Single-stranded nucleic acid binding protein T4gp32 mutant and application thereof

Abstract

The invention provides a single-chain binding protein T4gp32 mutant and application of the single-chain binding protein T4gp32 mutant. According to the invention, the T4gp32 protein variant is screened by using a point mutation technology, and the affinity and the stability of the combination of the mutant and DNA are obviously improved compared with those of a wild type. The T4gp32 protein variant screened by the invention can obviously improve the RPA reaction efficiency and greatly shorten the RPA reaction time, so that the T4gp32 protein variant is more suitable for basic laboratories and on-site rapid nucleic acid detection.

Description

Technical Field

[0001] The invention relates to the technical field of molecular diagnosis and genetic engineering, and in particular to a single-stranded nucleic acid binding protein T4gp32 mutant and an application thereof. Background Art

[0002] T4 gp32 protein is a single-stranded DNA binding protein from T4 bacteriophage. It is a typical single-stranded DNA binding protein and has been widely studied. It plays a core role in the replication, recombination and repair of T4 bacteriophage. It can synergistically bind to the exposed ssDNA after the dsDNA is unwound, maintain the stability of ssDNA, and prevent ssDNA from forming secondary structures or being degraded by nucleases. T4 gp32 protein can improve the efficiency of reverse transcription in RT-PCR, enhance the activity of T4 DNA polymerase and increase the yield of PCR. Although the existing gp32 single-stranded DNA binding protein has binding activity, its binding efficiency needs to be improved, and the unit bacterial expression level of gp32 single-stranded DNA binding protein in industrial production is low, which also makes its use effect in industrial production relatively poor. Summary of the invention

[0003] In order to solve at least one of the above problems, the present invention mutates the wild-type T4 gp32 protein (amino acid sequence as shown in SEQ ID NO: 2) and screens out T4 gp32 protein variants with significantly improved DNA binding affinity and stability.

[0004] According to one aspect of the present disclosure, a T4 gp32 protein variant is provided, wherein the T4 gp32 protein variant has improved affinity and stability for binding to DNA, wherein the T4 gp32 protein variant has an amino acid mutation at one or more positions corresponding to positions 62, 78, 80, 86, 100, 140 and 186 of the amino acid sequence as shown in SEQ ID NO:2, and the T4 gp32 protein variant has at least 85% sequence identity with the amino acid sequence as shown in SEQ ID NO:2.

[0005] In some embodiments, the T4 gp32 protein variant has amino acid V at position 62 substituted with C.

[0006] In some embodiments, the T4 gp32 protein variant has the amino acid S at position 78 substituted with C.

[0007] In some embodiments, the T4 gp32 protein variant has amino acid T at position 80 substituted with C.

[0008] In some embodiments, the T4 gp32 protein variant has the amino acid S at position 86 substituted with C.

[0009] In some embodiments, the amino acid N at position 100 of the T4 gp32 protein variant is substituted with any of A, I, L, V, F, W, Y, C, Q, M, S, T, R, H, K, D, E, G, or P.

[0010] In some embodiments, the amino acid N at position 100 of the T4 gp32 protein variant is substituted with any one of R, H or K.

[0011] In some embodiments, the T4 gp32 protein variant has the amino acid N at position 100 substituted with R.

[0012] In some embodiments, the T4 gp32 protein variant has the amino acid G at position 140 substituted with any of A, I, L, V, F, W, Y, N, C, Q, M, S, T, R, H, K, D, E, or P.

[0013] In some embodiments, the T4 gp32 protein variant has amino acid G substituted with P at position 140.

[0014] In some embodiments, the T4 gp32 protein variant has amino acid Y at position 186 substituted with any of A, I, L, V, F, W, N, C, Q, M, S, T, R, H, K, D, E, G, or P.

[0015] In some embodiments, the T4 gp32 protein variant has the amino acid Y at position 186 substituted with any one of R, H or K.

[0016] In some embodiments, the T4 gp32 protein variant has amino acid Y at position 186 substituted with R.

[0017] In some embodiments, the T4 gp32 protein variant has an amino acid mutation at one or more of positions 62, 78, 80 and 86 of the amino acid sequence shown in SEQ ID NO:2.

