Recyclable biochip stationary phase as well as preparation method and application thereof

Abstract

The invention discloses a recyclable biochip stationary phase as well as a preparation method and application thereof, and belongs to the field of biochips. The preparation method of the biochip stationary phase comprises the following steps: (1) activating a glass slide by adopting plasma, and then putting the glass slide into a silane coupling agent solution to react, so that a silane coupling agent is covalently bound with the glass slide to obtain a functionally modified biochip; and (2) combining the 5'end modified single chain oligo with the functionally modified biochip to obtain the biochip stationary phase. The biochip stationary phase disclosed by the invention is low in cost, excellent in physicochemical property, good in stability and tolerance and capable of adapting to a complex environment; more importantly, the method can be recycled, the resource utilization rate is increased, the pollution is reduced, and the method has huge application potential in the leading technical field of DNA synthesis by an enzyme method and the like.

Description

Technical Field

[0001] The invention relates to the field of biochips, and in particular to a recyclable biochip stationary phase and a preparation method and application thereof. Background Art

[0002] In recent years, genetic engineering technology has developed rapidly, and the position of DNA synthesis in the field of bioengineering has become increasingly critical, becoming the core link to promote many research and application breakthroughs. As a cutting-edge third-generation DNA synthesis technology, bioenzymatic DNA synthesis, with its outstanding characteristics such as high efficiency, high accuracy and environmental protection, is like a key, bringing hope to solving many problems faced by traditional DNA synthesis, and is expected to break the current bottleneck of chemical synthesis. DNA synthesis technology can use biological enzymes to catalyze the addition of single bases to the end of the DNA chain and perform multiple rounds of reactions to synthesize the target DNA chain. In this process, the DNA chain needs to be fixed on a solid surface for subsequent reactions.

[0003] In this technical system, biochips, as the stationary phase for DNA synthesis, play key roles such as supporting the reaction and fixing the reaction substrate. DNA immobilization technology is an important basis for the functioning of biochips, mainly fixing the probe on the support by covalent or non-covalent means. The non-covalent immobilization method cleverly utilizes the hydrophobic and electrostatic interactions between molecules to achieve probe fixation under relatively mild conditions. This method is relatively simple to operate and has little effect on the structure of the probe; while the covalent immobilization method uses chemical reactions between functional groups to form stable covalent bonds. Although the reaction conditions are relatively complex, it can provide a more solid fixation effect, ensuring that the probe remains stable in a complex reaction environment, and providing a solid guarantee for accurate DNA synthesis. However, the chip stationary phase carriers currently on the market are all disposable consumables, which are difficult to recycle, resulting in high costs and a large waste of resources. Summary of the invention

[0004] The purpose of the present invention is to provide a recyclable biochip stationary phase and a preparation method and application thereof.

[0005] The present invention first provides a method for preparing a biochip stationary phase, comprising the following steps: (1) treating a glass slide with plasma, and then placing the glass slide in a silane coupling agent solution for reaction, so that the silane coupling agent is covalently bonded to the glass slide, thereby obtaining a functionally modified biochip; (2) Combining the 5'-end modified single-stranded oligo with the functionally modified biochip to obtain the biochip stationary phase.

[0006] In the above preparation method, in step (1), the plasma treatment time is 1-500 s, specifically 180 s; The power of the plasma treatment is 30-160 W; specifically, it can be 130 W; The working gas for the plasma treatment is selected from any one of nitrogen, oxygen, argon and air; The flow rate of the working gas for the plasma treatment is 10 to 100 mL / h; specifically, it may be 10 mL / h; The silane coupling agent contains a mercapto group; The silane coupling agent can be specifically selected from at least one of (3-mercaptopropyl)triethoxysilane, mercaptopropylmethyldimethoxysilane and (3-mercaptopropyl)trimethoxysilane; The volume percentage concentration of the silane coupling agent solution is 1%-20%; specifically, it can be 1%; The solvent of the silane coupling agent solution is acetonitrile; The reaction time is 2 h-24 h; specifically 24 h; The reaction temperature is 20°C-60°C, specifically 20°C-35°C; the reaction is carried out in the dark.

