Amylase signal peptide variant and application thereof

Abstract

The invention discloses an amylase signal peptide variant mutant SEQ ID NO: 2 or 3 generated by utilizing a natural language model, a coding gene of the amylase signal peptide variant mutant SEQ ID NO: 2 or 3 is fused with a bovine lactoferrin gene or thaumatin gene and is expressed in aspergillus, the secretory expression of bovine lactoferrin and / or thaumatin by the aspergillus can be improved, and the production economy of the bovine lactoferrin or thaumatin is enhanced.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to an amylase signal peptide variant and application thereof in improving the secretion and expression of bovine lactoferrin and / or thaumatin by Aspergillus. Background Art

[0002] Bovine lactoferrin (BLF) and thaumatin (Thaumatin) have broad application prospects in the pharmaceutical, food, cosmetic and other industries. The production of bovine lactoferrin and thaumatin by fermentation of microbial engineering bacteria is a promising method. The patent document with publication number CN1171815A discloses the genetic engineering technology of fermentation of lactoferrin by Aspergillus genus, especially Aspergillus awamori, Aspergillus niger and Aspergillus oryzae engineering bacteria. However, its efficient secretory expression in microbial expression system has always been a key problem limiting its large-scale production and application.

[0003] Signal peptides, as key elements for guiding protein secretion, play an important role in the secretion efficiency of proteins. For example, the patent document with publication number CN104004760A discloses that an Aspergillus oryzae genetically engineered bacterium into which a signal peptide coding sequence for promoting the expression of foreign proteins is introduced can secrete and express foreign acidic and neutral amylase proteins; the patent document with publication number CN107353327A discloses that an Aspergillus niger engineered bacterium into which an Aspergillus oryzae TAKA amylase signal peptide gene and an Escherichia coli phytase gene are introduced can secrete and express phytase in large quantities.

[0004] Traditional signal peptide optimization methods are often based on limited experimental attempts and known biological rules, and have certain blindness and limitations.

[0005] With the development of artificial intelligence technology, natural language models have shown great potential in biological sequence analysis and design. By learning from a large amount of biological sequence data, natural language models can dig out the potential rules and patterns hidden in the sequence, thus providing new ways and methods for generating signal peptide variants with excellent performance, which is expected to break through the bottleneck of traditional signal peptide optimization and achieve a significant improvement in protein secretion expression efficiency. Summary of the invention

[0006] We used the natural language model to generate a large number of amylase signal peptide variants, and fused them in front of the bovine lactoferrin or thaumatin gene. By expressing them in Aspergillus niger or Aspergillus oryzae, we screened out several amylase signal peptide variants that can significantly improve the secretion expression level of these two target proteins at the same time, which helps to reduce the fermentation production cost of these two proteins. The present invention expands the application scope of the natural language model and also provides examples and practical experience for innovation of genetic engineering technology based on artificial intelligence. Therefore, the present invention includes the following technical solutions.

[0007] The first aspect of the present invention provides an amylase signal peptide variant, which is a polypeptide selected from the following:

[0008] (a) a polypeptide having an amino acid sequence of MMVAWWSLFLYGLAVAAPALAA (SEQ ID NO: 2), which is a Q14A mutant of an α-amylase signal peptide having an amino acid sequence of MMVAWWSLFLYGLQVAAPALAA (SEQ ID NO: 1) derived from Aspergillus oryzae, and is designated herein as SP2;

[0009] (b) A polypeptide having an amino acid sequence of MMVAWWSLFLLGLQVAAPALAA (SEQ ID NO: 3), which is a Y11L mutant of the α-amylase signal peptide having an amino acid sequence of MMVAWWSLFLYGLQVAAPALAA (SEQ ID NO: 1) derived from Aspergillus oryzae, and is designated herein as SP3.

[0010] The second aspect of the present invention provides genes encoding the amylase signal peptide variants SP2 and SP3.

[0011] In one embodiment, the gene encoding the amylase signal peptide variant SEQ ID NO:2, i.e., SP2, is a polynucleotide having a nucleotide sequence of SEQ ID NO:4, or a polynucleotide having a homology of more than 90%, preferably more than 92%, preferably more than 95%, more preferably more than 97%, more preferably more than 98%, more preferably more than 99% to SEQ ID NO:4;

[0012] The gene encoding the amylase signal peptide variant SEQ ID NO:3, i.e., SP3, is a polynucleotide shown in the nucleotide sequence SEQ ID NO:5, or a polynucleotide having more than 90%, preferably more than 92%, preferably more than 95%, more preferably more than 97%, more preferably more than 98%, and more preferably more than 99% homology with SEQ ID NO:5.

[0013] Another aspect of the present invention provides a DNA molecule comprising the gene as described above, for example, an expression cassette / expression frame of the amylase signal peptide variant SEQ ID NO: 2 or SEQ ID NO: 3.