[0018] In some embodiments, the T4 gp32 protein variant has an amino acid mutation at one or both of positions 62 and 80 in the amino acid sequence shown in SEQ ID NO:2.

[0019] In some embodiments, the T4 gp32 protein variant has an amino acid mutation at one or both of positions 78 and 86 in the amino acid sequence shown in SEQ ID NO:2.

[0020] In some embodiments, the T4 gp32 protein variant has amino acid mutations at positions 62 and 80 of the amino acid sequence shown in SEQ ID NO:2.

[0021] In some embodiments, the T4 gp32 protein variant has amino acid mutations at positions 78 and 86 of the amino acid sequence shown in SEQ ID NO:2.

[0022] In some embodiments, the T4 gp32 protein variant has one or more amino acid mutations of V62C, S78C, T80C, S86C, N100R, G140P and Y186R relative to the amino acid sequence shown in SEQ ID NO:2.

[0023] In some embodiments, the T4 gp32 protein variant has one or both of V62C and T80C amino acid mutations relative to the amino acid sequence shown in SEQ ID NO:2.

[0024] In some embodiments, the T4 gp32 protein variant has one or both of S78C and S86C amino acid mutations relative to the amino acid sequence shown in SEQ ID NO:2.

[0025] In some embodiments, the T4 gp32 protein variant has one or two amino acid mutations of V62C and T80C, or S78C and S86C relative to the amino acid sequence shown in SEQ ID NO:2.

[0026] In some embodiments, the T4 gp32 protein variant has one or more amino acid mutations of V62C and T80C, S78C and S86C, N100R, G140P and Y186R relative to the amino acid sequence shown in SEQ ID NO:2.

[0027] According to yet another aspect of the present disclosure, a nucleic acid molecule is provided, which encodes the above-mentioned T4 gp32 protein variant of the present disclosure.

[0028] According to another aspect of the present disclosure, an expression vector is provided, which comprises the above-mentioned nucleic acid molecule of the present disclosure.

[0029] In some embodiments, the expression vector includes a prokaryotic expression vector and a eukaryotic expression vector.

[0030] In some embodiments, the eukaryotic expression vector includes a yeast expression vector, a mammalian expression vector, an insect expression vector, and the like.

[0031] According to another aspect of the present disclosure, a host cell is provided, which comprises the above-mentioned nucleic acid molecule and / or expression vector of the present disclosure.

[0032] In some embodiments, the host cell is selected from a prokaryotic cell and a eukaryotic cell.

[0033] In some embodiments, the prokaryotic cell comprises a bacterial cell.

[0034] In some embodiments, the bacteria include Escherichia coli, Streptomyces, and Bacillus subtilis;

[0035] In some embodiments, the eukaryotic cells include yeast cells, mammalian cells, insect cells, etc.

[0036] In some embodiments, the mammal is selected from humans, monkeys, mice, rats, hamsters, goats, sheep, cows, pigs, dogs or cats.

[0037] In some embodiments, the bacterial cells include B. subtilis RIK1285 cells, T1 Escherichia coli, Bl21 (DE3) Escherichia coli, WB600 cells, DH5α cells, BL21 cells, DH10Bac cells, XL10-Gold cells, TG1 cells, Stbl2 cells, BJ5183 cells, HB101 cells or Turbo cells.

[0038] According to yet another aspect of the present disclosure, a composition is provided, wherein the kit comprises the T4 gp32 protein variant as described above.

[0039] According to yet another aspect of the present disclosure, a kit is provided, comprising the T4 gp32 protein variant as described above.

[0040] According to yet another aspect of the present disclosure, a method of recombinase polymerase amplification (RPA) is provided, the method comprising performing recombinase polymerase amplification using the T4 gp32 protein variant.

[0041] According to another aspect of the present disclosure, there is provided use of the T4 gp32 protein variant, the nucleic acid molecule, the expression vector, the host cell, the composition, the kit, and the method for expressing the T4 gp32 protein variant in any one or more of the following:

[0042] 1) Bind to DNA;

[0043] 2) Improve the affinity or stability of DNA binding;

[0044] 3) Recombinase polymerase amplification;

[0045] 4) Improve the amplification efficiency of recombinase polymerase;

[0046] 5) Reduce the recombinase polymerase amplification reaction time.

