InDel marker related to flag leaf width character of millet, primer group and application

Abstract

The invention belongs to the technical field of millet breeding, and particularly relates to an InDel marker related to the flag leaf width character of millet, a primer group and application. The InDel marker is located at the upstream 66bp position of an initiation codon ATG of the Seita. 5G134600 gene, if a DNA fragment containing 277bp indicates that the flag leaf of the millet is in a wide character, and if the DNA fragment lacking 277bp indicates that the flag leaf of the millet is in a narrow character. Experiments prove that the InDel marker in the invention can accurately, reliably and effectively distinguish whether the flag leaf of millet is in a wide leaf shape or a narrow leaf shape, is not influenced by environmental factors, and can be used for breeding of the flag leaf width character of millet.

Description

Technical Field

[0001] The invention belongs to the technical field of millet breeding, and particularly relates to an InDel marker related to a millet flag leaf width trait, a primer set and an application thereof. Background Art

[0002] Faced with the dual challenges of continued global population growth and reduced arable land, more and more breeders aim to increase crop yield per unit area by increasing planting density. However, higher planting density usually stunts leaf growth, significantly reduces photosynthesis efficiency, and reduces lodging resistance. Good leaf traits can alleviate the problems caused by increased planting density.

[0003] The flag leaf in wheat is the main photosynthetic organ, providing the main source of carbohydrates for grain filling in the later stages of crop growth. Flag leaf length, flag leaf width, and flag leaf area are crucial in determining the amount of light captured for photosynthesis. Breeding cereals with optimally sized flag leaves is an effective strategy to increase grain yield potential. Numerous studies have shown that flag leaf size is positively correlated with traits such as 1,000-grain weight and yield per plant in cereals, including rice and wheat. Flag leaf length and flag leaf width together determine flag leaf area. If a flag leaf is too long, it may droop, resulting in reduced photosynthetic efficiency, especially when planted at high density.

[0004] Therefore, increasing the width of the flag leaf is an effective method to improve the flag leaf area. However, there are few studies on the flag leaf width trait in millet, and the effect value of the located QTL loci is low and the number of overlapping loci is small, which limits the progress of molecular marker-assisted breeding for this trait. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides an InDel marker, a primer set and an application related to the flag leaf width trait of millet, which can be used to type the flag leaf width of millet. The InDel marker can be used for auxiliary selection of millet flag leaf breeding.

[0006] The technical solution of the present invention is as follows.

[0007] In a first aspect, the present invention provides an InDel marker related to the flag leaf width trait of millet. The InDel marker is a gene fragment whose nucleotide sequence is shown as SEQ ID NO.1.

[0008] The present invention uses the RIL population derived from the hybridization of Heizhigu with long narrow leaves and Changnong 35 with short wide leaves as experimental materials, conducts QTL positioning analysis on the flag leaf width (FLW) trait of millet under three planting densities of Heizhigu, Changnong 35 and RIL population, obtains a stable QTL locus qFLW5-2 located on chromosome 5, and develops InDel marker Seita.5G134600 in the interval of 11731400 to 11731900 of the locus 5UTR277 This marker is closely linked to the width of the flag leaf of millet. 5UTR277+ and Seita.5G134600 5UTR277- There are significant differences in flag leaf width among the lines, including Seita.5G134600 5UTR277+ The leaf width of the variant germplasm material was significantly wider than that of the germplasm carrying Seita.5G134600. 5UTR277- The flag leaf width of the germplasm materials is variable.

[0009] The second aspect of the present invention provides a primer set for amplifying the InDel marker related to the flag leaf width trait of millet, the primer set consists of an upstream primer with a nucleotide sequence such as SEQ ID NO.2 and a downstream primer with a nucleotide sequence such as SEQ ID NO.3.

[0010] The third aspect of the present invention provides a kit, which comprises the primer set.

[0011] In another preferred embodiment, the kit further comprises reagents for PCR amplification.

[0012] The fourth aspect of the present invention provides the use of the kit in identifying flag leaf traits of millet.

[0013] A fifth aspect of the present invention provides a method for identifying the flag leaf width trait of millet, comprising the following steps:

[0014] Using the millet gene DNA to be identified as a template, using the PCR primers to perform PCR amplification, detecting whether the amplified product contains a gene fragment with a sequence such as SEQ ID NO.1, and judging whether the millet flag leaf is a wide trait or a narrow trait;

[0015] If the amplified product of the millet to be identified contains the gene fragment shown in SEQ ID NO.1, the flag leaf of the millet is a wide trait;

[0016] If the amplified product of the millet to be identified does not contain the gene fragment of SEQ ID NO.1, the millet flag leaf has a narrow trait.