[0014] Another aspect of the present invention provides the use of the above-mentioned amylase signal peptide variants SP2 and SP3 or the genes encoding them in improving the secretory expression of bovine lactoferrin and / or thaumatin by Aspergillus.

[0015] Preferably, the Aspergillus is Aspergillus niger, such as Aspergillus niger ATCC1015, or Aspergillus oryzae, such as Aspergillus oryzae ATCC11488.

[0016] In a preferred embodiment, the gene encoding the above-mentioned amylase signal peptide variant SP2 or SP3 is fused with the bovine lactoferrin gene or the thaumatin gene and expressed in Aspergillus.

[0017] Optionally, the nucleotide sequence of the bovine lactoferrin gene is SEQ ID NO: 6;

[0018] The nucleotide sequence of the thaumatin gene is SEQ ID NO:7.

[0019] Another aspect of the present invention provides an integration fragment for expressing bovine lactoferrin or thaumatin in Aspergillus, which comprises the coding gene of the above-mentioned amylase signal peptide variant SP2 or SP3 and the above-mentioned bovine lactoferrin gene located downstream, or

[0020] The coding gene of the above-mentioned amylase signal peptide variant SP2 or SP3 and the above-mentioned thaumatin gene located downstream.

[0021] Another aspect of the present invention provides an engineered Aspergillus niger or Aspergillus oryzae for producing bovine lactoferrin, wherein the above-mentioned integration fragment is integrated into the genome.

[0022] For example, the above-mentioned Aspergillus niger engineered bacteria or Aspergillus oryzae engineered bacteria can be constructed by a method comprising the following steps:

[0023] 1) Fusion gene construction: Use gene editing technology (such as Gibson assembly method or traditional restriction endonuclease digestion-ligation method or overlap PCR technology) to fuse the amylase signal peptide variant gene sequence with the bovine lactoferrin gene or thaumatin gene; ensure the accuracy and stability of the fusion site.

[0024] 2) Expression fragment construction: The constructed fusion gene is inserted into the promoter, terminator and selection marker suitable for Aspergillus, preferably Aspergillus niger or Aspergillus oryzae, and should contain a strong promoter (such as saccharifying enzyme promoter, gpd promoter, etc.), an efficient terminator, a suitable screening marker (such as antibiotic resistance gene) and elements that are conducive to gene expression regulation (such as enhancers, silencers, etc.). The correctness of the expression vector construction is verified by enzyme digestion identification and sequencing to ensure that the fusion gene is correctly inserted into the appropriate position of the vector and that other elements of the vector are intact.

[0025] 3) Preparation and transformation of Aspergillus cell protoplasts: Take Aspergillus, preferably Aspergillus niger or Aspergillus oryzae cells, and use a suitable enzymatic hydrolysis method (such as snail enzyme, cellulase, etc.) to prepare protoplasts; optimize the enzymatic hydrolysis conditions (such as enzyme concentration, enzymatic hydrolysis time, temperature, osmotic pressure stabilizer, etc.) to obtain high-activity and high-yield protoplasts. Then, the recombinant plasmid constructed in step 2) is introduced into the protoplasts by PEG-mediated protoplast transformation, and cultured on a regeneration medium containing a corresponding selection marker (such as antibiotic resistance) to screen out preliminary transformants;

[0026] 4) Identification and verification of transformants: The transformants screened in step 3) are amplified using PCR technology to detect whether the fusion gene is successfully integrated into the host genome. The expression level and secretion of the target protein, i.e., bovine lactoferrin or thaumatin, are detected by Western blot technology or enzyme-linked immunosorbent assay (ELISA) to ensure that the transformants can stably and efficiently express and secrete the target protein.

[0027] Another aspect of the present invention provides use of the above-mentioned engineered Aspergillus niger or engineered Aspergillus oryzae in producing bovine lactoferrin or thaumatin.

[0028] Experimental data show that compared with the control group using the wild-type amylase signal peptide (SP0) or without signal peptide optimization, the amylase signal peptide variant SP2 or SP3 fusion strategy generated by the natural language model of the present invention can increase the secretory expression level of bovine lactoferrin in Aspergillus engineered bacteria by more than 191%, and the secretory expression level of thaumatin by more than 44%, effectively improving the fermentation production efficiency of bovine lactoferrin and thaumatin, and laying the foundation for industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is an agarose gel electrophoresis photograph of the integration of the fusion gene of the amylase signal peptide variant SP2 or SP3 and bovine lactoferrin into the genome of Aspergillus niger or Aspergillus oryzae using PCR. This image is a validation diagram of the integration of the lactoferrin expression cassette sequence AoBLF, primer Pamy2-F / TglaA (Ptub)-R, and the positive band is about 3kb. In the figure, lanes 1-8 are based on Aspergillus niger transformants as templates, wherein lanes 1-4 are SP2-fused bovine lactoferrin expression cassette transformants, and lanes 5-8 are SP3-fused bovine lactoferrin expression cassette transformants; lanes 9-16 are based on Aspergillus oryzae transformants as templates, wherein lanes 9-12 are SP2-fused bovine lactoferrin expression cassette transformants, and lanes 13-16 are SP3-fused bovine lactoferrin expression cassette transformants.