[0007] In the above-mentioned preparation method, the group modified at the 5' end of the single-chain oligo is a disulfide bond; The 5'-end modified single-stranded oligo is a 5'-end modified single-stranded DNA; Specifically, the nucleotide sequence of the single-stranded oligo is as follows: 5'-TTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3'; The 5'-end modified single-stranded oligo is combined with the functionally modified biochip by spotting; The spotting concentration of the 5'-end modified single-stranded oligo is 1-10 μmol / L, specifically 2.5 μmol / L; The spotting volume of the 5'-end modified single-stranded oligo is 1-5 μL, specifically 1 μL; The time for the 5'-end modified single-stranded oligo to combine with the functionally modified biochip is 6 h-24 h, specifically 15 h; The temperature for combining the 5'-end modified single-stranded oligo with the functionally modified biochip is 20°C-60°C (specifically 25°C), and the ambient humidity is 70%-80%.

[0008] Specifically, the step of combining the 5'-end modified single-chain oligo with the functionally modified biochip in step (2) comprises the following steps: dropping the 5'-end modified disulfide bond single-chain oligo solution on the functionally modified biochip in a spotting manner, then placing it in an environment with a humidity of 70%-80% at 25°C for reaction for 15 h, rinsing with water and then drying with nitrogen.

[0009] The above-mentioned preparation method further comprises the step of cleaning the glass slide before treating the glass slide with plasma; The cleaning step comprises the following steps: placing the glass slide in an organic solvent for cleaning, then soaking the glass slide in a glass cleaning agent for ultrasonic treatment, and drying.

[0010] Specifically, the organic solvent is at least one of acetone, chloroform, ethyl chloride and xylene; The ultrasonic cleaning time is 1-30 min.

[0011] The number of times of ultrasonic cleaning is 2 times; The drying temperature is 25-80°C.

[0012] In the above preparation method, the size of the slide is 75 mm×25 mm, 76 mm×26 mm or 50 mm×75 mm.

[0013] The present invention further provides a biochip stationary phase prepared by the above preparation method.

[0014] The application of the above-mentioned biochip stationary phase in synthesizing DNA also falls within the protection scope of the present invention; Specifically, the biochip fixed phase is used in enzymatic DNA synthesis.

[0015] The present invention also provides a method for synthesizing DNA, comprising the following steps: synthesizing DNA by enzymatic method using the above biochip fixed phase.

[0016] Finally, the present invention provides a method for recycling the above-mentioned biochip stationary phase, comprising the following steps: The used biochip stationary phase is immersed in a reducing agent for reaction, and then the 5'-end modified single-stranded oligo is combined with the biochip stationary phase treated with the reducing agent to achieve the recycling of the biochip stationary phase.

[0017] In the above recycling method, the reducing agent is at least one of tris(2-carboxyethyl)phosphine (TCEP), dithiothreitol (DTT), mercaptoethanol (BME) and dithioerythritol (DTE); The solution concentration of the reducing agent is 10 mM-2 M, specifically 1 M; The reaction temperature is 20° C.-80° C., and the reaction time is 0.5 h-6 h, and specifically, the reaction can be carried out at 60° C. for 1 h.

[0018] In the above recycling method, the 5'-end modification group of the single-chain oligo is a disulfide bond; The nucleotide sequence of the single-stranded oligo is as follows: 5'-TTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3'; The 5'-end modified single-stranded oligo is combined with the functionally modified biochip by spotting; The spotting concentration of the 5'-end modified single-stranded oligo is 1-10 μmol / L, specifically 2.5 μmol / L; The spotting volume of the 5'-end modified single-stranded oligo is 1-5 μL, specifically 1 μL; The time for the 5'-end modified single-stranded oligo to combine with the functionally modified biochip is 6-24 hours, specifically 15 hours; The temperature for combining the 5'-end modified single-stranded oligo with the functionally modified biochip is 20°C-60°C (specifically 25°C), and the ambient humidity is 70%-80%.

[0019] In the present invention, the binding of the single-stranded oligo with a disulfide bond modified at the 5' end to the functionally modified biochip can be examined by hybridizing the complementary fluorescent chain of DNA modified with a fluorescent group at the 3' end.

[0020] In the DNA complementary fluorescent chain modified with a fluorescent group at the 3' end, the fluorescent group is selected from at least one of CY5, CY3 and FITC.

[0021] The nucleotide sequence of the fluorescent complementary chain is as follows: 5'-TCAAGTCGCGTAGGAGTCTCTAGCC-3'; The biochip stationary phase can be recycled 1-10 times.

