Primer probe combination and kit for fluorescent quantitative PCR (Polymerase Chain Reaction) detection of white spot syndrome virus and application of primer probe combination and kit

Abstract

The invention provides a primer probe combination and a kit for fluorescent quantitative PCR (Polymerase Chain Reaction) detection of white spot syndrome virus and application of the primer probe combination and the kit, and belongs to the technical field of molecular biological detection. The primer probe combination for the fluorescent quantitative PCR detection of the white spot syndrome virus comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO.1, a reverse primer with a nucleotide sequence as shown in SEQ ID NO.2 and a Taqman probe with a nucleotide sequence as shown in SEQ ID NO.3. The forward primer and the reverse primer in the primer probe combination are selected from the conserved region of the VP28 gene of the WSSV, so that the DNA of the WSSV can be specifically amplified, and the cross reaction with the genes of other aquatic viruses is avoided. The primer probe combination disclosed by the invention can still keep high sensitivity and high efficiency at a relatively low template concentration, so that the detection requirement of early infection of WSSV is met.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological detection, and in particular relates to a primer-probe combination, a kit and an application thereof for fluorescent quantitative PCR detection of white spot syndrome virus. Background Art

[0002] White Spot Syndrome Virus (WSSV) is one of the deadly viruses of important aquatic animals such as shrimp in aquaculture, and its infection leads to serious economic losses. Therefore, rapid and accurate detection of WSSV virus becomes the key to control its spread and take timely prevention and control measures.

[0003] In recent years, the detection methods for WSSV virus have been continuously developed, mainly including traditional virus isolation, ELISA (enzyme-linked immunosorbent assay), Western Blot (protein immunoblotting), and molecular biological detection methods such as PCR, fluorescent quantitative PCR (qPCR), etc. Although the traditional virus isolation method can provide intuitive evidence for the identification of the virus, the process is cumbersome and time-consuming, and it is difficult to separate samples with low viral loads. Although ELISA and Western Blot have good specificity, their sensitivity often cannot meet the needs of early diagnosis.

[0004] Currently, there is an urgent need for a WSSV virus detection reagent that maintains high sensitivity at lower template concentrations. Summary of the invention

[0005] The purpose of the present invention is to provide a primer-probe combination, a kit and an application thereof for white spot syndrome virus fluorescence quantitative PCR detection. The primer-probe combination of the present invention can maintain high sensitivity at a lower template concentration for white spot syndrome virus fluorescence quantitative PCR detection.

[0006] The present invention provides a primer-probe combination for fluorescent quantitative PCR detection of white spot syndrome virus, comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO.1, a reverse primer with a nucleotide sequence as shown in SEQ ID NO.2, and a Taqman probe with a nucleotide sequence as shown in SEQ ID NO.3; the 5' end of the Taqman probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

[0007] The present invention also provides a kit for fluorescent quantitative PCR detection of white spot syndrome virus, comprising the fluorescent probe combination described in the above scheme.

[0008] In the specific implementation process of the present invention, 2×qPCR Mix and Dnase / Rnase free H2O are also included; the 2×qPCR Mix includes components with the following concentrations: Tris-HCl 20mM, (NH4)2SO42mM, KCl20mM, MgCl24mM, dATP0.4mM, dGTP 0.4mM, dCTP 0.4mM, dUTP 0.8mM, betaine 1M, PEG800015mg / 100mL, Taq enzyme 1U and UNG enzyme 0.5U; the pH of the Tris-HCl is 8.8.

[0009] The present invention also provides the use of the primer-probe combination or the kit described in the above scheme in fluorescent quantitative PCR detection of white spot syndrome virus for non-diagnostic purposes.

[0010] The present invention also provides a method for detecting white spot syndrome virus by fluorescent quantitative PCR for non-diagnostic purposes, comprising the following steps:

[0011] Extract the genome of the sample to be tested; use the genome as a template and adopt the primer-probe combination described in the above scheme or the kit to perform fluorescent quantitative PCR.

[0012] In the specific implementation process of the present invention, the reaction system of the fluorescent quantitative PCR is 25 μL, including the following components: 5 μL of genome, 0.75 μL of forward primer, 0.75 μL of reverse primer, 0.5 μL of Taqman probe, 12.5 μL of 2×qPCR Mix and 5.5 μL of Dnase / Rnase free H2O; the final concentrations of the forward primer, reverse primer and Taqman probe are 10 μM respectively.

