Gene editing system based on Escherichia coli endogenous EcoTnpB protein and application thereof

Abstract

The invention relates to the field of gene editing, in particular to a gene editing system based on Escherichia coli endogenous EcoTnpB protein and application of the gene editing system, and the gene editing system comprises a) EcoTnpB protein expressed by Escherichia coli endogenous or a nucleotide sequence for coding the EcoTnpB protein; and b) an omega RNA molecule or a nucleotide sequence encoding the omega RNA molecule, the sequence of the omega RNA molecule comprises an RNA scaffold sequence and a guide sequence complementarily paired with a target sequence, and the omega RNA molecule can form a complex with the EcoTnpB protein and guide the EcoTnpB protein to recognize the target sequence. Escherichia coli endogenous protein is combined with customized omega RNA and a corresponding editing template for genome editing, efficient knockout, insertion and continuous editing of target genes can be achieved in Escherichia coli, and the method has wide application value in different Escherichia coli hosts.

Description

Technical Field

[0001] The present invention relates to the field of gene editing, and in particular to a gene editing system based on endogenous EcoTnpB protein of Escherichia coli and applications thereof. Background Art

[0002] In recent years, gene editing technology has become an important tool in modern biotechnology, and its application prospects in basic research, medicine, bioengineering and other fields are broad. Gene editing tools represented by the CRISPR-Cas9 system have been widely used worldwide due to their high efficiency, precision and ease of operation. However, the application of the CRISPR-Cas system also faces many challenges, including off-target effects, potential toxicity to the host genome, and dependence on exogenous protein expression. Therefore, exploring new, efficient and low-toxic gene editing tools has important scientific value and practical significance.

[0003] Escherichia coli (E. coli) is a model organism widely used in routine cloning operations, foreign protein expression, and synthesis of high-value compounds. In recent years, genome editing technology has been increasingly used to construct efficient E. coli cell factories. The current common strategy is to use the CRISPR-Cas system to generate double-strand breaks (DSBs) at the target site and repair them through editing templates carrying the desired mutations and homologous recombination (HR). However, since E. coli lacks a strong DNA repair pathway, the lambda red (λred) recombination system was introduced to promote recombination between the editing template and the sequences on both sides of the DSB. In genome editing using these CRISPR-Cas systems, cells that do not complete recombination usually die due to unrepaired DSBs, thereby achieving positive screening.

[0004] With the development of technology, new DSB-free CRISPR-derived gene editing methods (such as base editing and guide editing) have also been applied to E. coli. However, whether it is DSB-based editing or DSB-free editing, the introduction of exogenous CRISPR-Cas systems imposes a metabolic burden on cells and may cause off-target toxicity, and additional steps are required to remove these systems after editing is completed.

[0005] In recent years, the obligatory mobile element-guided activity system (OMEGA) has been discovered as a new type of RNA-guided DNA-cutting enzyme, which is considered to be the evolutionary precursor of the CRISPR-Cas system. The OMEGA system is usually encoded by a transposon and includes an RNA-guided nuclease (such as TnpB, IscB, IsrB or Fanzor) and its non-coding RNA (ωRNA), also known as reRNA. The ωRNA contains a scaffold sequence and a programmable guide sequence that matches the target sequence. In addition, the proximity of the target to the transposon-associated motif (TAM) is also a necessary condition for the OMEGA system to exhibit cutting activity.

[0006] Although the OMEGA system has been successfully used as a genome editing tool in a variety of hosts, the feasibility of utilizing the endogenous OMEGA system for genome editing has not been explored. Summary of the invention

[0007] The present invention is conducted to solve the above-mentioned problems, and aims to provide a gene editing system based on the endogenous EcoTnpB protein of Escherichia coli and its application.

[0008] In a first aspect, the present invention provides a gene editing system based on the endogenous EcoTnpB protein of Escherichia coli (hereinafter referred to as the EcoTnpB system), characterized in that it comprises: a) EcoTnpB protein endogenously expressed by Escherichia coli or a nucleotide sequence encoding the EcoTnpB protein; b) an ωRNA molecule or a nucleotide sequence encoding the ωRNA molecule, wherein the sequence of the ωRNA molecule comprises an RNA scaffold sequence and a guide sequence complementary to a target sequence, and the ωRNA molecule can form a complex with the EcoTnpB protein and guide the EcoTnpB protein to recognize the target sequence; Wherein, the nucleotide sequence of the EcoTnpB protein is shown in SEQ ID NO.1; The RNA scaffold sequence includes a sequence extending from the first base of the sequence shown in SEQ ID NO.2 to at least 160 bases from the 5' end to the 3' end, and the guide sequence includes a sequence extending from the first base of the sequence shown in SEQ ID NO.2 to at least 14 bases from the 5' end to the 3' end.