[0047] Beneficial effects:

[0048] The present disclosure uses point mutation technology to screen out T4 gp32 protein variants, and the affinity and stability of the mutants for binding to DNA are significantly improved compared to the wild type. The T4 gp32 protein variants screened by the present disclosure can significantly improve the efficiency of the RPA reaction and greatly shorten the reaction time of the RPA reaction, making it more suitable for grassroots laboratories and on-site rapid nucleic acid detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 Shown are electropherograms of wild-type gp32 and gp32 mutants: S25C+E30C, W31C+F135C, S50C+P57C, V62C+T80C tested for activity in a 30 min RPA amplification reaction.

[0050] Figure 2 Shown are electropherograms of wild-type gp32 and gp32 mutant S78C+S86C tested for activity in a 30 min RPA amplification reaction.

[0051] Figure 3 Shown are electropherograms of wild-type gp32 and gp32 mutants S25C+E30C, W31C+F135C, S50C+P57C and P88C+F235C tested for activity in a 30 min RPA amplification reaction.

[0052] Figure 4 Shown are electropherograms of wild-type gp32 and gp32 mutants: V62C+T80C, S78C+S86C tested for activity in a 16 min RPA amplification reaction.

[0053] Figure 5 Shown are electropherograms of wild-type gp32 and mutants: N100R, G140P and Y186R tested for activity in a 30 min RPA amplification reaction.

[0054] Figure 6 Shown are electropherograms of the activity of wild-type gp32 in 30 min and 16 min RPA amplification reactions, and mutant N100R tested in 16 min RPA amplification reactions.

[0055] Figure 7 Shown are electropherograms of the activity of wild-type gp32 in 30 min and 16 min RPA amplification reactions, and mutant G140P tested in 16 min RPA amplification reactions.

[0056] Figure 8 Shown are electropherograms of the activity of wild-type gp32 in 30 min and 16 min RPA amplification reactions, and mutant Y186R tested in 16 min RPA amplification reactions. DETAILED DESCRIPTION

[0057] Recombinase polymerase isothermal amplification (RPA) is a nucleic acid isothermal amplification technology developed by the British company TwistDx in 2006. It has many advantages over PCR technology. RPA amplification does not require high temperature to denature the template, so it can quickly complete nucleic acid amplification within 20-30 minutes at a temperature of 37°C-42°C, and is similar to PCR in sensitivity and specificity. Therefore, RPA technology has developed rapidly in recent years. In the RPA reaction, the gp32 protein binds to the unwound double-stranded DNA to keep it stable. Therefore, the gp32 protein is a key protein in the RPA reaction.

[0058] With the further development of RPA reaction, the improvement of reaction effect has become more and more important. However, in practical applications, gp32 has problems such as low RPA activity, low stability, low protein expression and low purity. This leads to the poor effect of gp32 in PRA reaction and also limits the industrial application of gp32.

[0059] The present invention predicts the molecular structure of T4 gp32 protein (gp32 protein for short) binding to single-stranded DNA and screens virtual mutations to improve the stability of the protein and its activity in recombinant protein production.

[0060] The present invention improves the binding affinity and stability of protein molecules with DNA by predicting their structure and optimizing their mutations, thereby enhancing the activity of proteins in RPA.

[0061] The RPA activity of the mutant of T4 gp32 protein screened by the present disclosure is significantly improved compared with the wild type, and the reaction effect is still good after the time is shortened, which shows that the mutant can significantly shorten the reaction time of the RPA reaction.

[0062] definition

[0063] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0064] As used herein, the articles "a," "an," and "an" include plural referents unless the context clearly dictates otherwise.

[0065] The expression "about" as used herein is understood by one of ordinary skill in the art and varies within a certain range depending on the context in which it is used. If one of ordinary skill in the art is not aware of the use of the term based on the context in which it is used, "about" will mean up to plus or minus 10% of the specified value.