[0030] Figure 2It is a photo of agarose gel electrophoresis using PCR to detect the integration of the fusion gene of amylase signal peptide variant SP2 or SP3 and thaumatin into the genome of Aspergillus niger or Aspergillus oryzae. This image is a verification diagram of the integration of the thaumatin expression cassette AoTha, primer Pamy2-F / TglaA (Ptub)-R, and the positive band is about 1.5kb. In the figure, lanes Lane 1-8 are based on Aspergillus niger transformants as templates, and lanes 9-16 are based on Aspergillus oryzae transformants as templates. Lanes 1-8 are based on Aspergillus niger transformants as templates, wherein lanes 1-4 are SP2 fusion thaumatin expression cassette transformants, and lanes 5-8 are SP3 fusion thaumatin expression cassette transformants; lanes 9-16 are based on Aspergillus oryzae transformants as templates, wherein lanes 9-12 are SP2 fusion thaumatin expression cassette transformants, and lanes 13-16 are SP3 fusion thaumatin expression cassette transformants.

[0031] Figure 3 This is the color development photo and standard curve of the Histag ELISA kit standard sample. DETAILED DESCRIPTION

[0032] In order to improve the fermentation level of bovine lactoferrin and thaumatin, we chose the improvement of amylase signal peptide as a breakthrough. Therefore, according to the set optimization goals, namely improving the secretion efficiency in Aspergillus niger or Aspergillus oryzae, enhancing the compatibility of signal peptide and target protein, etc., a series of amylase signal peptide variant sequences were generated using the trained natural language model. Through the prediction function of the model, the generated variant sequences were preliminarily screened, and sequences with higher potential for secretion efficiency improvement were selected for subsequent experimental verification.

[0033] Based on bioinformatics statistics, we determined to modify the amino acid sequence of the wild-type α-amylase signal peptide from Aspergillus oryzae (herein numbered SP0, with an amino acid sequence of SEQ ID NO: 1), in the hope of enhancing the secretory expression of exogenous bovine lactoferrin and / or thaumatin by Aspergillus niger and / or Aspergillus oryzae.

[0034] As used herein, the terms "(bovine lactoferrin / thaumatin fermentation level) increase", "elevate", "enhance" or "increase" as used above mean an increase of at least 20% or more compared to a reference level, for example, an increase of at least 30% or more, at least 50% or more, at least 80% or more, at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, or at least about 5-fold compared to a reference level.

[0035] As used herein, the term "and / or" as used in the terms "A and / or B", "A and / or B", is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0036] An effective method for achieving co-expression of amylase signal peptide variants and bovine lactoferrin or thaumatin in Aspergillus is to use fusion gene expression, that is, to form a fusion gene by combining the amylase signal peptide variant encoding gene with the bovine lactoferrin gene or thaumatin gene located downstream.

[0037] The construction of the fusion gene first involves gene cloning and modification, and the bovine lactoferrin gene and thaumatin gene are amplified by PCR technology, while the amylase signal peptide variant sequence obtained by screening is amplified. During the amplification process, a suitable restriction endonuclease recognition site is introduced in the primer design for subsequent gene connection operations. The amplified gene fragment is purified and quantitatively analyzed. Then the fusion gene is constructed, and the amylase signal peptide variant sequence is fused with the bovine lactoferrin or thaumatin gene using gene editing techniques such as the Gibson assembly method, Overlap-PCR technology or traditional restriction endonuclease digestion-connection method to ensure the accuracy and stability of the fusion site. In the design of the fusion gene, the connecting peptide sequence between the signal peptide and the target protein is considered, and the appropriate amino acid residues are selected to form the connecting peptide to ensure that the signal peptide can effectively guide the secretion of the target protein without affecting the functional structure of the target protein. Finally, the fusion gene fragment is constructed and further fused with a strong promoter (such as a saccharifying enzyme promoter, a gpd promoter, etc.), an efficient terminator, a suitable screening marker (such as an antibiotic resistance gene), and elements that are conducive to gene expression regulation (such as enhancers, silencers, etc.) to form an expression cassette. The correctness of the expression vector construction was verified by enzyme digestion identification and sequencing to ensure that the fusion gene was correctly inserted into the appropriate position of the vector and that the other elements of the vector were intact.

