Specific primer group for identification of cotton seeds of Stetei cotton and grey white cotton and application of specific primer group for identification of cotton seeds of Stetei cotton and grey white cotton

Abstract

The invention discloses a specific primer group for cotton seed identification of Stetei cotton and grey white cotton and application of the specific primer group, and belongs to the field of molecular biology. The specific primer group for identifying the cotton seeds of the stetti cotton and the grey white cotton is composed of a first specific primer and a second specific primer. The first specific primer can specifically identify diploid E genome grey cotton seeds and other E genome cotton seeds, and can also distinguish and identify AD tetraploid genome cotton seeds and other genome cotton seeds. And the second specific primer is used for identifying the effectiveness of the 34 cotton genome cotton seeds and identifying the C genome Stetti cotton seed. The specific primer group provided by the invention can be used for rapidly identifying a cotton seed containing C genome Stetetai cotton, a cotton seed containing E genome grey white cotton and / or a cotton seed containing AD genome, and solves the problem of DNA confusion of the cotton seed containing C genome Stetetai cotton, the cotton seed containing E genome grey white cotton and / or a tetraploid cotton seed containing AD genome with other genome cotton seeds.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a specific primer set and application thereof for identifying diploid C genome Sterti cotton species, diploid E genome gray cotton species and / or tetraploid AD genome cotton species. Background Art

[0002] PCR (polymerase chain reaction) technology is the core of molecular marker technology. It amplifies target DNA fragments through specific primers to detect specific genes or genomes. In recent years, molecular marker methods based on PCR technology have been widely used in cotton variety identification. For example, studies on cotton variety identification using SSR markers have shown that SSR markers can effectively distinguish different cotton species. The PCR principle follows three stages: denaturation, annealing, and extension: (1) Denaturation of template DNA: After the template DNA is heated to about 94-95°C for a certain period of time, the double-stranded template DNA or the double-stranded DNA formed by PCR amplification is dissociated to become a single strand so that it can bind to the primer and prepare for the next round of reaction; (2) Annealing (renaturation) of template DNA and primer: After the template DNA is heated and denatured into a single strand, the temperature is reduced to about 55-65°C (adjusted according to the primer Tm value), and the primer and the complementary sequence of the template DNA single strand are paired and bound; (3) Primer extension: The DNA template-primer complex is heated at 72°C and under the action of DNA polymerase (such as TaqDNA polymerase), with dNTP as the reaction raw material and the target sequence as the template, according to the principle of base complementary pairing and semi-conservative replication, a new semi-conservative replication chain complementary to the template DNA chain is synthesized.

[0003] cotton( Gossypium spp. As one of the most important economic crops in the world, cotton is widely planted and has many varieties. According to the different genomes, cotton is mainly divided into two categories: diploid (2n=2×=26, A, B, C, D, E, F, G, K chromosome type) and tetraploid (2n=4×=52, AD1~AD7). Among them, diploid C genome Sterti cotton, diploid E genome gray cotton and tetraploid AD genome cotton play an important role in cotton genetic diversity and fiber quality. Therefore, accurate identification of these cotton varieties is of vital importance for cotton breeding, production and trade.

[0004] At present, although there have been some studies and patent reports on cotton genome identification, the specific primers and PCR identification methods for diploid E genome gray-white cotton and tetraploid AD genome cotton still have certain limitations and shortcomings. For example, the specificity of some primers is not strong enough, and false positive or false negative results may occur; the sensitivity of some PCR methods needs to be improved, and it is difficult to accurately detect low-copy number genomic DNA samples.