[0013] In the specific implementation process of the present invention, the reaction procedure of the fluorescent quantitative PCR includes: 37°C, 2 min; 95°C, 3 min; 95°C, 10 s, 60°C, 30 s, 40 cycles.

[0014] In the specific implementation process of the present invention, at the end of each cycle, the fluorescent signal is detected in real time to determine whether the sample to be tested contains white spot syndrome virus, and the judgment standard is: when the Ct value of the FAM fluorescence channel of the test sample is ≤38 and there is an obvious exponential growth period, it is determined that the sample to be tested contains white spot syndrome virus; when the test sample has no amplification curve, or the Ct value is >40 or there is no Ct value, it is determined that the sample to be tested does not contain white spot syndrome virus; when the test sample has a typical S-type amplification curve and the Ct value of the FAM fluorescence channel is 38<Ct value≤40, a re-test is performed, if after the re-test, the Ct value is ≤40 and a typical amplification curve appears, it is determined to be positive, otherwise it is determined to be negative; and / or, combining the intensity CT value of the fluorescence signal and the standard curve, the quantitative result of the white spot syndrome virus in the sample to be tested is obtained.

[0015] In the specific implementation process of the present invention, the standard curve is constructed with the logarithm of the standard plasmid copy number as the horizontal coordinate and the CT value as the vertical coordinate; the formula of the standard curve is: y = -3.6948x + 38.612, R 2 =0.9997.

[0016] In the specific implementation process of the present invention, the dilution gradient of the standard plasmid is: 10 7 cpoies / 5μL, 10 6 cpoies / 5μL, 10 5 cpoies / 5μL, 10 4 cpoies / 5μL, 10 3 cpoies / 5μL, 10 2 cpoies / 5μL, 10 1 cpoies / 5μL and 1 cpoies / 5μL.

[0017] The present invention provides a primer-probe combination for fluorescent quantitative PCR detection of white spot syndrome virus, including a forward primer with a nucleotide sequence as shown in SEQ ID NO.1, a reverse primer with a nucleotide sequence as shown in SEQ ID NO.2, and a Taqman probe with a nucleotide sequence as shown in SEQ ID NO.3; the 5' end of the Taqman probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group. The forward primer and the reverse primer in the primer-probe combination of the present invention are selected from the conserved region of the VP28 gene of WSSV, which can ensure that the DNA of WSSV can be specifically amplified and avoid cross-reaction with the genes of other aquatic viruses; the TaqMan probe selects another specific sequence in the gene region of the VP28 gene, and uses the fluorescent group and the quenching group to realize real-time monitoring of the fluorescent signal during the PCR amplification process, thereby achieving the purpose of quantitative detection of WSSV. The primer-probe combination of the present invention can still maintain high sensitivity and high efficiency at a lower template concentration, thereby meeting the detection needs of early WSSV infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0019] Figure 1 The figure is the result of fluorescence quantitative PCR of primer-probe combination No. 1 in comparative example 1;

[0020] Figure 2 The figure is the result of fluorescence quantitative PCR of primer-probe combination No. 2 in Example 1;

[0021] Figure 3 The figure is the result of fluorescence quantitative PCR of primer-probe combination No. 3 in comparative example 2;

[0022] Figure 4 This is a linear relationship diagram between the amount of template DNA and the Ct value of Comparative Example 1;

[0023] Figure 5 This is a linear relationship diagram between the amount of template DNA and the Ct value in Example 1;

[0024] Figure 6 This is a linear relationship diagram between the amount of template DNA and the Ct value of Comparative Example 2;

[0025] Figure 7 This is the result diagram of primer and probe specificity verification;

[0026] Figure 8This is the fluorescence quantitative PCR amplification curve of the gradient dilution standard plasmid;

[0027] Fig. 9 The figure is the standard curve of fluorescent quantitative PCR of the gradient dilution standard plasmid. DETAILED DESCRIPTION

[0028] The present invention provides a primer-probe combination for fluorescent quantitative PCR detection of white spot syndrome virus, comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO.1, a reverse primer with a nucleotide sequence as shown in SEQ ID NO.2, and a Taqman probe with a nucleotide sequence as shown in SEQ ID NO.3; the 5' end of the Taqman probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

[0029] In the present invention, the fluorescent group is FAM; the quenching group is BHQ1.