[0017] A sixth aspect of the present invention provides an application of the InDel marker in the prediction of millet flag leaf width trait or millet molecular-assisted screening breeding.

[0018] The seventh aspect of the present invention provides an application of the primer set in the prediction of the flag leaf width trait of millet or in the molecular-assisted screening and breeding of millet.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention discloses the detection and application of an InDel marker related to the width of the flag leaf under a specific planting density of millet. The present application uses a RIL population derived from the hybridization of Heizhigu with long narrow leaves and Changnong 35 with short wide leaves as experimental materials. Based on a high-density genetic map constructed by whole genome resequencing, QTL positioning analysis was performed on the flag leaf width (FLW) trait of millet under three planting densities, and a stable QTL locus qFLW5-2 located on chromosome 5 was obtained. InDel marker Seita.5G134600 was developed in the range of 11731400 to 11731900 of this locus. 5UTR277 (F:AGTGACCCGTGACCGTGAG, R:GAGGTCTTGGCGAAGTAGGC), this marker is closely linked to the width of the flag leaf of millet. In the RIL population, Seita.5G134600 5UTR277+ and Seita.5G134600 5UTR277- There were significant differences in flag leaf width among the lines. Among 680 germplasms from natural populations under two environmental conditions, Shunyi, Beijing and Changzhi, Shanxi, Seita.5G134600 was found. 5UTR277+ The leaf width of the variant germplasm material was significantly wider than that of the germplasm carrying Seita.5G134600. 5UTR277- The flag leaf width of the germplasm materials is variable.

[0021] The molecular marker Seita.5G134600 of the present invention 5UTR277 The primers can be used to type the width of millet flag leaf, and this marker can be used for auxiliary selection in millet flag leaf breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1The flag leaf width phenotype of HZG and CN35 at different planting densities and the flag leaf width frequency distribution diagram of the RIL population at different planting densities; wherein, A is a photo of the flag leaves of HZG and CN35; B is the flag leaf width phenotype of HZG and CN35 at different planting densities, C is the flag leaf width frequency distribution diagram of the RIL population at different planting densities, c1 represents the flag leaf width frequency distribution diagram at E1 density in 2021, c2 represents the flag leaf width frequency distribution diagram at E1 density in 2022, c3 represents the flag leaf width frequency distribution diagram at E2 density in 2022, c4 represents the flag leaf width frequency distribution diagram at E3 density in 2022, c5 represents the flag leaf width frequency distribution diagram at E2 density in 2023, and c6 represents the flag leaf width frequency distribution diagram at E3 density in 2023.

[0023] Figure 2 The changes in flag leaf width of the parents Heizhigu and Changnong 35 and RILs under different planting densities.

[0024] Figure 3 This is the result of alignment of the parental sequences in the range 11731400 to 1731900 within the qFLW5-2 locus.

[0025] Figure 4 Mark Seita.5G134600 for InDel 5UTR277 Genotyping in the parents and some RIL populations. In the figure, 1 to 5 are 5 narrow-leaf phenotype lines (FLW = 2.00 ± 0.15 cm) randomly selected from the RIL population, and 6-10 are 5 wide-leaf phenotype lines (FLW = 3.30 ± 0.38 cm) randomly selected from the RIL population.

[0026] Figure 5 Mark Seita.5G134600 for InDel 5UTR277 The results of the correlation analysis between genotyping and leaf width traits of natural germplasm from different places; among them, A represents the correlation analysis results of leaf width traits in Shunyi, Beijing, B represents the correlation analysis results of leaf width traits in Anyang, Henan, C represents the correlation analysis results of leaf width traits in Chaoyang, Liaoning, and D represents the correlation analysis results of leaf width traits in Changzhi, Shaanxi. DETAILED DESCRIPTION

[0027] In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0028] In the description of the present invention, unless otherwise specified, all reagents used are commercially available and all methods used are conventional techniques in the art.

