PARMS molecular marker related to drought tolerance and lateral root length of corn and application of PARMS molecular marker

Abstract

The invention discloses a PARMS molecular marker related to drought tolerance and lateral root length of corn and application of the PARMS molecular marker. The nucleotide sequences of upstream and downstream 150bp of the molecular marker are as shown in SEQ ID NO.6. The nucleotide sequences of a primer group for detecting the PARMS molecular marker are as shown in SEQ ID NO. 1 to SEQ ID NO. 3. The invention successfully develops the molecular marker based on the natural variation of the 3 'UTR region of the corn ZmbZIP89 (Zm00001eb238570) gene, and the marker is obviously related to the length and drought tolerance of the corn lateral root, and can accurately, efficiently and stably distinguish the InDel + genotype from the InDel-genotype. The molecular marker can be widely applied to high-throughput screening and molecular marker-assisted breeding of drought-enduring corn germplasm resources, and provides important technical support and theoretical basis for cultivating new varieties of high-yield, stable-yield and drought-enduring corn.

Description

Technical Field

[0001] The present invention relates to the field of corn genetic breeding, and in particular to a PARMS molecular marker related to corn drought resistance and lateral root length and an application thereof. Background Art

[0002] Maize (Zea mays L.) is one of the most important food crops worldwide, providing a vital food source for humans and animals and an industrial raw material. However, maize yield and quality are susceptible to a variety of environmental factors, with drought being one of the most significant abiotic stresses. Global climate change is leading to increasing frequency and intensity of droughts, posing a serious threat to maize production and food security. Therefore, developing new drought-tolerant maize varieties is crucial for ensuring food security and sustainable agricultural development.

[0003] Plant drought tolerance is a complex quantitative trait that is regulated by multiple genes and is also affected by environmental factors. The root system is the main organ for plants to absorb water and nutrients, and its morphological structure and physiological function are closely related to the drought tolerance of plants. The corn root system consists of radicle, primary root and secondary roots (including lateral roots and crown roots), of which lateral roots account for the largest proportion in the root system and play a key role in the absorption of water and nutrients by corn. Studies have shown that the length and number of lateral roots are positively correlated with the drought tolerance of corn. Therefore, in-depth research on the molecular mechanism of corn lateral root development and the discovery of genetic resources related to drought tolerance are of great significance for the breeding of new drought-tolerant corn varieties.

[0004] In recent years, with the rapid development of molecular biology and genomics technologies, marker-assisted selection (MAS) has become an important tool for crop genetic improvement. MAS utilizes molecular markers closely linked to target traits to indirectly select for target genotypes, improving breeding efficiency and shortening breeding cycles. PARMS (Penta-primer amplification refractory mutation system) is a SNP PCR analysis technique that combines a pair of universal fluorescent primers, a pair of SNP allele-specific primers, and a common reverse primer. It allows for rapid and simple SNP allele genotyping and has been widely used in crop genotyping, marker-assisted selection, and gene mapping.

[0005] Although some studies have reported on genes associated with drought tolerance in maize, the number of known drought-tolerance genes remains limited, and their mechanisms of action in drought tolerance are not fully understood. Furthermore, existing molecular markers have limited correlation with drought-tolerance traits, limiting their application in maize drought-tolerance breeding. Therefore, there is an urgent need to develop stable and reliable molecular markers that are tightly linked to maize drought-tolerance traits and to apply them to maize drought-tolerance breeding practices. Summary of the Invention

[0006] To address the limited association between existing molecular markers and maize drought tolerance and lateral root length, the present invention provides a PARMS molecular marker based on natural variation in the 3'UTR region of the maize ZmbZIP89 (Zm00001eb238570) gene and its application in maize drought tolerance breeding. ZmbZIP89 (Zm00001eb238570) is located on chromosome 5 of maize and is physically located at Chr5:146731728-146734223 on the maize B73 reference genome, Zm-B73-REFERENCE-NAM-5.0.