[0066] In the present disclosure, the term "DNA", the full name of which is "deoxyribonucleic acid" (abbreviated as DNA), is one of the four biological macromolecules contained in biological cells, which is a type of nucleic acid. DNA carries the genetic information necessary for the synthesis of RNA and proteins, and is an essential biological macromolecule for the development and normal functioning of organisms. DNA is a macromolecular polymer composed of deoxynucleotides. Deoxynucleotides are composed of bases, deoxyribose and phosphate. There are four types of bases: adenine (A), guanine (G), thymine (T) and cytosine (C).

[0067] In the present disclosure, the term "upstream primer" refers to an oligonucleotide that is extended uninterruptedly along the negative strand; the term "downstream primer" used in the present invention refers to an oligonucleotide that is extended uninterruptedly along the positive strand. The positive strand is the sense strand, also known as the coding strand, which is generally located at the upper end of the double-stranded DNA, with a 5'-3' direction from left to right, and a base sequence that is substantially the same as the mRNA of the gene; the primer that binds to this strand is the downstream primer; the negative strand is the nonsense strand, also known as the non-coding strand, which is complementary to the positive strand, and the primer that binds to this strand is the upstream primer. It should be understood that when the designations of the sense strand and the antisense strand are interchanged, the corresponding upstream primer and downstream primer names may also be interchanged accordingly.

[0068] As used herein, the term "single-strand binding protein (SSB)" is a protein that can bind to single-stranded DNA, and usually plays an important role in DNA replication, repair, recombination, etc. Exemplary single-strand binding proteins include, but are not limited to, Escherichia coli (E. coli) SSB, T4gp32, T7 gene 2.5SSB, phage π29SSB, RB69 phage gp32 protein, and homologous proteins or protein complexes thereof, or functional variants thereof.

[0069] As used herein, the term "T4 gp32 protein" or "gp32 protein" is a single-stranded DNA binding protein from T4 bacteriophage that plays a key role in the DNA replication process. It promotes DNA replication and repair by binding to single-stranded DNA, preventing DNA annealing and maintaining the stability of single-stranded DNA.

[0070] As used herein, the term "mutant" or "variant" refers to a protein variant produced by changing its original protein sequence through gene mutation technology. Mutants are often used to study the relationship between protein structure and function.

[0071] As used herein, the term "recombinase polymerase amplification (RPA)" is a molecular biology technique for DNA amplification, which uses specific recombinases, polymerases and auxiliary proteins to perform efficient DNA amplification at room temperature. The technology mainly includes: at a constant temperature of 37-42°C, the recombinase can bind tightly to the primer DNA to form a polymer of the enzyme and the primer. When the primer searches for a sequence that is completely complementary to the template DNA, the template DNA is unzipped with the help of a single-stranded DNA binding protein (SSB), and a new DNA complementary chain is formed under the action of a strand displacement DNA polymerase. The reaction product also grows exponentially, and an amplified fragment that can be detected by agarose gel electrophoresis can usually be obtained within 1 hour. Exemplary recombinases include, but are not limited to, RecA protein, T4UvsX protein, RB69 bacteriophage UvsX protein and homologous proteins or protein complexes thereof, or their functional variants. Exemplary strand-displacing DNA polymerases include, but are not limited to, Bsu (Bacillus subtilis), Bst (Bacillus stearothermophilus) polymerase, exo-Klenow polymerase, or a large fragment of sequencing-grade T7 exo-polymerase.

[0072] In some embodiments, recombinase polymerase amplification uses "accessory proteins", which include any protein that can interact with the recombinase and single-stranded binding protein to help produce the nucleation of UvsX filaments on ssDNA. Exemplary accessory proteins include, but are not limited to, T4 UvsY, RB69 bacteriophage UvsY protein, E. coli RecO, E. coli RecR, any homologous protein or protein complex from any phylum, and their functional variants.

[0073] As used herein, the term "sequence identity" is used in the context of the present disclosure to describe the degree of similarity between two nucleotide sequences or two amino acid sequences, and has the same meaning as "percent identity". The percent homology of two sequences can be calculated as follows, after the two sequences are aligned, by dividing the number of positions where the residues are identical by the total length of the aligned sequences and multiplying by 100%. Methods and tools for aligning two amino acid sequences or nucleotide sequences are well known in the art, such as the BLAST suite provided on the NCBI website. As used herein, having "at least 85% sequence identity" with a sequence refers to having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with the sequence.