[0029] The present invention uses the RIL population derived from the hybridization of Heizhigu (long narrow leaves) and Changnong 35 (short wide leaves) as experimental materials. Based on the high-density genetic map constructed by whole genome resequencing, QTL positioning analysis was performed on the flag leaf width (FLW) trait of millet under three planting densities, and a stable QTL site qFLW5-2 located on chromosome 5 was obtained. InDel marker Seita.5G134600 was developed in the interval of 11731400 to 11731900 of this site. 5UTR277 This marker is closely linked to the width of the flag leaf of millet. In the RIL population, Seita.5G134600 5UTR277+ and Seita.5G134600 5UTR277- There were significant differences in flag leaf width among the lines. Among 680 germplasms from natural populations under two environmental conditions, Shunyi, Beijing and Changzhi, Shanxi, Seita.5G134600 was found. 5UTR277+ The leaf width of the mutant germplasm materials is wider than that of the germplasm carrying Seita.5G134600 5UTR277- The width of flag leaf of the germplasm material with variation. The molecular marker Seita.5G134600 of the present invention 5UTR277 The primers can be used to type the width of millet flag leaf, and this marker can be used for auxiliary selection in millet flag leaf breeding.

[0030] The nucleotide sequence of the InDel marker of the present invention is shown in SEQ ID NO.1:

[0031] TTGGGCCATGTTTAGTTACTCCCAACTCCTAACTTTGACACTATGCAAAAAGAAGATTCCCCATCACATCAAACTTGCGGTACATGCATGGAGTACTAAATGTAGATGAAATTAAAAACTAATTGCACAGTTTTGTTGT ACTTTGCGAGACGAATCTTTTGAGCCTAATTAGTCAATATTTGGACAATAATTCACAAATACAAACGAAACGCTACAGTGTGCTACAGTGCTGTAACAGTAATTTGGCACCTCCCAAATTCCCCAACTAAACAAGGCC.

[0032] The nucleotide sequence of the Seita.5G134600 gene is shown in SEQ ID NO.4:

[0033] TGCTTGTGTGAGTGACCCGTGACCGTGAGCTTCCTTCTGTTGGTGAGCTTGCTCTGCACGGCCTGAGCCCTGAGGTGAGGGAGAGAGATACTAGGGCGGTGACCATGGCATGGCGGGGCCGGCTCGGGGAGACCGCGGACAGCGGCCTCGAGCTCAGCCTTGGCCTCCCGGCCTACTTCGCCAAGACCTCATCAGGTTAGTTTTGCCAAGAACTGCTTCTTGTTT.

[0034] The nucleotide sequence of the gene of Seita.5G134600 of Changnong 35 is shown in SEQ ID NO.5:

[0035] TGCTTGTGTGAGTGACCCGTGACCGTGAGCTTCCTTCTGTTGGGCCATGTTTAGTTACTCCCAACTCCTAACTTTGACACTATGCAAAAAGAAGATTCCCCATCACATCAAACTTGCGGTACATGCATGGAGTACTAAATGTAGATGAAATTAAAAACTAATTGCACAGTTTTGTTGTACTTTGCGAGACGAATCTTTTGAGCCTAATTAGTCAATATTTGGACAATAATTCACAAATACAAACGAAACGC TACAGTGTGCTACAGTGCTGTAACAGTAATTTGGCACCTCCCAAATTCCCCAACTAAACAAGGCCTTGGTGAGCTTGCTCTGCACGGCCTGAGCCCTGAGGTGAGGGAGAGAGATACTAGGGCGG TGACCATGGCATGGCGGGGCCGGCTCGGGGAGACCGCGGACAGCGGCCTCGAGCTCAGCCTTGGCCTCCCGGCCTACTTCGCCAAGACCTCATCAGGTTAGTTTCCAAGAACTGCTTCTTGTTT.

[0036] The following is a detailed description of an InDel marker, primer set and application related to the flag leaf width trait of millet.

[0037] 1. Experimental process

[0038] 1. Construction of genetic population

[0039] The millet varieties Heizhigu and Changnong 35 with significant differences in flag leaf traits were selected as parents. Figure 1 A in the figure. The F1 generation was obtained by hybridization, and the F1 generation was self-pollinated to obtain the F2 generation segregation population. From the F2 generation, the single seed method was used for continuous self-pollination to obtain a recombinant inbred line population containing 122 strains, which was recorded as RIL-F7.