[0007] In order to achieve the above object, the present invention provides a PARMS molecular marker related to drought tolerance and lateral root length in maize. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.6. The physical location of the marker is located in Chr5:146732098 of the B73 reference genome (Zm-B73-REFERENCE-NAM-5.0), InDel - The base of the genotype at this position is C-----, InDel + The genotype base at this position is CAACAC.

[0008] SEQ ID NO.6:

[0009] AGCAGCAGATCAAGGTGGCCACCACCGGCGGCGCCGACATCGCCGCGGC

[0010] CGCCTCCATGCAGGCCAGGCAAGAGCTGCTCGCGTGCGAGGGCGCTGCC

[0011] ATTCGATAGCAGATCGAGGGCGGAGGCGTTCAATTGGCAGTGCCACAACA

[0012] ACCAGCACCGAACTTTGTGCCGGGTTCCTCCTTTTCCAGACAAGTTGTT

[0013] CGTCGTGCGTGCAAATACACGCGCCTGTTATTAGCCTATTGATTTTATTTCTGTGCAGTCTTAATTAATTCGTATATGTGATGTATTCCTCCTCTTCGTCCC.

[0014] A second aspect of the present invention provides a primer set for detecting the above-mentioned PARMS molecular marker, which is developed based on the maize lateral root length gene ZmbZIP89 (Zm00001eb238570), and includes a forward competitive primer ZmbZIP89-INDEL1341-F1 with a nucleotide sequence as shown in SEQ ID NO.1, a forward competitive primer ZmbZIP89-INDEL1341-F2 with a nucleotide sequence as shown in SEQ ID NO.2, and a reverse universal primer ZmbZIP89-INDEL1341-R with a nucleotide sequence as shown in SEQ ID NO.3.

[0015] A third aspect of the present invention provides a kit for detecting the above-mentioned PARMS molecular marker, wherein the kit comprises the above-mentioned primer set.

[0016] A fourth aspect of the present invention provides use of the above primer set or kit in detecting drought tolerance and lateral root length of corn.

[0017] A fifth aspect of the present invention provides a method for detecting drought tolerance and lateral root length of corn, comprising the following steps:

[0018] A FAM fluorescent probe tag (its nucleotide sequence is shown in SEQ ID NO. 4) was connected to the 5' end of the above-mentioned ZmbZIP89-INDEL1341-F1, and a HEX fluorescent probe tag (its nucleotide sequence is shown in SEQ ID NO. 5) was connected to the 5' end of the ZmbZIP89-INDEL1341-F2. The genomic DNA of the maize to be tested was used as a template and the primer set was used to perform fluorescence quantitative PCR amplification. The amplified products were then scanned for fluorescence signals, and genotyping of the maize material to be tested was performed based on the fluorescence signals:

[0019] If the tested maize material has the fluorescent probe signal of the forward primer ZmbZIP89-INDEL1341-F1 in the primer set (the sample with fluorescence aggregation close to the X-axis and displayed in blue), but does not contain the fluorescent probe signal of the forward primer ZmbZIP89-INDEL1341-F2, then the tested maize material does not contain the maize drought tolerance and lateral root length QTL site, which is InDel - genotype;

[0020] If the maize material to be tested has the fluorescent probe signal of the forward primer ZmbZIP89-INDEL1341-F2 in the primer set (fluorescence aggregates close to the Y axis and displays green), but does not contain the fluorescent probe signal of the forward primer ZmbZIP89-INDEL1341-F1, then the maize material to be tested contains the maize drought tolerance and lateral root length QTL site, which is recorded as InDel + genotype;

[0021] InDel - The drought tolerance and lateral root length of maize genotype lines were significantly higher than those of InDel + Genotypes of maize lines.

[0022] Specifically,

[0023] The PCR amplification reaction system was as follows: 10–100 ng DNA template, 0.15 μL ZmbZIP89-INDEL1341-F1, 0.15 μL ZmbZIP89-INDEL1341-F2, 0.4 μL ZmbZIP89-INDEL1341-R, 5 μL 2× PARMS master mix (Wuhan Jingpeptide), and ddH O to make up to 10 μL;

[0024] The PCR amplification reaction conditions were as follows: 1) heat activation at 94°C for 20 min; 2) denaturation at 94°C for 20 s, annealing and extension at 65–57°C for 60 s, and 10 touch-down cycles, with the temperature decreasing by 0.8°C each cycle; 3) denaturation at 94°C for 20 s and annealing at 57°C for 60 s, for 32 cycles.