[0022] Oligonucleotides synthesized using the stationary phase of the present invention can be used in the following scenarios: (1) As a PCR primer, a primer chain with a cleavage site is inoculated, followed by synthesis of the target sequence. After the reaction is completed, the cleavable nucleotide is dissociated from the solid phase by cleavage means, thereby successfully releasing the oligonucleotide; (2) As the synthesis of short-chain nucleotide units of genes: According to the synthesis requirements of short-chain nucleotide units of a certain gene, the corresponding primer chain is inoculated to complete the synthesis of gene segmented short-chain sequences. In this scenario, there is no need to perform dissociation operation, and the synthesized short-chain sequence can be directly used in the gene splicing process.

[0023] The present invention introduces a recyclable stationary phase based on a silicon-based chip, which has low cost, excellent physical and chemical properties, good stability and tolerance, and can adapt to complex environments; the biochip stationary phase of the present invention also has the advantage of being functionalized and can be modified as needed; more importantly, it can be recycled, improve resource utilization, reduce pollution, and provide strong support for the sustainable development of biochip technology, showing great application potential in cutting-edge technology fields such as enzymatic DNA synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Functional modification process for recyclable biochips; Figure 2 This is the fluorescence image after coupling the initiation chain in Example 2; Figure 3 This is the fluorescence image after hybridization of the fluorescent complementary strand in Example 2; Figure 4 This is the fluorescence image of the first cycle in Example 3; Figure 5 This is the fluorescence image of the second cycle in Example 3. DETAILED DESCRIPTION

[0025] The present invention is further described in detail below in conjunction with specific embodiments. The given examples are only for illustrating the present invention, but not for limiting the scope of the present invention.

[0026] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0027] The quantitative tests in the following examples were performed three times unless otherwise specified, and the results were averaged.

[0028] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0029] The embodiments described below are some embodiments of the present invention, rather than all embodiments, and they should not be understood as limiting the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0030] Example 1: Preparation of a recyclable biochip (1) Slide preparation: Select a clean 75 mm × 25 mm slide for subsequent experimental operations.

[0031] (2) Surface cleaning: First, clean the glass slide in acetone to remove oil and impurities on the surface. Then, soak the glass slide in a cleaning agent (1 g Alnocox dissolved in 100 mL water) and ultrasonically treat for 5 min. This step is repeated twice to ensure thorough cleaning. After cleaning, dry the glass slide at 80 °C for 1 h to remove residual moisture.

[0032] (3) Plasma cleaning: Turn on the gas cylinder and the power of the equipment in turn, and place the prepared slide in the plasma cleaning machine (Nane Technology-NE-PE05F). Turn on the radio frequency and vacuum system, and treat the slide with plasma. Set the power to 130 W, the nitrogen flow rate to 10 mL / h, and the treatment time to 180 s to further clean the surface of the slide and improve its activity.

[0033] (4) Functional modification: Prepare a 1% (3-mercaptopropyl) triethoxysilane acetonitrile solution, immerse the treated glass slide in it, and react at room temperature (25°C) in the dark for 24 h to obtain a functionally modified biochip (the functional modification process is as follows Figure 1 as shown).

[0034] Example 2: Preparation of a recyclable biochip stationary phase (1) Coupling initiator chain: The functionalized modified biochip prepared in Example 1 was manually cut into small pieces of 4 mm×4 mm, and then the single-chain oligo (1 μL, 2.5 μmol / L) with a disulfide bond modified at the 5' end was dropped on the above biochip (4 mm×4 mm) in a spotting manner, and placed in a wet box (humidity 70%-80%) for 15 h at 25°C. After the reaction, the biochip was rinsed with water twice and then dried with nitrogen to obtain a recyclable biochip stationary phase. It was placed under a fluorescence microscope for observation. Figure 2 This is the fluorescence image after coupling the initiator chain.

[0035] The nucleotide sequence of the initiating chain (sequence I) is as follows: 5'-TTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3'; The single-chain oligo with a disulfide bond modified at the 5' end refers to a single-chain oligo with a disulfide bond modified at the 5' end.

[0036] (2) Hybridization of fluorescent complementary chains: The biochip stationary phase prepared in step (1) was immersed in eight consecutive centrifuge tubes containing fluorescent complementary chains (100 μL, 0.5 μmol / L) to perform hybridization experiments. After hybridization was completed, the biochip was washed twice with 0.1 mol / L sodium chloride solution and then dried with nitrogen gas. The biochip was then observed under a fluorescence microscope. Figure 3 This is the fluorescence image after hybridization of fluorescent complementary chains.