[0030] In the present invention, the nucleotide sequence of the forward primer is specifically: 5'-CTTTCACTCTTTCGGTCGTG-3'; the nucleotide sequence of the reverse primer is specifically: 5'-TATTGCCTGTGTGGGTTTCG-3'; the nucleotide sequence of the TaqMan probe is specifically: 5'-FAM-CCATCCTCGCCATCACTGCTG-BHQ1-3'.

[0031] In the present invention, the primer-probe combination is obtained from General Biotechnology (Anhui) Co., Ltd.

[0032] In the present invention, the forward primer and the reverse primer are designed using Primer3web (https: / / primer3.ut.ee / ) with the WSSV-specific structural gene VP28 as the detection target. Since the forward primer and the reverse primer of the present invention are selected from the conserved region of the VP28 gene of WSSV, it can ensure that the DNA of WSSV can be specifically amplified to avoid cross-reaction with genes of other aquatic pathogens; the other aquatic pathogens include one or more of decapod iridovirus 1 (DIV1), infectious hypodermal and hematopoietic tissue necrosis virus (IHHNV), infectious myonecrosis virus (IMNV), Nodamura virus (CMNV), Vibrio parahaemolyticus (Vp), Vibrio harveyi (Vh), highly pathogenic Vibrio (VpTPD), Vibrio acute hepatopancreatic necrosis (VpAHPDN) and enterocytosis of shrimp (EHP). In the present invention, the TaqMan probe selects another specific sequence in the gene region of the VP28 gene, and uses fluorescent groups and quenching groups to monitor the fluorescence signal in the PCR amplification process in real time, thereby achieving the purpose of quantitative detection of WSSV.

[0033] The primer-probe combination of the present invention can maintain high sensitivity and high efficiency at a lower template concentration, thereby meeting the detection requirements for early WSSV infection.

[0034] The nucleic acid sequence of the target gene fragment of the primer-probe combination of the present invention is shown in SEQ ID NO.10.

[0035] The present invention also provides a kit for fluorescent quantitative PCR detection of white spot syndrome virus, comprising the fluorescent probe combination described in the above scheme.

[0036] In the specific implementation process of the present invention, the kit also includes 2×qPCR Mix and Dnase / Rnase freeH2O; the 2×qPCRMix includes the following components in concentration: Tris-HCl 20mM, (NH4)2SO42mM, KCl 20mM, MgCl24mM, dATP 0.4mM, dGTP 0.4mM, dCTP 0.4mM, dUTP 0.8mM, betaine 1M, PEG800015mg / 100mL, Taq enzyme 1U and UNG enzyme 0.5U; the pH of the Tris-HCl is 8.8. The present invention can improve enzyme activity and reaction efficiency by reasonably setting the composition of 2×qPCRMix, thereby enhancing the sensitivity of the reaction; in addition, the use of 2×qPCRMix can simplify experimental operations and improve the stability of the reaction.

[0037] In the present invention, UNG enzyme can destroy DNA incorporated with dUTP in any previous reaction before the PCR reaction, thereby effectively preventing cross contamination in the PCR reaction and improving the accuracy of the detection result.

[0038] The present invention also provides the use of the primer-probe combination or the kit described in the above scheme in fluorescent quantitative PCR detection of white spot syndrome virus for non-diagnostic purposes.

[0039] The present invention also provides a method for detecting white spot syndrome virus by fluorescent quantitative PCR for non-diagnostic purposes, comprising the following steps:

[0040] Extracting the genome of the sample to be tested;

[0041] Using the genome as a template, fluorescent quantitative PCR is performed using the primer-probe combination described in the above scheme or the kit described.

[0042] In the specific implementation process of the present invention, the TIANGEN virus genome DNA / RNA extraction kit (DP315) is used to extract the WSSV genome according to the steps in the instruction manual, and the WSSV genome concentration is determined using an ultra-micro spectrophotometer.