[0038] We used the trained natural language model to generate a series of amylase signal peptide variant sequences and experimentally verified these variant sequences. First, host cell transformation and screening were carried out, protoplasts were prepared and transformed. For Aspergillus niger or Aspergillus oryzae, appropriate enzymatic hydrolysis methods (such as snail enzyme, cellulase, etc.) were used to prepare protoplasts, and enzymatic hydrolysis conditions (such as enzyme concentration, enzymatic hydrolysis time, temperature, osmotic pressure stabilizer, etc.) were optimized to obtain protoplasts with high activity and high yield. The constructed recombinant expression vector was introduced into Aspergillus niger or Aspergillus oryzae protoplasts by PEG-mediated protoplast transformation, and cultured on a regeneration medium containing corresponding screening markers (such as antibiotic resistance) to screen out preliminary transformants. Then, the transformants were identified and verified, and the transformants obtained by preliminary screening were amplified by PCR technology to detect whether the fusion gene was successfully integrated into the host genome. The expression level and secretion of the target protein (bovine lactoferrin or thaumatin) were further detected by Western blot technology or enzyme-linked immunosorbent assay (ELISA) to ensure that the transformants can stably and efficiently express and secrete the target protein.

[0039] After experimental comparison, it was found that two variants of wild amylase signal peptide, SP2 (SEQ ID NO: 2) and SP3 (SEQ ID NO: 3), were relatively ideal mutants.

[0040] The amylase signal peptide variants SP2 and SP3 of the present invention both have only 22 amino acids, and the amino acid sequences of bovine lactoferrin and thaumatin are clear, so those skilled in the art can easily obtain fusion genes, expression cassettes (DNA molecules) and plasmids containing these fusion genes, and transformants containing the plasmids. These fusion genes, expression cassettes, plasmids, and transformants can be obtained by genetic engineering construction methods well known to those skilled in the art.

[0041] The present invention also achieves the following beneficial effects:

[0042] Innovative signal peptide optimization method. This invention applies the natural language model to the generation of amylase signal peptide variants for the first time, breaking through the limitations of traditional signal peptide optimization methods and opening up a new way for the optimization design of biological signal peptide sequences. It has important theoretical innovation significance and broad application potential, and is expected to promote technological development in the field of genetic engineering.

[0043] The production cost of bovine lactoferrin and thaumatin by fermentation is reduced, and the application prospect is expanded. The efficient secretory expression of bovine lactoferrin and thaumatin significantly reduces the cost and difficulty of separation and purification of downstream products. At the same time, Aspergillus niger or Aspergillus oryzae as hosts have the advantages of easy cultivation, rapid growth, low fermentation cost, etc., which further reduces the production cost and improves the market competitiveness of the product. The present invention provides a reliable technical guarantee for the wide application of bovine lactoferrin and thaumatin in the fields of food, medicine, cosmetics, etc., and also provides a useful reference and reference for the efficient production of other bioactive substances.

[0044] The present invention is further described in detail below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0045] Example

[0046] The examples involve the addition amounts, contents and concentrations of various substances, wherein the percentages described therein, unless otherwise specified, are all by mass percentages.

[0047] In the examples herein, if no specific description is given for laboratory temperature or operating temperature, the temperature generally refers to room temperature (15-30° C.).

[0048] Materials and methods

[0049] The whole gene synthesis, primer synthesis and sequencing in the examples were all completed by Suzhou Genewise Biotechnology Co., Ltd.

[0050] The molecular biology experiments in the embodiments include plasmid construction, enzyme digestion, ligation, competent cell preparation, transformation, culture medium preparation, etc., and are mainly carried out with reference to Molecular Cloning Experiment Guide (3rd edition), edited by J. Sambrook and DW Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002). If necessary, the specific experimental conditions can be determined by simple experiments.

[0051] PCR amplification experiments were performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. If necessary, adjustments could be made through simple experiments.

[0052] The strains used included Aspergillus niger ATCC1015 and Aspergillus oryzae ATCC11488, both of which were purchased from the American Type Culture Collection (ATCC).

[0053] The experimental steps include:

[0054] 1. Natural language model construction and signal peptide variant generation

[0055] 1. Data collection and organization: A large number of amylase gene sequences and related functional data were collected from public databases (such as GenBank, Uniprot, etc.) and published literature, and cleaned, denoised and standardized to build a high-quality biological sequence database. Finally, the α-amylase signal peptide (SEQ ID NO: 1) from Aspergillus oryzae was selected to promote the secretory expression of bovine lactoferrin and thaumatin in Aspergillus, referred to as SP0.

[0056] 2. Model training: Select a suitable natural language model architecture (such as the Transformer model and its variants), use the preprocessed database as training data, and train the model. During the training process, optimize the model's hyperparameters, such as learning rate, batch size, number of iterations, etc., to improve the accuracy and generalization ability of the model.