[0037] The nucleotide sequence of the fluorescent complementary chain is as shown in sequence II; the specific fluorescent complementary chain is as follows: 5'-TCAAGTCGCGTAGGAGTCTCTAGCC-3'-CY3.

[0038] Example 3: Recyclable application of biochip stationary phase (1) First cycle: The stationary phase of the hybridized biochip of Example 2 was immersed in 1 M TCEP reducing agent (Aladdin, catalog number: T107252) and reacted at 60°C for 1 h. After that, it was rinsed with water twice and dried with nitrogen gas, and its fracture was observed under a fluorescence microscope. Figure 4 (A) is the fluorescence image after TCEP treatment.

[0039] (2) Hybridization verification: The biochip stationary phase treated with TCEP in step (1) above was immersed in eight consecutive centrifuge tubes containing fluorescent complementary chains (100 μL, 0.5 μmol / L) and hybridization experiments were performed again. After hybridization was completed, the biochip was washed twice with 0.1 mol / L sodium chloride solution and dried with nitrogen gas, and then observed under a fluorescence microscope. Figure 4 (B) is the fluorescence image after hybridization of the complementary fluorescent chain. The results show that the covalent bonds on the surface of the stationary phase are successfully broken and complementary hybridization cannot be performed on its surface.

[0040] (3) Secondary spotting: Repeat the operation of coupling the initiator chain in Example 2 on the biochip stationary phase treated with TCEP in step (1) above, and then observe it under a fluorescence microscope. Figure 4 (C) in the figure is the fluorescence image after secondary coupling initiation chain.

[0041] (4) Secondary hybridization: Repeat the above step (2) with the biochip stationary phase that is secondarily coupled to the initiating chain in step (3). Figure 4 (D) is the fluorescence image after hybridization of the complementary fluorescent chain. The results show that the covalent bonds on the surface of the stationary phase were successfully restored and the stationary phase can be successfully recycled.

[0042] (5) Second cycle: Repeat the above step (1) with the biochip stationary phase of the second hybridization in step (4). Figure 5(A) is the fluorescence image after TCEP treatment.

[0043] (6) Hybridization verification: Repeat the above step (2) on the biochip stationary phase treated with TCEP in the above step (5), and then observe it under a fluorescence microscope. Figure 5 (B) is the fluorescence image after hybridization of the fluorescent complementary chain. The results show that the covalent bonds on the surface of the stationary phase are successfully broken and complementary hybridization cannot be carried out on its surface.

[0044] (7) Three-time spotting: Repeat the operation of coupling the initiator chain in Example 2 on the biochip stationary phase treated with TCEP in step (5) above, and then observe it under a fluorescence microscope. Figure 5 (C) in the figure is the fluorescence image after three coupling initiation chains.

[0045] (8) Third hybridization: Repeat the above step (2) with the biochip stationary phase of the third coupling of the initiator chain in step (7). Figure 5 (D) is the fluorescence image after hybridization of the complementary fluorescent chain. The results show that the covalent bonds on the surface of the stationary phase were successfully restored and the stationary phase can be successfully recycled.

[0046] The nucleotide sequence of the priming strand and the nucleotide sequence of the fluorescent complementary strand used in this example are the same as those in Example 2.

[0047] Example 4: Recyclable biochip stationary phase for enzymatic DNA synthesis DNA synthesis was performed on a DNA synthesizer using the biochip stationary phase prepared in step (1) of Example 2. The nucleotide sequence of the synthesized DNA (sequence III) was: TAGGTATATATGTGCCATGGTGGTTTGTTGCACCCATCAACCCTTCATCTACATTAGGTA; the specific steps were to use TdT enzyme and dNTP with protected bases to perform enzyme-catalyzed chain extension reaction at the end of the initiating chain, and then use a deprotection solution to elute the protective group on the base, and multiple cycles to achieve enzymatic synthesis of the target DNA sequence. The synthesis steps are as follows: Steps: (1) Using TdT enzyme and dNTP with protected bases to perform enzymatic DNA synthesis based on a biochip, the enzyme reaction system is shown in Table 1.

[0048]

[0049] The enzyme reaction conditions are 30°C and the reaction time is 5-10 min.

[0050] (2) Use a deprotection solution (0.3 M sodium nitrite solution) to elute the protected bases, and repeat multiple cycles to achieve enzymatic synthesis of the target DNA sequence.

[0051] (3) Perform PCR amplification on the target DNA sequence synthesized based on the biochip, perform agarose gel electrophoresis on the PCR amplification product, recover the target electrophoresis band and perform sequencing analysis on it.