[0009] Studies have shown that the physiological function of the OMEGA effector element TnpB may be to form a double-strand break by cutting the donor junction after the transposon it carries is transposed, and stimulate homologous recombination through the complete transposon copy on the sister chromatid, so that the transposon is retained at the original site of transposition. Based on this, the inventors assume that TnpB needs to have a higher activity to act on the newly formed donor junction, and combine with an efficient recombination system to retain the transposon before cell division is completed. If this hypothesis is true, by providing customized ωRNA and corresponding editing templates, endogenous TnpB protein and recombination system can be used for genome editing.

[0010] The inventors found through genome sequence analysis that commonly used E. coli strains (such as BL21 (DE3)) contain a single copy of the IS605 transposon, encoding a truncated TnpA and a TnpB (EcoTnpB), thus revealing the activity of the endogenously expressed EcoTnpB protein in inducing DSBs, and further discovered a variety of novel DSB repair regulatory mechanisms. On this basis, a convenient single-plasmid E. coli editing and design EcoTnpB system was developed. Compared with the CRISPR-Cas9 system combined with λred recombination, this system showed significant improvements in colony formation efficiency and ease of use, providing a new option for the gene editing toolbox and providing strong support for research and application in related fields.

[0011] In some embodiments of the first aspect, the RNA scaffold sequence comprises any one of the following: 1) The sequence shown in bases 1 to 300 of SEQ ID NO. 2; 2) the sequence shown in bases 1 to 260 of SEQ ID NO. 2; 3) The sequence shown in bases 1 to 220 of SEQ ID NO. 2; 4) the sequence as shown in bases 1 to 200 of SEQ ID NO. 2; 5) The sequence shown as bases 1 to 180 of SEQ ID NO. 2; 6) The sequence as shown in bases 1 to 160 of SEQ ID NO. 2.

[0012] In some embodiments of the first aspect, the TAM sequence at the 5' end of the target sequence is one of TTTAT, ATTAT, GTTAT, CTTAT, GTTAC or CTTAC.

[0013] In some embodiments of the first aspect, the length of the RNA scaffold sequence is 200-300 nt, and the length of the guide sequence is 14-20 nt.

[0014] In some embodiments of the first aspect, the ω RNA molecule is expressed by an inducible promoter P BAD Regulation.

[0015] The second aspect of the present invention provides a vector system containing the gene editing system described in any one of the first aspects.

[0016] The third aspect of the present invention provides an engineered host cell containing the gene editing system described in any one of the first aspects, characterized in that the engineered host cell is Escherichia coli.

[0017] In some embodiments of the third aspect, the Escherichia coli is any one of BL21 (DE3), Escherichia coli W3110, Escherichia coli DH5α, Escherichia coli JM109, and Escherichia coli MG1655.

[0018] The fourth aspect of the present invention provides an application of the gene editing system as described in the first aspect, the vector system as described in the second aspect, or the engineered host cell as described in the third aspect in the field of nucleic acid recognition or gene editing, characterized in that the application includes gene knockout, gene integration, multi-site continuous editing, multi-site simultaneous editing, and multi-copy integrated expression.

[0019] The fifth aspect of the present invention provides a method for nucleic acid recognition or gene editing, characterized in that the target nucleic acid molecule and the gene editing system described in any one of the first aspects are subjected to nucleic acid recognition or gene editing in a reaction system at 24 to 48°C.

[0020] In some embodiments of the fifth aspect, the reaction system contains metal ions, and the metal ions include one of copper, calcium, cobalt, zinc, nickel, and magnesium ions.

[0021] The sixth aspect of the present invention is an application of a gene editing system as described in any one of the first aspects in constructing a high-yield L-phosphinothricin ammonium strain, characterized in that E. coli BL21 (DE3) is used as the base bacteria, the gene editing system is used to knock out the pyrophosphohydrolase gene mazG, and the nicotinamide adenine dinucleotide kinase gene nadK and the nicotinic acid phosphoribosyltransferase gene pncB are integrated and transferred, thereby constructing a high-yield L-phosphinothricin ammonium strain.

[0022] By implementing the above technical solution, the present invention has the following beneficial effects: The present invention provides a gene editing system based on endogenous EcoTnpB protein. Compared with the CRISPR-Cas system in the prior art, it can achieve efficient knockout, insertion and continuous editing of target genes in Escherichia coli without the introduction of Cas protein. Further experiments show that the EcoTnpB system is not affected by the recA homologous recombinase and has wide application value in different Escherichia coli hosts.