[0057] 3. Generation of signal peptide variants: Based on the preset optimization goal (improving the expression of bovine lactoferrin and thaumatin in Aspergillus) and constraints, a series of amylase signal peptide variant sequences were generated using the trained natural language model. The generated sequences were preliminarily screened to remove sequences that clearly did not conform to biological rules and requirements, and candidate sequences with potential application value were retained for subsequent experimental verification.

[0058] 2. Gene fusion and expression vector construction

[0059] 4. Gene cloning: The bovine lactoferrin and thaumatin genes and the screened amylase signal peptide variant sequences including SP1-SP6 were obtained by PCR amplification technology, and homologous regions were introduced into the primer design to facilitate the subsequent gene connection operation.

[0060] 5. Construction of fusion gene: Use overlap extension PCR technology to fuse the amylase signal peptide variant with the bovine lactoferrin or thaumatin gene, design and introduce an optimized linker peptide coding sequence at the fusion site to ensure the integrity and correctness of the fusion gene.

[0061] 6. Construction of recombinant non-expression cassette: The correctly sequenced fusion gene will be further fused with other elements (such as promoter, terminator, selection marker, etc.) to form an expression cassette.

[0062] 3. Host cell transformation and screening

[0063] 7. Protoplast preparation: For Aspergillus niger or Aspergillus oryzae, use enzymatic hydrolysis methods (such as snail enzyme, cellulase, etc.) to prepare protoplasts, optimize enzymatic hydrolysis conditions (such as enzyme concentration, enzymatic hydrolysis time, temperature, osmotic pressure stabilizer, etc.) to obtain protoplasts with high activity and high yield.

[0064] 8. Transformation operation: The constructed recombinant expression vector is introduced into the protoplasts of Aspergillus niger or Aspergillus oryzae by PEG-mediated protoplast transformation, and cultured on a regeneration medium containing a corresponding selection marker (such as an antibiotic resistance gene) to screen out preliminary transformants.

[0065] 9. Identification of transformants: Use PCR technology to amplify the transformants obtained from the preliminary screening to detect whether the fusion gene has been successfully integrated into the host genome.

[0066] 4. Fermentation culture and detection

[0067] 10. Fermentation with engineered bacteria: The correctly identified positive transformants, i.e., engineered Aspergillus niger and engineered Aspergillus oryzae, are inoculated into a fermentation medium for fermentation.

[0068] 11. Product detection: During the fermentation process of the engineered Aspergillus niger and Aspergillus oryzae, samples were taken regularly, and the expression level of bovine lactoferrin was detected by enzyme-linked immunosorbent assay (ELISA) or Western blot to evaluate the expression effect and secretion of the fusion gene in Aspergillus niger or Aspergillus oryzae.

[0069] Example 1: Construction of integration fragments

[0070] The amylase promoter and the synthetic amylase signal peptide or its variant, as well as bovine lactoferrin, the label histag, the termination sequence and the selection marker amdS gene are spliced ​​by overlap. The wild-type amylase signal peptide is an α-amylase signal peptide derived from Aspergillus oryzae, with an amino acid sequence of MMVAWWSLFLYGLQVAAPALAA (SEQ ID NO: 1), which is named SP0 herein.

[0071] The PCR amplification primers for some gene fragments in this example are listed in Table 1.

[0072] Primer Sequence(5’-3’) Pamy2-F agaattcatggtgttttgatc Pamy2(AoB)-R tgggagatggtgcaccagcgcacattcttacgtggagctgcagccaaagcaggtgccgc AoBLF-F gctccacgtaagaatgtgcgctg AoBLF(TglaA)-R cgaaatggattgattgtttagtgatgatggtgatgatggcgggtcaggaaggcgcaagc TglaA(AoB)-F gccttcctgacccgccatcatcaccatcatcactaaacaatcaatccatttcgctatag TglaA(Ptub)-R ttacatcccaaaaagcatcaccaccatcaccatcaccggtgtctgtatttccggatatc Ptubulin(T)-F ccgacggaattgaggatatccggaaatacagacaccggtgatggtgatggtggtgatgc Ptubulin-R gcttatcagcggccagttcttcccaggattgaggcattgtgccgggtagattgaagggg amdS-F tttcaataccttcaaccccttcaatctacccggcacaatgcctcaatcctgggaagaac amdS-R gcgtgaatgtaagcgtgacataactaattacatgactatggagtcaccacatttcccag Tcyc(amdS)-F gtggggaagttgctgggaaatgtggtgactccatagtcatgtaattagttatgtcacgc Tcyc1-R cttgcatgcaggcctctgcagtcgacgggcccgggatccgcaaattaaagccttcgagc Pamy2(AoT)-R acggtgtagctacaacggttgacaatctcaaatgtcgctgcagccaaagcaggtgccgc AoTha-F gcgacatttgagattgtcaac AoTha(TglaA)-R cgaaatggattgattgtttagtgatgatggtgatgatgcgccgtggggcagaaggtgac TglaA(AoT)-F ttctgccccacggcgcatcatcaccatcatcactaaacaatcaatccatttcgctatag

[0073] In Table 1, "-F" in the name stands for forward direction; "-R" stands for reverse direction.