[0040] 2. Field planting, trait investigation and data analysis

[0041] The parent and RIL populations were planted in the experimental field of the Millet Research Institute of Shanxi Agricultural University in 2021, 2022 and 2023, respectively. Each line was planted in two rows, with a row length of 3m and a row spacing of 33cm. The three planting densities were 6cm (505,000 plants / hm2). 2 , E1), 9cm (337,000 plants / hm 2 , E2), 12cm (262,000 plants / hm 2 , E3) for treatment. Management and pest control were carried out in accordance with normal field production management standards. After the millet headed and the length of the sub-ear node was stable, three plants with consistent growth were selected from each strain to investigate the width of the flag leaf. Flag leaf width (FLW): the distance at the widest position of the flag leaf (cm). Office Excel 2021 and IBM SPSS Statistics 27 were used to organize the phenotypic data of the RIL population within three years and perform descriptive statistical analysis, variance homogeneity, significance test, etc., and Origin 2021 was used to draw frequency distribution histograms and correlation analysis diagrams.

[0042] 3. Field sampling and leaf DNA extraction

[0043] In the experimental field, leaves from three parents and each strain in the RIL population were mixed and placed in centrifuge tubes with corresponding numbers, stored in liquid nitrogen, and DNA was extracted using a modified version of the SDS method.

[0044] 4. 8% non-denaturing polyacrylamide gel electrophoresis

[0045] The specific steps are as follows:

[0046] Place the cleaned glass plate and ear plate in order, wipe them clean with anhydrous ethanol. After drying, put the two plates together, align them, fix them with clamps, and place them flat on the table to observe whether the plates are level.

[0047] Prepare the working solution: prepare the polyacrylamide gel working solution in the ratio of 40% acrylamide (Acr:Bis=39:1):5×TBE:deionized water=1:1:3.

[0048] Bottom sealing: In a fume hood, add 35 mL of working solution, 350 μL of 10% APS, and 20 μL of TEMED into a conical flask and shake well. Then pour it into the groove of the foam board, put the fixed board vertically into the groove and let it stand for 3 seconds to allow the liquid to soak into the bottom between the two boards, then take it out and wait for solidification.

[0049] Glue filling: Add 90mL working solution, 900μL 10% APS, and 70μL TEMED to a conical flask in a fume hood, shake well, and then fill with glue. After the glue is filled, insert an appropriate comb immediately to check whether there are bubbles between the two plates. If there are, place the plate vertically on the table and tap it up and down several times to make the bubbles float out. After completion, place it flat on the table until the glue solidifies.

[0050] Loading the plate: Pull out the comb and remove the clips, clean the impurities on the plate, and then put it into the electrophoresis tank to fix it.

[0051] Sample loading: Add sufficient 1×TBE electrode buffer into the electrophoresis tank, and add the marker and 2 μL PCR amplification product into the sample wells in sequence.

[0052] Electrophoresis: Adjust the voltage of the electrophoresis instrument to 120V, current to 100mA, power to 50W, and time to about 1.5h, until bromophenol blue approaches the bottom of the plate.

[0053] After the PCR amplification products are separated by electrophoresis, silver staining is used for detection:

[0054] After the electrophoresis is completed, remove the gel plate, pry the two plates apart, and quickly rinse the gel in a basin filled with deionized water for about 8 to 10 seconds. Place the gel block in a 0.1wt% silver nitrate solution for staining for 10 minutes; after the silver staining is completed, quickly rinse it with deionized water for about 8 to 10 seconds. Add a developer prepared from 1L deionized water, 20gNaOH, 5gNa2CO3 and 750μL formaldehyde, place it on a shaker in a fume hood, and shake it continuously until the DNA bands are clearly visible. After the staining is completed, quickly rinse the gel block twice with deionized water again, remove it and take a picture.

[0055] 5. Whole genome resequencing and construction of high-density genetic maps

[0056] The DNA of the parents and each strain of the RIL population was extracted and then quality tested. After passing the quality test, it was sent to Shijiazhuang Boredy Biotechnology Co., Ltd. for subsequent library construction and high-throughput sequencing. The genetic map was constructed using the mstmap function in the R package ASMap.

[0057] 6. QTL location analysis

[0058] The composite interval mapping method (CIM) in the software Windows QTL Cartographer V2.5 was used to locate and analyze QTLs for the four flag leaf traits of the RIL population. Parameter settings: Model 6: Standard Model and Forward & Backward Method were selected, the number of permutations was 1000, the number of control markers and the window size were set to 5 and 10 cM, the LOD threshold was set to 2.5, and the rest remained unchanged. When the LOD value was ≥ 2.5, it was considered that there might be a QTL in the interval.