[0025] Through the above technical solution, the present invention achieves the following beneficial effects:

[0026] 1) Using this molecular marker, InDels can be identified quickly and accurately - 1) The genotype of maize germplasm resources provides excellent genetic resources for maize drought tolerance breeding. 2) This molecular marker can be used to track the distribution and transmission pattern of InDel variation in the 3'UTR region of ZmbZIP89 in maize genetic populations, providing a powerful tool for in-depth study of its genetic mechanism in maize lateral root development and drought tolerance formation. 3) This molecular marker can be applied to maize breeding practice to identify InDel - Genotypes can be introduced into superior corn varieties to improve their drought tolerance and accelerate the development of new drought-tolerant corn varieties. 4) This molecular marker can be combined with molecular markers of other drought-tolerant genes to construct a molecular breeding technology system for corn drought tolerance, achieving precise improvement of corn drought tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1The positions of InDel variant sites (A) and sequence differences between different genotypes (B) are shown. Circles and triangles represent SNPs and InDels, respectively.

[0028] Figure 2 InDel + and InDel - Different phenotypes of genotypes under drought stress;

[0029] Figure 3 InDel + and InDel - Comparison of lateral root length among genotypes;

[0030] Figure 4 InDel + and InDel - differences in survival rates among genotypes under drought stress;

[0031] Figure 5 InDel + and InDel - Comparison of physiological indicators of genotypes under drought stress, including: (A) InDel under drought treatment 15 days after planting + (n=15) and InDel - Statistical analysis of stem dry weight (SDW) of (n=15); (B) InDel under drought treatment 15 days after planting + (n=15) and InDel - Statistical analysis of photosynthetic rate (PS) of (n=15); (C) InDel under drought treatment 15 days after planting + (n=15) and InDel - Statistical analysis of stomatal conductance (SC) of (n=15); (D) InDel under drought treatment 15 days after planting + (n=15) and InDel - Statistical analysis of water use efficiency (WUE) of (n=15);

[0032] Figure 6 It is the genotyping result of molecular markers in maize inbred line population. DETAILED DESCRIPTION

[0033] The following is a detailed description of the specific embodiments of the present invention. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the present invention.

[0034] Example 1 Verification of candidate genes

[0035] 164 maize inbred lines were selected for association analysis, and 10 variants significantly associated with the expression of ZmbZIP89 were obtained. Six variants within the 3'UTR showed complete linkage disequilibrium, forming two different haplotype groups in the maize inbred lines (such as Figure 1 Carry InDel - The germplasm ratio of alleles carrying InDel + The germplasm with the allele had a higher expression level (p = 9.60 × 10 -6 ) and longer lateral root length (p = 1.70 × 10 -5 ), suggesting that these variations may affect gene expression and lateral root length ( Figure 3 ). To further evaluate the InDel + and InDel - drought resistance, we have + and InDel - The survival rate and physiological indices under drought stress were analyzed. Figure 2 、 Figure 4 and 5 As shown, with InDel + Compared with the inbred lines of - The inbred lines showed higher survival rate, photosynthetic rate (PS), stomatal conductance (SC) and water use efficiency (WUE).