[0074] The sequence identity percentage can be calculated by the following process: determine the number of positions where the same amino acid residue or nucleic acid base occurs in both sequences to obtain the number of matching positions, divide the number of matching positions by the total number of positions in the comparison window, and multiply the result by 100 to obtain the sequence identity percentage. The comparison of the sequence and the determination of the sequence identity percentage between the two sequences can be completed using software that is easy to use and download online. Suitable software programs can be obtained from various sources for the comparison of protein and nucleotide sequences. A suitable program for determining the sequence identity percentage is bl2seq, which is a part of the BLAST program suite that can be obtained from the BLAST website (blast.ncbi.nlm.nih.gov). Bl2seq uses BLASTN or BLASTP algorithms to compare between two sequences. BLASTN is used to compare nucleic acid sequences, and BLASTP is used to compare amino acid sequences. Other suitable programs are, for example, a part of the EMBOSS suite of Needle, Stretcher, Water or Matcher, bioinformatics programs, and can also be obtained at www.ebi.ac.uk / Tools / psa.

[0075] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with the examples. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation to the present invention. The actual protection scope of the present invention is set forth in the claims. In the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications. The equipment, instruments, reagents and / or kits used in the following examples are not mentioned in terms of their sources, and are all commercially available on the market or obtained by conventional methods known to those skilled in the art.

[0076] Example

[0077] Example 1: Construction of mutants

[0078] 1. The pet28 vector-wild-type gp32 DNA template (sequence shown in SEQ ID NO: 1) was amplified by PCR to obtain the expression plasmid of the gp32 protein mutant, and the reaction system was shown in Table 1. The amino acid sequence of the wild-type gp32 protein is shown in SEQ ID NO: 2.

[0079] Table 1. Amplification reaction system

[0080] Components volume <![CDATA[Wild-type gp32 template (1×10 9 copies)]]> 1μL Forward primer (10uM) 1μL Reverse primer (10uM) 1μL 2xTransStar"FastPfuPCRSuperMix (full gold) 25μL <![CDATA[ddH2O]]> Make up to 50 μL

[0081] The PCR amplification program was as follows: pre-denaturation at 98°C for 3 min, denaturation at 98°C for 15 s, annealing at 62°C for 15 s, extension at 72°C for 3 min, 30 cycles, and final extension at 72°C for 5 min.

[0082] The primer sequences used in Table 1 are shown in Table 2.

[0083] Table 2. Primer sequences used for amplification

[0084]

[0085]

[0086]

[0087] 2. Run the reaction product on 2% agarose gel electrophoresis to check whether the bands are correct.

[0088] 3. Use DNA gel rapid purification kit (full gold) to recover the product, take 30 μL of the recovered product, add 0.6 μL of DMTEnzyme (full gold) and digest the template in a water bath at 37°C for 1 hour.

[0089] 4. After digestion of the template, take 10 μL of the product and add 10 μL of 2×MultiF Seamless Assembly Mix (Aibotek) and incubate in a 50°C water bath for 15 min to circularize the linear DNA.

[0090] 5. Take 10 μL of the recombinant ligation product and transform it into 50 μL (full gold) T1 E. coli competent cells, place it on ice for 30 minutes, then heat shock at 42°C for 45 seconds, and then place it on ice for 2 minutes. After adding 500 μL LB medium, place it at 37°C and 200rpm shaker for incubation for 1 hour. Centrifuge at 8000×g for 1 minute to collect the bacteria, keep 100 μL of the supernatant and resuspend it, then spread it on the kanamycin-resistant LB plate, and place it in a 37°C incubator for 12 hours. Retrieve the single clone, culture it at 37°C and 220rpm for 12 hours, and then sample it for sequencing.