[0005] Therefore, the development of a primer and PCR method that can specifically, sensitively and quickly identify diploid C genome Sterti cotton varieties, diploid E genome gray cotton varieties and / or tetraploid AD genome cotton varieties has important theoretical and practical significance for cotton variety identification, genetic resource protection, breeding improvement and industrial application. It will also fill some gaps in the existing technology in this field and provide strong technical support for the sustainable development of the cotton industry. Summary of the invention

[0006] The purpose of the present invention is to achieve rapid and convenient identification of diploid C genome Sterti cotton species ( G.sturtianum )、Diploid E genome gray-white cotton species ( G.incanum ) and other diploid A, B, C, D, E, F, G, K group cotton species or tetraploid cotton species (AD1~AD7), thereby providing a specific primer set for identifying Sterti cotton and gray-white cotton species and its application.

[0007] In order to achieve the above object, the technical solution of the present invention is: In the first aspect, the present invention provides a specific primer set for identifying Sterile cotton and gray-white cotton, which consists of a first specific primer and a second specific primer, the forward primer (F1) sequence of the first specific primer is shown as SEQ ID No.1, the reverse primer (R1) sequence of the first specific primer is shown as SEQ ID No.2, the forward primer (F2) sequence of the second specific primer is shown as SEQ ID No.3, and the reverse primer (R2) sequence of the second specific primer is shown as SEQ ID No.4.

[0008] In a second aspect, the present invention also provides the use of the above-mentioned specific primer set for identifying Stetti cotton and gray-white cotton varieties in the preparation of diploid C genome Stetti cotton varieties, diploid E genome gray-white cotton varieties and / or tetraploid AD genome cotton varieties identification products.

[0009] In a third aspect, the present invention also provides a kit for identifying Stetti cotton and gray-white cotton species, comprising the above-mentioned specific primer set for identifying Stetti cotton and gray-white cotton species.

[0010] Compared with the prior art, the technical effects of the present invention are: In the specific primer set provided by the present invention, the first specific primer F1 / R1 can specifically identify the diploid E genome gray-white cotton species and other E genome cotton species, and can also distinguish and identify the AD tetraploid genome cotton species and other genome cotton species. The second specific primer F2 / R2 is designed using the conserved region of each cotton species and is used to identify the validity of 34 cotton genomes and identify the C genome Stetti cotton species.

[0011] The present invention utilizes the first specific primer F1 / R1 to amplify a band of nucleotide sequence of 92-117 bp in PCR with diploid A, B, C, D, E, F, G genome cotton species; and amplify a band of specific nucleotide sequence of 127 bp in PCR with diploid E genome gray-white cotton species; while there is no band in PCR with AD genome cotton species (5 tetraploid cotton species) as template, so it can quickly identify E genome gray-white cotton species and / or tetraploid AD genome cotton species. At the same time, utilizing the second specific primer F2 / R2, except for diploid C genome Sterti cotton species, other cotton species can amplify a band of about 600 bp in length. After combining the two pairs of specific primers, two bands can be amplified in the A, B, C (except the Sturti cotton species), D, E, F, and G genomes, while the C genome of the Sturti cotton species only has a band of about 110 bp, and the AD genome has only a band of about 600 bp, which not only verifies the specificity of the Sturti, gray-white, and AD genome cotton species, but also verifies the validity of the 34 cotton genome cotton species.

[0012] In summary, the specific primer set provided by the present invention can quickly identify cotton species containing the C genome Sterti cotton species, the E genome gray-white cotton species and / or the AD genome cotton species, and then quickly and accurately distinguish them from other genome cotton species, thereby solving the problem of confusing the DNA of the C genome Sterti cotton species, the E genome gray-white cotton species and / or the tetraploid AD genome cotton species with other genome cotton species in experimental work, and has important practical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can also be obtained based on these drawings.

[0014] Figure 1 The first specific primer F1 / R1 and the second specific primer F2 / R2 were used to perform PCR test results on various cotton varieties in the embodiment of the present invention. DETAILED DESCRIPTION

[0015] In order to make those skilled in the art better understand the technical scheme of the present invention, the present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. The experimental methods in the following embodiments are conventional methods unless otherwise specified. The test materials used in the following embodiments are purchased from conventional biochemical reagent stores unless otherwise specified.