[0036] Example 2 Application of PARMS Molecular Markers

[0037] 1. Development of PARMS molecular markers

[0038] Based on the indel variant in the 3'UTR region of the ZmbZIP89 gene, a primer set was designed, including a pair of forward primers labeled with FAM and HEX fluorescent markers, and a reverse primer. The two upstream primers were designated ZmbZIP89-INDEL1341-F1 and ZmbZIP89-INDEL1341-F2, respectively, and the downstream primer was designated ZmbZIP89-INDEL1341-R. The developed PARMS molecular marker was designated ZmbZIP89-INDEL1341. The nucleotide sequences of the three primers are as follows:

[0039] ZmbZIP89-INDEL1341-F1(SEQ ID NO.1):

[0040] 5'-GAAGGTGACCAAGTTCATGCTTGGCAGTGCCACAACAACC-3';

[0041] ZmbZIP89-INDEL1341-F2(SEQ ID NO.2):

[0042] 5'-GAAGGTCGGAGTCAACGGATTTGGCAGTGCCACAACAACA-3';

[0043] ZmbZIP89-INDEL1341-R(SEQ ID NO.3):

[0044] 5′-CCGGCACAAAGTTCGGTG-3′.

[0045] In order to detect the PCR amplification product using a fluorescence reader, the upstream primer

[0046] The 5' end of ZmbZIP89-INDEL1341-F1 is conjugated to a FAM fluorescent group, and the 5' end of the upstream primer ZmbZIP89-INDEL1341-F2 is conjugated to a HEX fluorescent group. The nucleotide sequence of the fluorescent probe tag is as follows:

[0047] FAM fluorescent probe tag (SEQ ID NO.4):

[0048] 5'-GAAGGTGACCAAGTTCATGCT-3';

[0049] HEX fluorescent probe tag (SEQ ID NO.5):

[0050] 5'-GAAGGTCGGAGTCAACGGATT-3'.

[0051] 2. Identification of InDel site genotype

[0052] Molecular markers were used to identify the genotypes of the InDel sites (ZmbZIP89-INDEL1341) of 164 natural population materials. The specific steps include:

[0053] (1) PCR amplification

[0054] (i) DNA of the maize varieties to be tested was amplified by PCR to obtain PCR products. The PCR amplification system was as follows: 10-100 ng DNA template, 0.15 μL ZmbZIP89-INDEL1341-F1, 0.15 μL ZmbZIP89-INDEL1341-F2, 0.4 μL ZmbZIP89-INDEL1341-R, 5 μL 2× PARMS master mix (Wuhan Jingpeptide), and ddH2O was added to 10 μL.

[0055] (ii) PCR amplification reaction conditions were as follows: 1) heat activation at 94°C for 20 min; 2) denaturation at 94°C for 20 s, annealing and extension at 65–57°C for 60 s, and 10 touch-down cycles, with the temperature decreasing by 0.8°C each cycle; 3) denaturation at 94°C for 20 s and annealing at 57°C for 60 s, for 32 cycles.

[0056] (2) Genotyping

[0057] After PCR is completed, the fluorescence signal is read using a TECAN infinite M1000 microplate reader, and then the online software snpdecoder is used to parse and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and the genotype results are output according to different colors.

[0058] The results showed that the ZmbZIP89-INDEL1341 site-specific primer was connected to the HEX fluorescent group, which was green in the test results, indicating the inserted base, which was InDel + The ZmbZIP89-INDEL1341 site-specific primer is connected to the FAM fluorescent group, which is blue in the test results, indicating the missing base, which is InDel - The red color on the genotype chart indicates heterozygosity. Figure 6 and as shown in Table 1.

[0059] Table 1 Genotypes and phenotypes of the tested strains in the maize inbred line population

[0060]

[0061]

[0062]

[0063] Note: NA means missing data

[0064] Statistical analysis was performed using SPSS 19.0. + 、InDel - Genotype, and the lateral root length phenotypic data of the two genotype materials respectively, the results showed that the InDel - The lateral root length of maize genotypes is greater than that of those carrying InDel + Genotype type of maize lateral root length ( Figure 3 ).

[0065] Statistical analysis (t-test) further showed that the short lateral root genotype (InDel + genotype) and long lateral root genotype (InDel - The phenotypic differences among the genotypes were extremely significant (Table 2).

[0066] Table 2 Statistical analysis results of genotype-phenotype of tested strains in maize inbred line population

[0067]

[0068] Note: * indicates a difference at a significance level of 0.05, and ** indicates a difference at a significance level of 0.01.