[0059] 7. Single marker analysis

[0060] Single marker analysis refers to the statistical analysis of the average values ​​of a quantitative trait under different genotypes of the same molecular marker. If there is a significant difference between the average values, it indicates that the QTL and the molecular marker are closely linked. The tighter the linkage between the marker and the QTL, the greater the difference in quantitative traits between genotypes and the higher the significance. According to the millet reference genome sequence and the results of whole genome resequencing of parents, the difference sites between parents were searched within the QTL positioning interval of flag leaf width, and sites with a difference of more than 10 bp were given priority. The NCBI website (https: / / www.ncbi.nlm.nih.gov / ) was used to retrieve the upstream and downstream 300 bp sequences of the corresponding sites, and the Primer3.0 (http: / / primer3.ut.ee / ) online website was used to design primers.

[0061] 8. Genotype detection of RIL population

[0062] The newly designed primers were used to screen for polymorphism between Heizhigu and Changnong No. 35, and the polymorphic primers obtained by screening were used to detect the genotypes of each strain in the RIL population (2023 F9 generation). Leaves from 5 individual plants were randomly selected for each strain and mixed, amplified using the Super Lightning Mix (LP800) of Beijing Jinbaite Biotechnology Co., Ltd. and detected by 8% non-denaturing polyacrylamide gel electrophoresis. Super Lightning Mix (LP800) contains three components: nucleic acid releaser (lysis solution), lightning mix (2×PCRmix), and ddH2O. The product does not require the extraction of genomic DNA. The lysis solution can quickly lyse animal and plant tissue cell samples and release DNA as a template for PCR amplification. The specific operation steps are as follows:

[0063] DNA extraction: put the mixed leaves into a 2.0ml centrifuge tube and add steel beads, put it into liquid nitrogen for quick freezing, and then use a grinder to grind it into powder; pour out the steel beads in the tube and add 30μL of nucleic acid release agent, put it into a centrifuge and centrifuge it at 12000rpm for 1-3min. If the nucleic acid release agent precipitates, dissolve it at 37℃ and use it after clarification. The dosage can also be adjusted according to needs; put the centrifuge tube with nucleic acid release agent into boiling water and boil it for 3-5min; after boiling, put the centrifuge tube into a centrifuge and centrifuge it at 12000rpm for 3min; then absorb all the liquid in the tube into a new 1.5ml centrifuge tube, put the new 1.5ml centrifuge tube into the centrifuge again and centrifuge it at 12000rpm for 5min, then absorb the supernatant into the PCR plate, add 50μL ddH2O to dilute it, and store it at -20℃. When taking it out as a template again, centrifuge it at 12000rpm for 8min to take 2μL of supernatant as PCR template. The PCR reaction system (operation on ice) is shown in Table 1.

[0064] Table 1 PCR reaction system

[0065] Reaction components Reaction volume (10 μL) TemplateDNA 1μL Primers:F+R 1.5μL 2×PCRmix 5μL <![CDATA[ddH2O]]> 2.5μL

[0066] The PCR reaction program is shown in Table 2.

[0067] Table 2 PCR reaction program

[0068]

[0069] PCR primer sets are shown in Table 3.

[0070] Table 3 PCR primer sets

[0071] Primers sequence serial number Upstream primer 5'-AGTGACCCGTGACCGTGAG-3' SEQ ID NO.2 Downstream primer 5'-AGTGACCCGTGACCGTGAG-3' SEQ ID NO.3

[0072] The present invention uses 8wt% non-denaturing polyacrylamide gel to perform electrophoresis separation on the PCR amplification product and performs silver staining detection. Using Excel statistical gel graph, when the band position is consistent with the black branch valley band position, it is recorded as "A", when it is consistent with the Changnong No. 35 band position, it is recorded as "B", when the two bands appear at the same time, it is recorded as "H", and when the target band is missing or unclear, it is recorded as "-".