[0016] Example 1 The following PCR verification was performed using the first specific primer F1 / R1 and the second specific primer F2 / R2 with 34 cotton species DNA as template.

[0017] 1 Materials and Methods 1.1 Experimental Materials The experimental materials were the nuclear genomic DNA of each cotton species shown in Table 1, with a concentration of 100 ng / μL; F1 / R1 was the intergenic region IGS ( rps7 , atp4 ) was designed as the first specific primer: forward primer F1: TATAAAGTCGAAGGAACCGCGG (as shown in SEQ ID No.1); reverse primer R1: GAGTTAAGTTAACGGGCTTGGC (as shown in SEQ ID No.2); F2 / R2 used NCBI-Blast to select a conservative sequence as the second specific primer, forward primer F2: AGCAGAGGCAATTTGGGAA (as shown in SEQID No.3), reverse primer R2: GAGTCAGTCAACGAGCGGG (as shown in SEQ ID No.4). Multiplex PCR was performed using the first specific primer F1 / R1 and the second specific primer F2 / R2, and sequencing analysis was performed to verify that the primers could amplify bands in all 34 cotton species, verifying the validity of the 34 cotton genomes.

[0018] Both pairs of specific primers were synthesized by Changchun Kumei Biotechnology Co., Ltd. and purified by PAGE. 2×Taq plus Master Mix (containing red dye) was produced by Biosharp. After PCR, no DNA loading buffer was required for staining. 6 μL could be directly loaded for electrophoresis detection.

[0019] 0.2 ml PCR tube; PCR instrument from Techne, UK; agarose gel was made of TAE containing 2.5% agarose, and the electrophoresis solution was 1×TAE; the nucleic acid dye Gelview was produced by Beijing Biotech Biotechnology Co., Ltd., and the electrophoresis instrument was produced by Beijing Junyi Company; the gel imaging instrument was SH-510 produced by Hangzhou Shenhua Technology Co., Ltd.

[0020] 1.2 Experimental methods 1) Add DNA, first specific primer F1 / R1, second specific primer F2 / R2, and 2×Taq plus Master Mix according to the above system proportions into a 0.2 ml sterilized PCR tube. The first specific primer system and the second specific primer system are both 25 μL. 2) Centrifuge the 96-well plate, shake it, and after centrifugation, place it in a PCR instrument and run the above PCR process:

[0021] The amount of dd H2O used in the above system depends on the concentration of the template DNA, where 2× Yes Plus Master Mix is ​​2x, which can be Yes It is composed of enzyme + dNTP + Buffer.

[0022] , 3) Take out the product and load the sample; 4) Voltage: 120 V, current: 200 mA, electrophoresis time: 60 min; 5) Take the glue and read the tape.

[0023] 2 Experimental results The gel reading results showed that the combination of the specific primer F1 / R1 and the second specific primer F2 / R2 proved that the DNA of 34 cotton species was available ( Figure 1 ).

[0024] Using the first specific primer F1 / R1, it is possible to G.herbaceum )、Asian cotton( G. arboreum )、African cotton( G.africanum ))、B(Abnormal cotton( Anomaly )、Green Top Cotton( G.capitis- green ))、C(Sterti cotton( G.sturtianum ), Robinson cotton ( G.robinsonii ))、D(Thurber's cotton( G.thurberi )、Hackney West Cotton( G. harknessii )、Klausko Cotton( G.klotzschianum ), Davidson cotton ( G. davidsonii)、Upland cotton( G. arid )、Raymond cotton( G.raimondii )、Pseudo-cotton( G. gossypioides )、Loose cotton( G.laxum )、Split cotton( G.lobatum ), Schwantimann G. schwendimanii )、Turner's cotton( G.turneri )、Three-lobed cotton( G. trilobum ))、E(Stokes cotton( G.stocksii )、Somali cotton( G.somalense )、Alesi cotton( G. aeysianum ))、F(Long-calyx cotton( G.longicalyx ))、G genome (Australian cotton ( G.australe )、Nelson's cotton( G. nelsonii )、Australian cotton( G.australe )) cotton species PCR amplified a nucleotide sequence of about 92-117 bp. G.incanum ) cotton species, a specific nucleotide sequence of about 127 bp was amplified in the PCR of the AD genome cotton species (5 tetraploid AD genome cotton species (upland cotton ( G. hirsutum )、Sea Island Cotton( G.barbadense )、Wool Cotton( G.tomentosum )、Yellow-brown cotton( G.mustillinum )、Darwin cotton( G. darwinii )))) was used as the template for PCR and no band of length ( Figure 1 ) 。