[0069] The present invention has successfully developed a molecular marker based on the natural variation of the 3'UTR region of the maize ZmbZIP89 gene. This marker is significantly correlated with maize lateral root length and drought tolerance traits, and can accurately, efficiently and stably distinguish InDel + Genotype and InDel - Genotype. This molecular marker can be widely used in high-throughput screening of drought-tolerant maize germplasm resources, functional research on drought-resistant genes, and molecular marker-assisted breeding, providing important technical support and theoretical basis for breeding new high-yield, stable-yield, drought-tolerant maize varieties. This invention not only provides a new molecular tool for genetic improvement of maize drought tolerance, but also offers a new perspective for a deeper understanding of the molecular mechanisms of maize response to drought stress.

[0070] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0071] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0072] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A PARMS molecular marker related to drought tolerance and lateral root length in maize, the molecular marker is based on natural variation in the 3'UTR region of the maize ZmbZIP89 gene, characterized in that: The ZmbZIP89 is located on chromosome 5 of maize, and its physical position on the maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0 is Chr5:146731728-146734223. The nucleotide sequence of 150 bp upstream and downstream of the molecular marker is shown in SEQ ID NO.

6. The physical position of the marker is located at Chr5:146732098 of the maize B73 reference genome, InDel - The base at this position of the genotype is C-----, InDel + The genotype base at this position is CAACAC.

2. A primer set for detecting the PARMS molecular marker according to claim 1, characterized in that: The primer set includes a forward competitive primer ZmbZIP89-INDEL1341-F1 with a nucleotide sequence as shown in SEQ ID NO.1, a forward competitive primer ZmbZIP89-INDEL1341-F2 with a nucleotide sequence as shown in SEQ ID NO.2, and a reverse universal primer ZmbZIP89-INDEL1341-R with a nucleotide sequence as shown in SEQ ID NO.

3.

3. A kit for detecting the PARMS molecular marker according to claim 1, characterized in that: Comprising the primer set of claim 2.

4. Use of the primer set according to claim 2 or the kit according to claim 3 in detecting drought tolerance and lateral root length of corn.

5. A method for detecting drought tolerance and lateral root length of corn, characterized in that: The steps include: The 5' end of ZmbZIP89-INDEL1341-F1 of claim 2 is connected to a FAM fluorescent probe label, and the 5' end of ZmbZIP89-INDEL1341-F2 is connected to a HEX fluorescent probe label, and the genomic DNA of the corn to be tested is used as a template, and the primer set is used to perform fluorescent quantitative PCR amplification, and then the amplified product is scanned for fluorescent signals, and the corn material to be tested is genotyped according to the fluorescent signals: If the maize to be tested shows the fluorescence signal of the forward competitive primer ZmbZIP89-INDEL1341-F1, but does not show the fluorescence signal of the forward competitive primer ZmbZIP89-INDEL1341-F2, the maize is recorded as InDel - Genotype; if the tested corn shows the fluorescent signal of the forward competitive primer ZmbZIP89-INDEL1341-F2, but does not show the fluorescent signal of the forward competitive primer ZmbZIP89-INDEL1341-F1, the corn material is recorded as InDel + genotype InDel - The drought tolerance and lateral root length of maize lines of the genotype were significantly higher than those of InDel + Genotypes of maize lines.

6. The method according to claim 5, characterized in that The PCR amplification reaction system was as follows: 10-100 ng DNA template, 0.15 μL ZmbZIP89-INDEL1341-F1, 0.15 μL ZmbZIP89-INDEL1341-F2, 0.4 μL ZmbZIP89-INDEL1341-R, 5 μL 2× PARMS master mix, and ddH2O to make up to 10 μL; The PCR amplification reaction conditions were as follows: 1) heat activation at 94°C for 20 min; 2) denaturation at 94°C for 20 s, annealing and extension at 65-57°C for 60 s, and 10 touch-down cycles, with the temperature decreasing by 0.8°C each cycle; 3) denaturation at 94°C for 20 s, annealing at 57°C for 60 s, and 32 cycles.

Images