[0073] 9. Transcriptome differential analysis and candidate gene mining of foxtail millet flag leaves

[0074] The experiment used Heizhigu and Changnong 35 as materials. The flag leaves of Heizhigu and Changnong 35 were measured and sampled at the heading stage (HD) and the filling stage (GF). The sampling time was 9 o'clock in the morning, and the sampling site was the widest position in the middle of the flag leaf. Three millet plants with relatively consistent growth were randomly selected for each variety as three replicates. After sampling, they were quickly placed in an insulated bucket filled with liquid nitrogen and brought back to the laboratory. After being frozen by liquid nitrogen, they were placed in an ultra-low temperature refrigerator. The experimental samples were packaged and sent to Beijing Biomike Biotechnology Co., Ltd. to complete RNA extraction and quality inspection, library construction and quality inspection, high-throughput sequencing, etc. The sequencing platform was Illumina, and the sequencing mode was PE150. Genes with significant differences in gene expression levels in different samples are called differentially expressed genes (DEGs). DEGs were screened using DESeq2_edgeR software, and the screening criteria were: FoldChange≥2 and FDR<0.05. All the DEGs screened out were analyzed by hierarchical clustering, and the genes with the same or similar expression patterns in each sample were clustered and heat maps were drawn. DEGs can be divided into up-regulated genes and down-regulated genes according to their expression levels in the two groups, and the two are relative. The number of up-regulated and down-regulated DEGs in each comparison group was counted and a chart was drawn.

[0075] Based on RNA-seq data, differentially expressed genes were analyzed in the target interval. Then, candidate genes controlling leaf width were inferred based on gene function annotation, WGCNA and gene expression pattern analysis. The sequences of candidate genes were obtained through Phytozome data (https: / / phytozome-next.jgi.doe.gov / ) and primers were designed for amplification.

[0076] 2. Experimental Results

[0077] 1. Construction of high-density genetic map

[0078] With Heizhigu as the female parent and Changnong 35 as the male parent, the recombinant inbred lines containing 122 strains were resequenced, and a high-density genetic map containing 3795 Bin markers, a total map distance of 3164.72cM, and an average map distance of 0.88cM was constructed.

[0079] 2. Flag leaf width traits of parents and RIL populations under different planting density environments

[0080] The width of the flag leaf of the parents Heizhigu and Changnong 35 showed extremely significant differences under the six environmental conditions. Figure 1As shown in B, in the RIL population, the average values ​​of each trait in different environments are basically between the two parents, and the coefficient of variation is above 10.00%, with the highest reaching 20.82%. In addition, the absolute values ​​of the skewness and kurtosis of each trait in different environments are less than 1, which can be approximately considered to conform to the normal distribution. The population frequency distribution diagram also shows that the flag leaf width trait is continuously distributed in different environments, such as Figure 1 As shown in C. In summary, the flag leaf width trait is a quantitative trait, which is controlled by multiple genes and is easily affected by the environment.

[0081] As the planting density increased, the flag leaf width of Changnong 35 decreased, and there were significant differences among the three planting densities; however, under the three density conditions, there was no significant difference in the flag leaf width of Heizhigu, and there was a significant difference in the flag leaf width of RILs between E1 and E2, such as Figure 2 This indicates that the flag leaf width trait is affected by genetic and environmental factors.

[0082] 3. QTL positioning of flag leaf width under different planting density environments

[0083] Based on the high-density genetic map constructed by resequencing of RIL population, combined with the phenotypic data of flag leaf traits of RIL population under multi-year and multi-density conditions, the composite interval mapping method of WinQTLCartV2.5 was used to detect QTL for flag leaf width, and the results are shown in Table 4. A total of 10 QTLs related to flag leaf width in millet were located on chromosomes 3, 5, 6, and 8, respectively, with LOD values ​​ranging from 2.75 to 4.92, contribution rates ranging from 7.73% to 15.22%, and additive effects ranging from -0.23 to 0.22, as shown in Table 3. Among them, there are 6 major QTLs in the mapping interval of qFLW5-2. qFLW3-1 and qFLW3-2 are located in the intervals of 23.15Mb to 26.94Mb and 45.01Mb to 45.42Mb on chromosome 3, respectively, with phenotypic variation contribution rates of 10.30% and 14.01%. qFLW5-1 and qFLW5-3 were located at 5.91Mb-6.12Mb and 34.55Mb-34.95Mb on chromosome 5, explaining 12.25% and 11.26% of phenotypic variation, with LOD values ​​of 4.15 and 3.49, respectively. The enhancing alleles were derived from Changnong 35. qFLW8 and qFLW9 were located at 37.64Mb-37.91Mb and 14.43Mb-15.90Mb on chromosomes 8 and 9, respectively, explaining 11.69% and 15.22% of phenotypic variation, with LOD values ​​of 3.91 and 4.89, and additive effect values ​​of 0.22 and -0.21, respectively. The enhancing alleles were derived from Heizhigu and Changnong 35, respectively. At the same time, qFLW3-2 and qFLA3-2, qFLW6-1 and qFLR6-1, qFLW6-2 and qFLR6-3 all have co-location, and one interval contains QTLs controlling different traits.