[0074] Some gene sequences in this example are listed in Table 2.

[0075]

[0076]

[0077]

[0078]

[0079] Using the gene-synthesized amylase promoter and signal peptide (Aspergillus oryzae alpha-amylase II promoter + signal peptide sequence in Table 2) as a template and Pamy2-F / Pamy2(AoB)-R as primers, PCR amplification was performed to obtain the Pamy2 fragment. Using the gene-synthesized bovine lactoferrin (the codon-optimized BLF genefragment sequence in Table 2, i.e., SEQ ID NO: 6) as a template and AoBLF-F / AoBLF(TglaA)-R as primers, PCR amplification was performed to obtain the AoBLF fragment. Using the Aspergillus niger CBS513.88 genome as a template and TglaA(AoB)-F / TglaA(Ptub)-R as primers, PCR amplification was performed to obtain the TglaA fragment. The PCR fragment was recovered using a gel recovery kit. 1 μl of each of the three PCR products (Pamy2, AoBLF, TglaA) was mixed as a template, and Pamy2-F / TglaA(Ptub)-R was used as primers to perform Overlap PCR amplification to obtain the Pamy2-AoBLF-TglaA fragment.

[0080] Using the genome of Aspergillus niger CBS513.88 as a template and Ptubulin(T)-F / Ptubulin-R as primers, PCR amplification was performed to obtain the Ptubulin fragment. Using the genome of Aspergillus nidulans as a template and amdS-F / amdS-R as primers, PCR amplification was performed to obtain the amdS fragment. Using the genome of Saccharomyces cerevisiae as a template and Tcyc(amdS)-F / Tcyc1-R as primers, PCR amplification was performed to obtain the Tcyc1 fragment. The PCR fragments were recovered using a gel recovery kit. 1 μl of each of the three PCR products (Ptubulin, amdS, Tcyc1) was mixed as a template, and Ptubulin(T)-F / Tcyc1-R was used as primers to perform Overlap PCR amplification to obtain the Ptubulin-amdS-Tcyc1 fragment.

[0081] 1 μl of the above PCR products Pamy2-AoBLF-TglaA and Ptubulin-amdS-Tcyc1 were mixed as templates, and Pamy2-F / Tcyc1-R were used as primers to perform Overlap PCR amplification to obtain the final fragment for integration, i.e., the integration fragment of the fusion gene of the wild amylase signal peptide SP0 and bovine lactoferrin located downstream thereof: Pamy2-AoBLF-TglaA-Ptubulin-amdS-Tcyc1.

[0082] Example 2: Transformation and selection of positive clones

[0083] Spores of Aspergillus niger CBS513.88 or Aspergillus oryzae Rib40 were inoculated from glycerol stock onto potato dextrose agar (PDA) plates (potato 200 g / L, glucose 20 g / L, agar powder 15 g / L) and cultured at 30°C for 4-5 days to promote mycelial growth and spore production. Fresh spores were eluted with 0.85% sodium chloride and 0.02% Tween 80. The spore suspension was diluted to 2 × 10 8 The spores were inoculated into 250 ml of liquid complete medium (CM) at a concentration of 1000 spores / ml and cultured overnight (16-18 hours) at 30°C and 50 rpm. The germinated spores were collected by filtration through three layers of mirabilite (pre-cut and sterilized, purchased from Millipore), washed with SMC solution (1.33 mol / L sorbitol, 50 mmol / L calcium chloride, 20 mmol / L MES buffer, pH 5.8), and then digested with enzyme solution (200 mg lyase plus 10 ml SMC solution) at 30°C and 75 rpm rotary shaking for 3 hours. During the digestion process, the quality and quantity of the protoplasts can be checked by microscopy. Before collecting the protoplasts, 10 ml of STC solution (1.33 mol / L sorbitol, 50 mmol / L calcium chloride, 10 mmol / L tris / hydrochloric acid, pH 7.5) was added to increase the amount of protoplasts released. The digested protoplasts were filtered through three layers of Mirab to separate them from the cell wall debris, and the filtrate was centrifuged at 10°C and 3500 rpm for 10 minutes. The supernatant was discarded, and the protoplasts were washed 1-2 times with 1 ml of STC solution at 10°C and 4500 rpm for 5 minutes each time, and then the protoplasts were resuspended in STC solution. The volume of STC solution was set according to the number of transformations (100 μl for each transformation), and the final concentration of protoplasts should exceed 7×10 6 / ml. Prepare several 50 ml sterile centrifuge tubes according to the number of transformation experiments. For each transformation, add 100 μl of protoplast suspension, 8-10 μg of plasmid DNA and 25 μl of polyethylene glycol 6000 (25% polyethylene glycol 6000, dissolved in a 65°C water bath for 10 minutes) to an empty 50 ml centrifuge tube and mix gently. Subsequently, add 1 ml of polyethylene glycol 6000 and mix it evenly into the mixture. Then, place the centrifuge tube on ice and incubate for 5 minutes. Add 2 ml of STC solution to the suspension and mix it slightly. Next, add 10 ml of the upper culture medium containing acetamide (20 mmol / L) to the suspension and mix it evenly. Cover the mixture on the lower culture medium containing acetamide (20 mmol / L), and place the culture plate at 30°C for 5-7 days to allow the transformants to grow.