[0091] 6. Transform 10 μL of the correctly sequenced mutant plasmid into 50 μL (full gold) Bl21 (DE3) E. coli competent cells, place on ice for 30 minutes, then heat shock at 42°C for 30 seconds, and then place on ice for 2 minutes. Add 500 μL LB medium and incubate at 37°C, 200rpm shaker for 1 hour. Collect the bacteria by centrifugation at 8000×g for 1 minute, keep 100 μL of supernatant and resuspend, then spread on the kanamycin-resistant LB plate, and place in a 37°C incubator for 12 hours. Retrieve a single clone, culture at 37°C 220rpm for 12 hours, and store the gp32 engineering strain in a -80°C refrigerator.

[0092] Example 2: Protein expression and purification

[0093] 1. Take 10 μL of gp32 engineered bacteria and inoculate it into a small test tube containing 5 mL of LB medium, add 10 μL of kanamycin (final concentration of 100 ug / mL), and culture at 37°C, 220 rpm for 12 h.

[0094] 2. Take 1.2 mL of bacteria and inoculate it into 120 mL of LB medium. Add 120 μL of kanamycin to a final concentration of 50 ug / ml. Culture at 37°C and 220 RPM for 4-5 hours and measure the OD value.

[0095] 3. When the OD value reaches 0.7-0.8, add 0.005mM-1mM IPTG inducer (Guangzhou Saiguo Biotechnology Co., Ltd.) to the shake flask according to the experimental design to start induction. According to the experimental design, the shake flask is placed in a shaker at 12-37°C for 20 hours.

[0096] 4. Centrifuge the bacterial solution at 8000×g for 5 minutes and take the supernatant to break the bacteria.

[0097] 5. After breaking the bacteria, centrifuge at 10,000×g for 1 hour and take the supernatant for purification using a nickel column.

[0098] 6. Rinse the nickel column with 3 column volumes of Buffer 1 (50 mM disodium hydrogen phosphate, 500 mM sodium chloride, pH = 7.2) for equilibrium.

[0099] 7. Pass the supernatant through the nickel column three times to ensure that all proteins are attached to the nickel column.

[0100] 8. Use 10 column volumes of washing solution (50 mM disodium hydrogen phosphate, 500 mM sodium chloride, 60 mM imidazole) to wash the nickel column to remove impurities.

[0101] 9. Use 10 mL of elution buffer (50 mM disodium hydrogen phosphate, 500 mM sodium chloride, 500 mM imidazole) to elute the gp32 protein.

[0102] 10. Wash the nickel column with 3 column volumes of final eluent (50 mM disodium hydrogen phosphate, 500 mM sodium chloride, 1 M imidazole).

[0103] 11. Use a 10kDa concentrator to concentrate the protein and replace the solution with protein storage solution (10mM Tris-HCl pH=7.5, 300mM NaCl, 1mM DTT, 0.1mM EDTA) to concentrate the protein to about 1-5mg / mL.

[0104] 12. Use the BCA protein concentration assay kit to determine the protein concentration.

[0105] The protein expressed according to the above steps carries a His tag and an enzyme cleavage site. The amino acid sequence of the expressed wild-type gp32 protein carrying a His tag and an enzyme cleavage site is shown in SEQ ID NO:3.

[0106] Example 3: RPA reaction process

[0107] The primer pair was used for RPA amplification with HPV-16 (SEQ ID NO: 46) as template.

[0108] Primer pair sequences:

[0109] Upstream primer (5'-3'): CTACACCTAGTGGTTCTATGGTTACCTCTGAT (SEQ ID NO: 47);

[0110] Downstream primer (5'-3'): AAACCTATAAGTATCTTCTAGTGTGCCTCCTG (SEQ ID NO: 48).

[0111] The reaction system is shown in Table 3.

[0112] Table 3. RPA reaction system

[0113] system Amount used μL 2×buffer 25 Upstream primer (10 μM) 1.5 Downstream primer (10 μM) 1.5 Creatine kinase (2μg / μL) (Yisheng) 2.5 gp32 (4 μg / μL) 2.5 uvsX (3μg / μL) 2 uvsY(1μg / μL) 1 Bsu (1 μg / μL) 1.5 <![CDATA[hpv template (1×10 8 copies / μL)]]> 1 <![CDATA[ddH2O]]> Replenish to 50 <![CDATA[MgCl2(280mM)(Aladdin)]]> 2.5

[0114] The 2×buffer formula is: 60mM Tris-HCl pH=8; 80mM potassium acetate; 4mM DTT (Aladdin); 40mM sodium creatine phosphate (Xiens); 15% PEG35K (Hefei Qiansheng); 5mM ATP (Shaoyuan Technology (Shanghai)); 0.9mM dNTP (Tianjin Olive Biotechnology Co., Ltd.). The amino acid sequence of uvsX is shown in SEQ ID NO: 49, the amino acid sequence of uvsY is shown in SEQ ID NO: 50, and the amino acid sequence of Bsu is shown in SEQ ID NO: 51.