[0043] In the specific implementation process of the present invention, the reaction system of the fluorescent quantitative PCR is 25 μL, including the following components: 5 μL of genome, 0.75 μL of forward primer, 0.75 μL of reverse primer, 0.5 μL of Taqman probe, 12.5 μL of 2×qPCR Mix and 5.5 μL of Dnase / Rnase free H2O; the final concentrations of the forward primer, reverse primer and Taqman probe are 10 μM respectively. The reaction system of the fluorescent quantitative PCR of the present invention provides appropriate enzyme activity and buffer conditions to ensure that the PCR reaction is carried out under efficient conditions, while avoiding non-specific amplification caused by contamination, and maintaining high sensitivity at a lower template concentration. The final concentrations of the forward primer, reverse primer and Taqman probe of the present invention can improve enzyme activity and reaction efficiency, thereby enhancing the sensitivity of the reaction.

[0044] In the specific implementation process of the present invention, the reaction procedure of the fluorescent quantitative PCR includes: 37°C, 2min; 95°C, 3min; 95°C, 10s, 60°C, 30s, 40 cycles. The reaction procedure of the present invention can improve the specificity of detection, obtain the best amplification efficiency, accurate quantitative results, and maintain high sensitivity at a lower template concentration. Among them, 37°C, 2min is to eliminate contamination, specifically, it is a warm bath at 37°C for 2min, so that the UNG enzyme can fully digest the possible contaminating nucleic acids; 95°C, 3min is pre-denaturation, specifically, it is pre-denaturation at 95°C for 3min, which is used to activate the Taq enzyme and completely melt the template DNA, and at the same time inactivate the UNG enzyme; 95°C, 10s, 60°C, 30s, 40 cycles are amplification, wherein 95°C, 10s is used for the denaturation of the DNA template to completely melt it; 60°C, 30s is the annealing and amplification step, the primer binds to the template, and provides a suitable binding temperature for the probe. This step ensures the specificity of amplification.

[0045] The present invention detects the fluorescent signal in real time at the end of each cycle so as to perform quantification during the amplification process.

[0046] At the end of each cycle, the present invention detects the fluorescent signal in real time to determine whether the sample to be tested contains the white spot syndrome virus, and the judgment standard is: when the Ct value of the FAM fluorescence channel of the test sample is ≤38 and there is an obvious exponential growth period, it is determined that the sample to be tested contains the white spot syndrome virus; when the test sample has no amplification curve, or the Ct value is greater than 40 or there is no Ct value, it is determined that the sample to be tested does not contain the white spot syndrome virus; when the test sample has a typical S-type amplification curve and the Ct value of the FAM fluorescence channel is 38<Ct value≤40, a re-test is performed, if after the re-test, the Ct value is ≤40 and a typical amplification curve appears, it is determined to be positive, otherwise it is determined to be negative; and / or,

[0047] The quantitative result of white spot syndrome virus in the sample to be tested is obtained by combining the intensity CT value of the fluorescence signal with the standard curve.

[0048] In the specific implementation process of the present invention, the standard curve is constructed with the logarithm of the standard plasmid copy number as the horizontal axis and the CT value as the vertical axis; the formula of the standard curve is: y = -3.6948x + 38.612. The detection limit of the primer probe combination of the present invention can reach 10cpoies per 5μL nucleic acid of the target gene, and the standard curve R established by the standard plasmid 2 =0.9997.

[0049] In the specific implementation process of the present invention, the dilution gradient of the standard plasmid is: 10 7 cpoies / 5μL, 10 6 cpoies / 5μL, 10 5 cpoies / 5μL, 10 4 cpoies / 5μL, 10 3 cpoies / 5μL, 10 2 cpoies / 5μL, 10 1 cpoies / 5μL and 1 cpoies / 5μL.

[0050] In the specific implementation process of the present invention, the standard plasmid is obtained by cloning the target gene into the pUC19 vector.

[0051] To further illustrate the present invention, a primer-probe combination, a kit and applications thereof for fluorescent quantitative PCR detection of white spot syndrome virus provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0052] Example 1

[0053] 1. Detection Reagents

[0054] Forward primer: 5'-CTTTCACTCTTTCGGTCGTG-3' (SEQ ID NO. 1);

[0055] Reverse primer: 5'-TATTGCCTGTGTGGGTTTCG-3' (SEQ ID NO. 2);

[0056] TaqMan probe: 5'-FAM-CCATCCTCGCCATCACTGCTG-BHQ1-3' (SEQ ID NO. 3);

[0057] Named as primer probe set No. 2, the primers and probes were synthesized by General Biotechnology (Anhui) Co., Ltd., the 5' end of the probes were labeled with the fluorescent group FAM, and the 3' end of the probes were labeled with the quenching group BHQ1.