[0084] PCR verification: Using the transformant on the plate as a template and Pamy2-F / TglaA(Ptub)-R as primers, PCR amplification obtained a 3.0Kb fragment, which was positive, indicating that the transformant was an engineered Aspergillus niger that expressed amylase signal peptide SP0 and bovine lactoferrin.

[0085] Figure 1 Agarose gel electrophoresis showing the detection of the integration of the fusion gene of amylase signal peptide variant SP2 and bovine lactoferrin into the Aspergillus niger genome by PCR

[0086] According to methods similar to those in Example 1 and Example 2, an Aspergillus niger engineered bacterium expressing one of the amylase signal peptide variants SP1-SP6 and bovine lactoferrin was constructed; an Aspergillus oryzae engineered bacterium expressing an amylase signal peptide or one of its variants SP0-SP6 and bovine lactoferrin was constructed; an Aspergillus niger engineered bacterium expressing an amylase signal peptide or one of its variants SP0-SP6 and thaumatin was constructed; and an Aspergillus oryzae engineered bacterium expressing an amylase signal peptide or one of its variants SP0-SP6 and thaumatin was constructed.

[0087] Example 3: Fermentation detection of extracellular proteins

[0088] Taking the engineered Aspergillus niger expressing bovine lactoferrin as an example, the positive transformants were resuspended in 500 μl of sterile distilled water, spread on potato dextrose agar (PDA) culture plates, and cultured at 30°C for 4-5 days to promote mycelial growth and spore production. 25 ml of fermentation medium was added to the cultured colonies and aseptically scraped with an inoculation loop. The spore concentration was 1.3×10 7 A suspension of 100 cells / ml was used as an inoculum for fungal culture. In a 500 ml Erlenmeyer flask, 100 ml of fermentation medium was added. Cultured on a shaker (180 rpm) at 30°C for 3 days. Samples were taken at 24h intervals, centrifuged at 8000×g for 5min, and the supernatant was collected for analysis. Fermentation medium (%): ammonium nitrate 0.5; potassium dihydrogen phosphate 0.1; magnesium sulfate 0.05; potassium chloride 0.05; ferrous sulfate 0.001; maltose 1.0; starch 1.0, pH 6.2.

[0089] The His Tag ELISA Detection Kit (GenScript Cat. No.: L00436) was used for the analysis of bovine lactoferrin in the fermentation broth. The specific process is as follows:

[0090] 1. Add 50 μl of His-tag standard or diluted sample containing His-tagged protein to each well of the His-tag plate.

[0091] 2. Add 50 μl of anti-His monoclonal antibody to all wells.

[0092] 3. Cover the plate with a sealing film and incubate at room temperature (20-25°C) for 30 minutes.

[0093] 4. Wash the plate four times with 260 μl of 1× washing solution.

[0094] 5. Pat the plate with a paper towel to remove any remaining liquid in the wells.

[0095] 6. Add 100 μl of Antibody Tracker to all wells.

[0096] 7. Cover the plate with a sealing film and incubate at room temperature for 30 minutes.

[0097] 8. Wash the plate four times with 260 μl of 1× washing solution.

[0098] 9. Pat the plate with a paper towel to remove any remaining liquid in the wells.

[0099] 10. Add 100 μl of TMB substrate to all wells and incubate at room temperature for 10-15 minutes.

[0100] 11. Add 50 μl of stop solution to all wells to stop the enzyme reaction. Read the absorbance of the plate at 450 nm on a microplate reader.

[0101] 12. Draw a standard curve with absorbance as the ordinate and the concentration of the His-tag standard as the abscissa.

[0102] 14. The amount of His-tagged protein in the sample was determined by extrapolating its optical density value to the standard curve.

[0103] Figure 2 A colorimetric photograph and a standard curve of the standard curve detected using Histag ELISA are shown.

[0104] The target proteins in the fermentation broths of Aspergillus oryzae expressing bovine lactoferrin, Aspergillus niger expressing thaumatin and Aspergillus oryzae expressing thaumatin were analyzed and detected by similar methods. The results are listed in Table 3.