[0052] (4) The synthesized product was subjected to second generation sequencing analysis. As shown in Table 2, the sequencing results of the first synthesis showed that the yield could reach 60% and the accuracy could reach 99.17%.

[0053] (5) The chip after the first synthesis was cut (step 1 of example 3) and inoculated (step 3 of example 3) according to the method of example 3, and then the second and third syntheses (same sequence) were performed. The sequencing results showed that the synthesis accuracy did not decrease significantly after multiple uses, proving the recyclable nature of the chip.

[0054] (Accuracy calculation formula: Accuracy = ).

[0055] .

Claims

1. A method for preparing a biochip stationary phase, comprising the following steps: (1) treating a glass slide with plasma, and then placing the glass slide in a silane coupling agent solution for reaction, so that the silane coupling agent is covalently bonded to the glass slide, thereby obtaining a functionally modified biochip; (2) Combining the 5'-end modified single-stranded oligo with the functionally modified biochip to obtain the biochip stationary phase.

2. The preparation method according to claim 1, characterized in that: In step (1), the plasma treatment time is 1-500 s; The power of the plasma treatment is 30-160 W; The working gas for the plasma treatment is selected from any one of nitrogen, oxygen, argon and air; The flow rate of the working gas for the plasma treatment is 10 to 100 mL / h; The silane coupling agent is selected from at least one of (3-mercaptopropyl)triethoxysilane, mercaptopropylmethyldimethoxysilane and (3-mercaptopropyl)trimethoxysilane; The volume percentage concentration of the silane coupling agent solution is 1%-20%; The reaction time is 2h-24h; The reaction temperature is 20°C-60°C.

3. The preparation method according to claim 1, characterized in that: The modified group at the 5' end of the single-chain oligo is a disulfide bond; The nucleotide sequence of the single-stranded oligo is as follows: 5'-TTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3'; The 5'-end modified single-stranded oligo is combined with the functionally modified biochip by spotting; The spotting concentration of the 5'-end modified single-stranded oligo is 1-10 μmol / L; The spotting volume of the 5'-end modified single-stranded oligo is 1-5 μL; The time for the 5'-end modified single-stranded oligo to combine with the functionally modified biochip is 6 h-24 h; The temperature for combining the 5'-end modified single-stranded oligo with the functionally modified biochip is 20° C.-60° C., and the ambient humidity is 70%-80%.

4. The preparation method according to any one of claims 1 to 3, characterized in that: The preparation method further comprises the step of cleaning the glass slide before treating the glass slide with plasma; The cleaning step comprises the following steps: placing the glass slide in an organic solvent for cleaning, then soaking the glass slide in a glass cleaning agent for ultrasonic treatment, and drying.

5. The biochip stationary phase prepared by the preparation method according to any one of claims 1 to 4.

6. Use of the biochip stationary phase according to claim 5 in synthesizing DNA.

7. A method for synthesizing DNA, comprising the following steps: synthesizing DNA using an enzymatic method using the biochip stationary phase as described in claim 5.

8. The method for recycling the stationary phase of a biochip according to claim 5, comprising the following steps: The used biochip stationary phase is immersed in a reducing agent for reaction, and then the 5'-end modified single-stranded oligo is combined with the biochip stationary phase treated with the reducing agent to achieve the recycling of the biochip stationary phase.

9. The recycling method according to claim 8, characterized in that: The reducing agent is at least one of tris(2-carboxyethyl)phosphine, dithiothreitol, mercaptoethanol and dithioerythritol; The solution concentration of the reducing agent is 10 mM-2 M; The reaction temperature is 20°C-80°C, and the reaction time is 0.5 h-6 h.

10. The recycling method according to claim 8 or 9, characterized in that: The 5'-end modification group of the single-chain oligo is a disulfide bond; The nucleotide sequence of the single-stranded oligo is as follows: 5'-TTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3'; The 5'-end modified single-stranded oligo is combined with the functionally modified biochip by spotting; The spotting concentration of the 5'-end modified single-stranded oligo is 1-10 μmol / L; The spotting volume of the 5'-end modified single-stranded oligo is 1-5 μL; The time for the 5'-end modified single-stranded oligo to combine with the functionally modified biochip is 6-24 hours; The temperature for combining the 5'-end modified single-stranded oligo with the functionally modified biochip is 20° C.-60° C., and the ambient humidity is 70%-80%.

Images