[0058] 2×qPCR Mix contains the following components: Tris-HCl (pH 8.8) 20mM, (NH4)2SO42mM, KCl 20mM, MgCl24mM, dATP 0.4mM, dGTP 0.4mM, dCTP 0.4mM, dUTP 0.8mM, betaine 1M, PEG800015%, Taq enzyme 1U and UNG enzyme 0.5U.

[0059] Comparative Example 1

[0060] Forward primer-1: 5'-AAGGCCTTTGTCGGTAGCTC-3' (SEQ ID NO. 4);

[0061] Reverse primer-1: 5'-TACTCGGTCTCAGTGCCAGA-3' (SEQ ID NO. 5);

[0062] Probe-1: 5'-FAM-ATGAGGATGAAGTTGGCACCTTTGTG-BHQ1-3' (SEQ ID NO. 6);

[0063] Named as primer probe set No. 1.

[0064] Comparative Example 2

[0065] Forward primer-3: 5'-TGGTATGCAGATGGTGCCAA-3' (SEQ ID NO. 7);

[0066] Reverse primer-3: 5'-TACCACACACAAAGGTGCCA-3' (SEQ ID NO. 8);

[0067] Probe-3: 5′-FAM-TAACCCATCAAAGGCCTTTGTCGGT-BHQ1-3′ (SEQ ID NO. 9);

[0068] Named as primer probe set No. 3.

[0069] 2. White Spot Syndrome Virus Purification

[0070] 1. Use tweezers to open the cephalothorax of white shrimp infected with WSSV and take 1g of gills and other tissues;

[0071] 2. Add 50 mL of pre-cooled TNE (20 mM Tris-HCl, 0.4 M NaCl, pH 8.5) solution and homogenize thoroughly on ice;

[0072] 3. After homogenization, transfer the sample into a 50 mL centrifuge tube and centrifuge at 3500 g for 5 min at 4°C;

[0073] 4. Take the supernatant to a centrifuge tube and centrifuge at 30,000 g for 30 min at 4°C;

[0074] 5. Resuspend the precipitate in 50 mL of pre-cooled TM (50 mM Tris-HCl, 10 mM MgCl2, pH 7.5) solution and centrifuge at 3500 g for 5 min at 4°C.

[0075] 6. Take the supernatant to a centrifuge tube, centrifuge at 4°C, 30,000 g for 30 min, and discard the supernatant;

[0076] 7. Resuspend the precipitate with a small amount of pre-cooled TM solution and store at -80℃ for later use.

[0077] 3. Extraction of White Spot Syndrome Virus Genome

[0078] The WSSV genome was extracted using the TIANGEN Virus Genome DNA / RNA Extraction Kit (DP315) according to the instructions, and the WSSV genome concentration was determined using an ultra-micro spectrophotometer.

[0079] 4. Amplification

[0080] The WSSV genome was diluted to 8 gradients: 10 ng / 5 μL, 1 ng / 5 μL, 100 pg / 5 μL, 10 pg / 5 μL, 1 pg / 5 μL, 100 fg / 5 μL, 10 fg / 5 μL, 1 fg / 5 μL, and 3 sets of repeated experiments were set for each gradient;

[0081] The reaction system was configured according to Table 1.

[0082] Table 1 Fluorescence quantitative PCR reaction system

[0083] Element volume Genome template 5μL Forward primer (10 μM concentration) 0.75μL Reverse primer (10 μM concentration) 0.75μL Taqman probe (10 μM concentration) 0.5μL 2×qPCRMix 12.5μL <![CDATA[Dnase / RnasefreeH2O]]> 5.5μL

[0084] The fluorescence quantitative PCR instrument reaction program was set according to Table 2.

[0085] Table 2 Fluorescence quantitative PCR reaction procedure

[0086]

[0087] *Collect FAM fluorescence signal at the end of the step.

[0088] The test results of Example 1, Comparative Example 1 and Comparative Example 2 are shown in Table 3. Figure 1 to Figure 3 shown.