[0115] RPA reaction process:

[0116] 1. Add all components except gp32 and MgCl2 to a 1.5 mL EP tube.

[0117] 2. Add wild-type and mutant gp32 into different EP tubes according to the experimental design.

[0118] 3. Add MgCl2 into the EP tube cap and cover the tube.

[0119] 4. After centrifugation, start the reaction and place in a water bath at 41°C for 30 minutes.

[0120] 5. After the reaction is completed, add 50 μL of DNA extraction phenol (Solebol) to terminate the reaction, mix gently by hand, centrifuge at 12000×g for 5 minutes, and extract the supernatant.

[0121] 6. Run the supernatant in 2% agarose gel electrophoresis for 40 minutes and observe the band results on a blue light gel exciter.

[0122] Example 4: Testing the effect of 6 gp32 mutants on improving the RPA reaction

[0123] According to the RPA steps of Example 3, different gp32 mutants were used to replace wild-type gp32 (mutants: S25C+E30C, W31C+F135C, S50C+P57C, V62C+T80C, S78C+S86C, P88C+F235C) to test RPA activity, and the RPA reaction time was 30 minutes. The control group (NTC) did not add HPV template.

[0124] The results are as follows Figures 1 to 3As shown, the mutants V62C+T80C and S78C+S86C have significantly improved performance compared to the wild type (WT). The grayscale value was calculated using ImageJ software, and it was found that V62C+T80C was 170% of WT and S78C+S86C was 214% of WT. Compared with the wild type, the mutants S25C+E30C, W31C+F135C, S50C+P57C and P88C+F235C had reduced or lost RPA activity.

[0125] The mutants V62C+T80C and S78C+S86C were further used for RPA reaction for 16 min. Figure 4 As shown: mutants V62C+T80C and mutants S78C+S86C also have good reaction effects when the RPA reaction time is 16 minutes. The effect of mutant V62C+T80C reaction for 16 minutes is 257% of WT reaction for 16 minutes and 149% of WT reaction for 30 minutes. The effect of mutant S78C+S86C reaction for 16 minutes is 192% of WT reaction for 16 minutes and 129% of WT reaction for 30 minutes. Mutants can effectively shorten the time required for RPA reaction.

[0126] Example 5: Testing 12 gp32 mutants to improve RPA reaction effect

[0127] Using the RPA step of Example 3, different gp32 mutants were used to replace wild-type gp32 (mutants: E30R, W31K, N100R, Y106K, Y106R, S107R, F139R, F139K, F139G, F139Y, G140P and Y186R) to test RPA activity, and the RPA reaction time was 30 minutes. The control group (NTC) did not add HPV template.

[0128] The results are as follows Figure 5 As shown: The performance of mutants N100R, G140P and Y186R was significantly improved compared to the wild type. The grayscale value was calculated using ImageJ software, and the results showed that N100R was 175% of WT, G140P was 222% of WT, and Y186R was 223% of WT.

[0129] The mutants N100R, G140P and Y186R were further used for RPA reaction for 16 min. Figures 6 to 8As shown, gp32 mutants also have good reaction effects when the RPA reaction time is 16 minutes. The effect of the N100R mutant at 16 minutes is 153% of the WT reaction at 16 minutes and 72% of the WT reaction at 30 minutes. The effect of the G140P mutant at 16 minutes is 174% of the WT reaction at 16 minutes and 95% of the WT reaction at 30 minutes. The effect of the Y186R mutant at 16 minutes is 163% of the WT reaction at 16 minutes and 104% of the WT reaction at 30 minutes. Mutants can effectively shorten the time required for RPA reaction.

