and enriching the database of chrysanthemum flowering period molecular markers.

[0074] Although the above examples have made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which all belong to the protection scope of the present application.

Claims

1. The use of a reagent for detecting the genotype of a SNP site in identifying the flowering period of a chrysanthemum, wherein the SNP site is at position 153 of the nucleotide sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2, and the base is A or G. When the base at the SNP site is A, the flowering period of the chrysanthemum is from mid-June to mid-July, and the chrysanthemum is a summer chrysanthemum; when the base at the SNP site is G, the flowering period of the chrysanthemum is from mid-September to late October, and the chrysanthemum is an autumn chrysanthemum; when both A and G exist at the SNP site, the flowering period of the chrysanthemum is from mid-June to early August or from late September to early October, and the chrysanthemum is a summer-autumn chrysanthemum. The chrysanthemum is 'Xiahuang', wild chrysanthemum, 'Xiaoguixiang', 'Bai-chongxiang', and 'Xingfang'.

2. The application of the primer set for detecting the SNP locus genotype of claim 1 in identifying the flowering period of chrysanthemum, wherein the primer set consists of degenerate primers and universal primers, and the nucleotide sequence of the universal primer BBX24-C1F is shown in SEQ ID NO.3; the degenerate primers... BBX24 The nucleotide sequence of -C1R is shown in SEQ ID NO.4; When the base at the SNP site of claim 1 is A, the flowering period of the chrysanthemum is from mid-June to mid-July, and the chrysanthemum is a summer chrysanthemum; when the base at the SNP site of claim 1 is G, the flowering period of the chrysanthemum is from mid-September to late October, and the chrysanthemum is an autumn chrysanthemum; when both A and G exist at the SNP site of claim 1, the flowering period of the chrysanthemum is from mid-June to early August or from late September to early October, and the chrysanthemum is a summer-autumn chrysanthemum. The chrysanthemum is 'Xiahuang', wild chrysanthemum, 'Xiaoguixiang', 'Bai-chongxiang', and 'Xingfang'.

3. The use of a kit in identifying the flowering period of a chrysanthemum, wherein the kit comprises the primer set of claim 2 and PCR amplification reagents. When the base at the SNP site of claim 1 is A, the flowering period of the chrysanthemum is from mid-June to mid-July, and the chrysanthemum is a summer chrysanthemum; when the base at the SNP site of claim 1 is G, the flowering period of the chrysanthemum is from mid-September to late October, and the chrysanthemum is an autumn chrysanthemum; when both A and G exist at the SNP site of claim 1, the flowering period of the chrysanthemum is from mid-June to early August or from late September to early October, and the chrysanthemum is a summer-autumn chrysanthemum. The chrysanthemum is 'Xiahuang', wild chrysanthemum, 'Xiaoguixiang', 'Bai-chongxiang', and 'Xingfang'.

4. Use according to claim 3, characterized in that, The kit further comprises DNA extraction reagents.

5. A method for identifying the flowering stage of chrysanthemum and distinguishing chrysanthemum varieties, characterized by, The method comprises the following steps: extracting the genomic DNA of the chrysanthemum to be tested; performing PCR amplification on the genomic DNA as a template using the primer set of claim 2 to obtain a PCR amplification product; sequencing the PCR amplification product to obtain a sequencing sequence; predicting the flowering period of the chrysanthemum to be tested according to the sequencing sequence: when the base at the SNP site of claim 1 is A, the flowering period of the chrysanthemum to be tested is from mid-June to mid-July, and the chrysanthemum is a summer chrysanthemum; when the base at the SNP site of claim 1 is G, the flowering period of the chrysanthemum to be tested is from mid-September to late October, and the chrysanthemum is an autumn chrysanthemum; when both A and G exist at the SNP site of claim 1, the flowering period of the chrysanthemum to be tested is from mid-June to early August or from late September to early October, and the chrysanthemum is a summer-autumn chrysanthemum. The chrysanthemum is 'Xiahuang', wild chrysanthemum, 'Xiaoguixiang', 'Bai-chongxiang', and 'Xingfang'.

6. The use of a reagent for detecting the genotype of the SNP site of claim 1 in chrysanthemum flowering period improvement assisted breeding. when the base at the SNP site is A, the Chrysanthemum has a flowering period of mid-June to mid-July, and is a summer chrysanthemum; when the base at the SNP site is G, the Chrysanthemum has a flowering period of mid-September to late October, and is an autumn chrysanthemum; when both A and G exist at the SNP site, the Chrysanthemum has a flowering period of mid-June to early August or late September to early October, and is a summer-autumn chrysanthemum; the Chrysanthemum is 'Xiahuang', wild chrysanthemum, 'Xiaoguixiang', 'Bai-chongxiang', and 'Xingfang'.

7. Use of the primer set of claim 2 or the kit of claim 3 or 4 or the method of claim 5 in chrysanthemum flowering period improvement assisted breeding; when the base at the SNP site of claim 1 is A, the Chrysanthemum has a flowering period of mid-June to mid-July, and is a summer chrysanthemum; when the base at the SNP site of claim 1 is G, the Chrysanthemum has a flowering period of mid-September to late October, and is an autumn chrysanthemum; when both A and G exist at the SNP site of claim 1, the Chrysanthemum has a flowering period of mid-June to early August or late September to early October, and is a summer-autumn chrysanthemum; the Chrysanthemum is 'Xiahuang', wild chrysanthemum, 'Xiaoguixiang', 'Bai-chongxiang', and 'Xingfang'.

Images