[0089] Table 3 Test results of Example 1, Comparative Example 1 and Comparative Example 2

[0090]

[0091]

[0092] Figures 1 to 3 Each figure contains 7 clusters of amplification curves. From left to right, each cluster represents the amplification curve of the template genome amount ranging from 10 ng / 5 μL to 10 fg / 5 μL, that is, the rightmost cluster is the 10 fg / 5 μL WSSV genome amplification curve.

[0093] According to the results of Comparative Example 1, Example 1, and Comparative Example 2, a linear relationship diagram between the amount of template DNA and the Ct value can be drawn and a regression equation can be established. The template DNA is converted into fg units, and the logarithm with base 10 is returned as the horizontal axis, and the average Ct value is used as the vertical axis. Figures 4 to 6 .

[0094] The amplification efficiency (E) was calculated according to the following formula.

[0095] E=10 -1 / 斜率 -1

[0096] The amplification efficiency of comparative example 1 was calculated to be 92.73%, the amplification efficiency of embodiment 1 was 97.66%, and the amplification efficiency of comparative example 2 was 94.27%. It can be seen that embodiment 1 has the highest amplification efficiency, the primer-probe combination has the best effect, and the detection sensitivity can reach 10fg / 5μL WSSV genome.

[0097] Example 2

[0098] Primer and probe specificity analysis of Example 1

[0099] 1. Genome extraction of white shrimp samples infected with different pathogens

[0100] The white spot syndrome virus (WSSV), decapod iris virus 1 (DIV1), infectious hypodermal and hematopoietic necrosis virus (IHHNV), infectious myonecrosis virus (IMNV), CMNV, Vibrio parahaemolyticus (Vp), Vibrio harveyi (Vh), highly pathogenic Vibrio spp. (VpTPD), Vibrio spp. with acute hepatopancreatic necrosis disease (VpAHPDN), and Enterocytosis hepatocellularis (EHP) were collected;

[0101] The TIANGEN Marine Animal Tissue Genomic DNA Extraction Kit (DP324) was used to extract the genomes of white shrimp samples infected with different pathogens according to the instructions, and the WSSV genome concentration was determined using an ultra-micro spectrophotometer.

[0102] 2. Primer probe specificity verification

[0103] The experiment was carried out according to the reaction system and reaction procedure in Example 1. The results are shown in Table 4 and Figure 4 shown.

[0104] Table 4 Primer probe specificity verification results

[0105]

[0106]

[0107] according to Figure 7 From the results in Table 4, it can be concluded that the primer pair and probe do not cross-react with other common pathogens of white shrimp and have good specificity.

[0108] Example 3

[0109] Establishment of standard curve and detection limit analysis of fluorescence quantitative PCR

[0110] 1. Standard plasmid construction

[0111] The target gene fragment nucleic acid sequence is shown in SEQ ID NO.10, specifically:

[0112] ATGGATTCTTTCTTTCACTCTTTCGGTCGTGTCGGCCATCCTCGCCATCACTGCTGTGATTGCTGTATTTATTGTGATTTTTAGGTATCACAACACTGTGACCAAGACCATCGAAACCCACACAGGCAATATCGAGACAAACATGGATGAA AACCTCCGCATTCCTGTGACTGCTGAGGTTGGATCAGGCTACTTCAAGATGACTGATGTGTCCTTTGACAGCGACACCTTGGGCAAAATCAAGATCCGCAATGGAAAGTCTGATGCACAGATGAAGGAAGAAGATGCGGATCTTGTCATC.

[0113] The target fragment was synthesized from General Biotechnology (Anhui) Co., Ltd. and cloned into the pUC19 vector.

[0114] 2. Standard curve establishment and detection limit analysis

[0115] The plasmid concentration was measured using an ultra-micro spectrophotometer, and the plasmid copy number was calculated according to the formula:

[0116]

[0117] The standard plasmid was diluted to 10 7 cpoies / 5μL, 10 6 cpoies / 5μL, 10 5 cpoies / 5μL, 10 4 cpoies / 5μL, 10 3 cpoies / 5μL, 10 2 cpoies / 5μL, 10 1 There were 8 gradients, including cpoies / 5μL and 1cpoies / 5μL, and 3 sets of repeated experiments were set for each gradient;

[0118] The experiment was carried out according to the primer-probe combination, reaction system and reaction procedure of Example 1. The results are shown in Table 5. Figure 8 and Fig. 9 shown.