[0105] Table 3. Detection results of bovine lactoferrin and thaumatin fermentation levels by Aspergillus engineering bacteria

[0106]

[0107]

[0108] It can be seen from Table 3 that compared with the wild-type amylase signal peptide variant SP0, some amylase signal peptide variants generated by natural language models, such as SP1 and SP4-6, not only have no promoting effect on the expression of exogenous target proteins bovine lactoferrin and thaumatin by Aspergillus (including Aspergillus oryzae and Aspergillus niger), but instead reduce the secretory expression of the target proteins. However, two amylase signal peptide variants, SP2 and SP3, promoted the secretion expression of bovine lactoferrin and thaumatin. SP2 increased the secretion expression of bovine lactoferrin by 67.9% in Aspergillus niger, increased the secretion expression of bovine lactoferrin by 108.8% in Aspergillus oryzae, increased the secretion expression of thaumatin by 44.3% in Aspergillus niger, and increased the secretion expression of thaumatin by 45.3% in Aspergillus oryzae; SP3 increased the secretion expression of bovine lactoferrin by 86.8% in Aspergillus niger, increased the secretion expression of bovine lactoferrin by 151% in Aspergillus oryzae, increased the secretion expression of thaumatin by 47.8% in Aspergillus niger, and increased the secretion expression of thaumatin by 26.9% in Aspergillus oryzae.

[0109] discuss

[0110] According to the results of the embodiment, the amylase signal peptide variants SP2 and SP3 generated by the natural language model of the present invention can effectively improve the secretion expression level of bovine lactoferrin and thaumatin in Aspergillus niger or Aspergillus oryzae through fusion technology. This may be due to the unique advantages of the amylase signal peptide variants SP2 and SP3 generated by the natural language model in the sequence structure, which enables it to better adapt to the expression system of Aspergillus niger or Aspergillus oryzae, and simultaneously produce a synergistic effect with bovine lactoferrin or thaumatin genes in the expression and secretion process, promoting the secretion of the target protein. However, the specific molecular mechanism still needs to be further studied, such as by means of protein structure analysis, gene expression regulation network analysis, etc., to reveal the expression regulation mechanism and protein interaction relationship of the fusion gene in the host cell.

[0111] During the experiment, we also found that different amylase signal peptide variants generated by the natural language model, as well as different fusion strategies and fermentation conditions, had a significant impact on the expression effect. Therefore, future research can further expand the scope and depth of application of the natural language model, explore more signal peptide variant combinations and fusion methods, and combine more advanced fermentation process optimization technologies, such as artificial intelligence-based intelligent control of the fermentation process, multi-scale metabolic flow analysis, etc., to achieve a higher level of secretory expression and production efficiency improvement.

Claims

1. An amylase signal peptide variant, which is a polypeptide selected from the following: (a) a polypeptide having an amino acid sequence of MMVAWWSLFLYGLAVAAPALAA (SEQ ID NO: 2); (b) A polypeptide having an amino acid sequence of MMVAWWSLFLLGLQVAAPALAA (SEQ ID NO: 3).

2. A gene encoding the amylase signal peptide variant according to claim 1.

3. The gene according to claim 2, characterized in that The gene encoding the amylase signal peptide variant SEQ ID NO:2 is a polynucleotide having a nucleotide sequence of SEQ ID NO:4, or a polynucleotide having more than 90% homology with SEQ ID NO:4; The gene encoding the amylase signal peptide variant SEQ ID NO:3 is a polynucleotide having a nucleotide sequence of SEQ ID NO:5, or a polynucleotide having 90% or more homology with SEQ ID NO:

5.

4. A DNA molecule, characterized in that Comprising the gene as claimed in claim 2.

5. Use of the amylase signal peptide variant according to claim 1 or the gene according to claim 2 in improving the secretory expression of bovine lactoferrin and / or thaumatin by Aspergillus.

6. The use according to claim 5, characterized in that The Aspergillus is Aspergillus niger or Aspergillus oryzae.

7. The use according to claim 5, characterized in that The gene encoding the amylase signal peptide variant according to claim 2 is fused with a bovine lactoferrin gene or a thaumatin gene and expressed in Aspergillus.

8. An integrated fragment, characterized in that For expressing bovine lactoferrin or thaumatin in Aspergillus, comprising the amylase signal peptide variant encoding gene as claimed in claim 2 and the bovine lactoferrin gene as claimed in claim 8 located downstream, or The method comprises a gene encoding an amylase signal peptide variant as claimed in claim 2 and a thaumatin gene as claimed in claim 8 located downstream.

9. An engineered Aspergillus niger or Aspergillus oryzae strain for producing bovine lactoferrin, characterized in that: The integration fragment as claimed in claim 8 is integrated into its genome.

10. Use of the engineered Aspergillus niger or Aspergillus oryzae according to claim 9 in producing bovine lactoferrin or thaumatin.

Images