[0025] The second specific primer F2 / R2 can be used to clone the diploid A genome cotton species (Gossypium herbaceum ( G.herbaceum )、Asian cotton( G. arboreum )、African cotton( G.africanum ))、B genome cotton species (abnormal cotton ( Anomaly )、Green Top Cotton( Green-headed G. )), C genome cotton species (Robinson G.robinsonii )、(Nandai Huamian( G.nandewarense )), D genome cotton (Gossypium thurberii ( G.thurberi )、Hackney Cotton( G.harknessii )、Klausko Cotton( G.klotzschianum ), Davidson cotton ( G. davidsonii )、Upland cotton( G. arid )、Raymond cotton( G.raimondii )、Pseudo-cotton( G. gossypioides )、Loose cotton( G.laxum )、Split cotton( G.lobatum ), Schwantimann G. schwendimanii )、Turner's cotton( G.turneri )、Three-lobed cotton( G. trilobum )), E genome cotton (Gossypium stokersii ( G.stocksii )、Somali cotton( G.somalense )、Alesi cotton( G. aeysianum )、Gray-white cotton( G.incanum ))、F genome cotton species (long-calyx cotton ( G.longicalyx ))、G genome cotton varieties (Australian cotton ( G.australe )、Nelson's cotton( G. nelsonii )、Australian cotton( G.australe )), tetraploid AD genome cotton species (upland cotton ( G. hirsutum )、Sea Island Cotton( G.barbadense )、Wool Cotton( G.tomentosum )、Yellow-brown cotton( G.mustillinum )、Darwin cotton( G. darwinii )) A band with a length of about 600 bp was amplified.

[0026] After combining two pairs of specific primers, two bands can be amplified in A, B, C (except Sterti cotton), D, E, F, G genome cotton species, while C genome Sterti cotton species only have one band of about 110 bp, and AD genome cotton species only have one band of about 600 bp. Therefore, it is possible to distinguish C genome Sterti cotton species, E genome gray cotton species and / or AD genome cotton species from other genome cotton species. Figure 1 The names of cotton species corresponding to each genome are shown in Table 1. Table 1 shows the information of 34 cotton species. Figure 1 Amplification results of each cotton species from left to right.

[0027]

[0028]

[0029] The above description of the disclosed embodiments is intended to enable those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the above drawings and descriptions are illustrative in nature and should not be construed as limiting the scope of protection of the claims of the present invention.

Claims

1. A specific primer set for identifying Sterile cotton and Gray cotton, characterized in that: It consists of a first specific primer and a second specific primer, the forward primer sequence of the first specific primer is shown as SEQ ID No.1, the reverse primer sequence of the first specific primer is shown as SEQ ID No.2, the forward primer sequence of the second specific primer is shown as SEQ ID No.3, and the reverse primer sequence of the second specific primer is shown as SEQ ID No.

4.

2. Use of the specific primer set for identifying Sterti cotton and gray-white cotton varieties according to claim 1 in preparing identification products of diploid C genome Sterti cotton varieties, diploid E genome gray-white cotton varieties and tetraploid AD genome cotton varieties.

3. A kit for identifying Sterile cotton and gray-white cotton, characterized in that: The invention comprises the specific primer set for identifying Sterti cotton and gray-white cotton as described in claim 1.

Images