[0130] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A T4 gp32 protein variant, wherein the T4 gp32 protein variant has improved affinity or stability for binding to DNA, wherein the T4 gp32 protein variant has an amino acid mutation at one or more positions corresponding to positions 62, 78, 80, 86, 100, 140 and 186 of the amino acid sequence shown in SEQ ID NO: 2, and the T4 gp32 protein variant has at least 85% sequence identity with the amino acid sequence shown in SEQ ID NO:

2.

2. The T4 gp32 protein variant according to claim 1, characterized in that The T4 gp32 protein variant has amino acid V at position 62 substituted with C; Preferably, the T4 gp32 protein variant has amino acid S at position 78 substituted with C; Preferably, the T4 gp32 protein variant has amino acid T at position 80 substituted with C; Preferably, the T4 gp32 protein variant has amino acid S at position 86 substituted with C; Preferably, the amino acid N at position 100 of the T4 gp32 protein variant is substituted with any one of A, I, L, V, F, W, Y, C, Q, M, S, T, R, H, K, D, E, G or P; more preferably any one of R, H or K; most preferably R; Preferably, the amino acid G at position 140 of the T4 gp32 protein variant is substituted with any one of A, I, L, V, F, W, Y, N, C, Q, M, S, T, R, H, K, D, E or P; more preferably P; Preferably, the amino acid Y at position 186 of the T4 gp32 protein variant is substituted with any one of A, I, L, V, F, W, N, C, Q, M, S, T, R, H, K, D, E, G or P; more preferably with any one of R, H or K; most preferably with R.

3. The T4 gp32 protein variant according to claim 1, characterized in that The T4 gp32 protein variant has an amino acid mutation at one or more of positions 62, 78, 80 and 86 in the amino acid sequence shown in SEQ ID NO: 2; Preferably, the T4 gp32 protein variant has an amino acid mutation at one or both of positions 62 and 80 in the amino acid sequence shown in SEQ ID NO: 2; more preferably, it has an amino acid mutation at positions 62 and 80; Preferably, the T4 gp32 protein variant has an amino acid mutation at one or both of positions 78 and 86 in the amino acid sequence shown in SEQ ID NO: 2; more preferably, it has an amino acid mutation at positions 78 and 86.

4. The T4 gp32 protein variant according to claim 1, characterized in that The T4 gp32 protein variant has one or more amino acid mutations selected from the group consisting of V62C, S78C, T80C, S86C, N100R, G140P and Y186R relative to the amino acid sequence shown in SEQ ID NO:

2.

5. The T4 gp32 protein variant according to claim 1, characterized in that The T4 gp32 protein variant has one or two amino acid mutations of V62C and T80C relative to the amino acid sequence shown in SEQ ID NO: 2; Preferably, the T4 gp32 protein variant has one or two amino acid mutations of S78C and S86C relative to the amino acid sequence shown in SEQ ID NO: 2; Preferably, the T4 gp32 protein variant has one or two amino acid mutations of V62C and T80C, or S78C and S86C relative to the amino acid sequence shown in SEQ ID NO: 2; Preferably, the T4 gp32 protein variant has one or more amino acid mutations selected from the group consisting of V62C and T80C, S78C and S86C, N100R, G140P and Y186R relative to the amino acid sequence shown in SEQ ID NO:

2.

6. A nucleic acid molecule encoding the T4 gp32 protein variant according to any one of claims 1 to 5.

7. An expression vector comprising the nucleic acid molecule according to claim 6.

8. A host cell comprising the nucleic acid molecule according to claim 6 and / or the expression vector according to claim 7.

9. A kit comprising the T4 gp32 protein variant according to any one of claims 1 to 5.

10. Use of the T4 gp32 protein variant according to any one of claims 1 to 5, the nucleic acid molecule according to claim 6, the expression vector according to claim 7, the host cell according to claim 8, and the kit according to claim 9 in any one or more of the following: 1) Bind to DNA; 2) Improve the affinity or stability of DNA binding; 3) Recombinase polymerase amplification; 4) Improve the amplification efficiency of recombinase polymerase; 5) Reduce the recombinase polymerase amplification reaction time.

Images