[0119] Table 5 Standard plasmid detection results

[0120]

[0121] According to Table 5, Figure 8 and Fig. 9 The results show that the detection limit of the primer pair and probe can reach 10cpoies of the target gene per 5μL nucleic acid, and the standard curve R established by the standard plasmid 2 =0.9997.

[0122] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer-probe combination for fluorescent quantitative PCR detection of white spot syndrome virus, characterized in that: It comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO.1, a reverse primer with a nucleotide sequence as shown in SEQ ID NO.2 and a Taqman probe with a nucleotide sequence as shown in SEQ ID NO.3; the 5' end of the Taqman probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

2. A kit for detecting white spot syndrome virus by fluorescent quantitative PCR, characterized in that: The invention comprises the fluorescent probe combination as claimed in claim 1.

3. The kit according to claim 2, characterized in that Also included are 2×qPCR Mix and DNase / RNasefree H2O; The 2×qPCR Mix includes components with the following concentrations: Tris-HCl 20 mM, (NH4)2SO4 2 mM, KCl 20 mM, MgCl2 4 mM, dATP 0.4 mM, dGTP 0.4 mM, dCTP 0.4 mM, dUTP 0.8 mM, betaine 1 M, PEG8000 15 mg / 100 mL, Taq enzyme 1 U and UNG enzyme 0.5 U; the pH of the Tris-HCl is 8.

8.

4. Use of the primer-probe combination of claim 1 or the kit of claim 2 or 3 in fluorescent quantitative PCR detection of white spot syndrome virus for non-diagnostic purposes.

5. A method for non-diagnostic white spot syndrome virus fluorescence quantitative PCR detection, characterized in that: The following steps are involved: Extracting the genome of the sample to be tested; Using the genome as a template, fluorescent quantitative PCR is performed using the primer-probe combination of claim 1 or the kit of claim 2 or 3.

6. The method according to claim 5, characterized in that The reaction system of the fluorescent quantitative PCR is 25 μL, and includes the following components: 5 μL of genome, 0.75 μL of forward primer, 0.75 μL of reverse primer, 0.5 μL of Taqman probe, 12.5 μL of 2×qPCRMix and 5.5 μL of Dnase / Rnase free H2O; the final concentrations of the forward primer, reverse primer and Taqman probe are 10 μM, respectively.

7. The method according to claim 5 or 6, characterized in that: The reaction procedure of the fluorescent quantitative PCR includes: 37° C., 2 min; 95° C., 3 min; 95° C., 10 s, 60° C., 30 s, 40 cycles.

8. The method according to claim 5, characterized in that At the end of each cycle, the fluorescence signal is detected in real time to determine whether the sample to be tested contains white spot syndrome virus. The judgment standard is: when the Ct value of the FAM fluorescence channel of the test sample is ≤38 and there is an obvious exponential growth period, it is determined that the sample to be tested contains white spot syndrome virus; when the test sample has no amplification curve, or the Ct value is >40 or there is no Ct value, it is determined that the sample to be tested does not contain white spot syndrome virus; when the test sample has a typical S-type amplification curve and the Ct value of the FAM fluorescence channel is 38<Ct value≤40, a re-test is performed. If after the re-test, the Ct value is ≤40 and a typical amplification curve appears, it is determined to be positive, otherwise it is determined to be negative; and / or, The quantitative result of white spot syndrome virus in the sample to be tested is obtained by combining the intensity CT value of the fluorescence signal with the standard curve.

9. The method according to claim 8, characterized in that The standard curve is constructed by taking the logarithm of the standard plasmid copy number as the horizontal axis and the CT value as the vertical axis; the formula of the standard curve is: y=-3.6948x+38.612, R 2 =0.9997.

10. The method according to claim 9, characterized in that The dilution gradient of the standard plasmid is: 10 7 cpoies / 5μL, 10 6 cpoies / 5μL, 10 5 cpoies / 5μL, 10 4 cpoies / 5μL, 10 3 cpoies / 5μL, 10 2 cpoies / 5μL, 10 1 cpoies / 5μL and 1 cpoies / 5μL.

Images