[0084] Table 4 QTL location of flag leaf width in RIL population

[0085]

[0086] 4. Single marker analysis

[0087] The two QTL loci qFLW9 and qFLW3-2 that explained the highest phenotypic variation, the repeatedly detected loci qFLW6-2, and qFLW5-2 that partially overlapped with the loci reported by previous researchers were selected for single marker analysis. The results showed that compared with other intervals, the markers in the qFLW5-2 interval were more closely linked to the leaf width phenotypic traits. Therefore, qFLW5-2 may be a key locus controlling millet leaf width.

[0088] 5. RNA-seq combined with QTL positioning to predict candidate genes

[0089] Heading stage (HD) and grain filling stage (GF) are two key periods of millet growth and development. The width of the flag leaf of Heizhigu and Changnong 35 showed extremely significant differences at the heading stage and the grain filling stage, so we selected these two periods for transcriptome analysis. Comprehensive resequencing data, transcriptome data and WGCNA analysis suggest that Seita.5G134600 is likely to be a candidate gene for qFLW5-2. According to gene annotation, the protein encoded by the Seita.5G134600 gene belongs to the AUX / IAA family.

[0090] 6. Development and application of tightly linked InDel markers for flag leaf width

[0091] The results of sequence comparison of Seita.5G134600 gene in Heizhigu and Changnong 35 showed that compared with Changnong 35, Heizhigu had a 277bp deletion in the 5'UTR (located -66bp upstream of the start codon ATG). Figure 3 As shown, an InDel marker Seita.5G134600 was developed at the deletion site Chr.5: 11731400-11731900 5UTR277 , and verified in the parent and RIL populations. The results showed that the genotype of the randomly selected wide-leaf phenotype strain (3.30±0.38) in the RIL population was consistent with that of Changnong 35, and the genotype of the narrow-leaf phenotype strain (2.00±0.15) was consistent with that of Heizhigu. Figure 4 In addition, 680 germplasms from natural populations under two environmental conditions in Shunyi, Beijing and Changzhi, Shanxi, carried Seita.5G134600 5UTR277+ The leaf width of the mutant germplasm materials is wider than that of the germplasm carrying Seita.5G134600 5UTR277- The original data of flag leaf width of variant germplasm materials come from the comprehensive millet database Setaria-db, such as Figure 5 It was inferred that the 277 bp deletion in the 5'UTR region of the gene was the cause of the difference in flag leaf width between the parents.

[0092] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0093] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. An InDel marker related to the flag leaf width trait of millet, characterized in that: The nucleotide sequence of the InDel marker is shown in SEQ ID NO.

1.

2. A primer set for amplifying the InDel marker related to the flag leaf width trait of millet according to claim 1, characterized in that: The primer set consists of an upstream primer with a nucleotide sequence such as SEQ ID NO.2 and a downstream primer with a nucleotide sequence such as SEQ ID NO.

3.

3. A reagent kit, characterized in that: The kit comprises the primer set according to claim 2.

4. The kit according to claim 2, characterized in that The kit also includes reagents for PCR amplification.

5. Use of the kit according to claim 3 or 4 in identifying flag leaf traits of millet.

6. A method for identifying the flag leaf width trait of millet, characterized in that: The following steps are involved: Using the millet gene DNA to be identified as a template, using the primer set described in claim 2 to perform PCR amplification, detecting whether the amplified product contains a gene fragment with a sequence such as SEQ ID NO.1, and determining whether the millet flag leaf is a wide trait or a narrow trait; If the amplified product of the millet to be identified contains the gene fragment shown in SEQ ID NO.1, the flag leaf of the millet is a wide trait; If the amplified product of the millet to be identified does not contain the gene fragment of SEQ ID NO.1, the millet flag leaf has a narrow trait.

7. Use of the InDel marker according to claim 1 in the prediction of the flag leaf width trait of millet or in the molecular-assisted screening breeding of millet.

8. Use of the primer set according to claim 2 in the prediction of millet flag leaf width trait or in millet molecular-assisted screening and breeding.

Images