[0023] The EcoTnpB system provided by the present invention can be used to simultaneously insert multiple DNA boxes with evolutionary capabilities into sites within chromosomes. At the same time, combining the EcoTnpB system with the CIChE system can effectively construct high-copy number integrated expression strains, which has great potential in constructing hosts for efficient integrated expression of industrial enzymes. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a diagram of the identification process for EcoTnpB in Example 1; wherein, a: analysis of the EcoTnpB and Dra TnpB domains; b: speculation on the EcoTnpB TAM sequence; c: TTTAT-TAM target interference experiment; d: identification of the TAM sequence.

[0025] Figure 2 It is a characteristic test diagram of the EcoTnpB protein in Example 2; wherein, a: the activity of the EcoTnpB protein at different temperatures; b: the metal ion dependence of the EcoTnpB protein under different metal ion conditions; c: double-stranded DNA cleavage mode.

[0026] Figure 3 This is a test diagram for optimizing the editing efficiency of the EcoTnpB protein in Example 3; wherein, a: ωRNA length test; b: guide length test; c: guide base mismatch test.

[0027] Figure 4 The application of the EcoTnpB system in BL21 (DE3) in the examples is summarized, wherein a: identification of lambda-1 editing by bacteria P; b: Sanger sequencing results of bacteria P; c: editing efficiency of heterologous construction targets; Figure 5 This is a summary of the application of the EcoTnpB system in BL21 (DE3) in the examples, wherein d: sequencing results of clones with failed maeA gene editing; e: EcoTnpB editing plasmid model; f: editing efficiency of the inducible promoter target construction; g: efficiency of continuous editing by the EcoTnpB system.

[0028] Figure 6The following is a summary of the application of the EcoTnpB system in DH5α, JM109, BL21 (DE3), W3100, and MG1655 in the examples; wherein, a: the number of clones (CFU) generated by editing the maeA gene in different strains; b: the efficiency of editing the maeA gene in different strains; c: the number of clones generated by editing the purA gene in different strains; d: the efficiency of editing the purA gene in different strains.

[0029] Figure 7 This is a diagram of the process of constructing a multi-copy integrated strain by the EcoTnpB system in the embodiment, wherein a: the distribution of the IS4 element in the genome; b: the integration result of the mcherry DNA cassette in BL21 (DE3); c: the integration result of the mCherry DNA cassette in BL21 (DE3) ΔrecA; Figure 8 This is a process diagram of constructing a multi-copy integrated strain by the EcoTnpB system in the embodiment, wherein d: EcoTnpB system combined with CIChE system model; e: the copy number of the integrated expression mcherry DNA cassette; f: the color change diagram of the integrated expression mcherry DNA cassette; Fig. 9 This is a process diagram of constructing a multi-copy integrated strain by the EcoTnpB system in the example, wherein g: expression level of the integrated expression nitDNA cassette; h: 1-CA production catalyzed by the integrated expression nit DNA cassette strain.

[0030] Fig.10 This is a test result diagram of the EcoTnpB system constructed a coenzyme self-sufficient glufosinate high-yield strain in the example; wherein, a: BL21 (DE3) ΔmazG strain NAD + / NADP + level; b: the copy number of the integrated expression nadK-pncB DNA cassette; c: the PPO conversion rate of the strain integrated expression nadK-pncB DNA cassette. DETAILED DESCRIPTION

[0031] In order to make the technical means, creative features, objectives and effects achieved by the present invention easier to understand, the present invention is described in detail below in conjunction with embodiments and drawings.

[0032] Example 1: From E. coli Identification of EcoTnpB in BL21(DE3) (1) In the genome information of Escherichia coli BL21 (DE3) (NCBI ACT43273.2), a tnpB protein with a homology of 30% was found (the encoded product was named EcoTnpB), and the sequence of EcoTnpB protein was determined as shown in SEQ ID NO.1 (see Figure 1(a) and inferred that the TAM recognized by EcoTnpB is 5'-TTTAT.

[0033] (2) Identification of EcoTnpB activity. The editing target selected was the TTTAT-TAM downstream site within the λDE3 prophage sequence (lambda-1). Construction of plasmid PJ23119_ωRNA-lambda-1: Use primers 1 and 2 in Table 1 to amplify the linearized vector by PCR with pTarget as a template, then use primers 3 and 4 in Table 1 to amplify the ωRNA with Guide from BL21 (DE3) by PCR, and use a one-step cloning method to clone the fragment into the linearized pTarget vector to obtain plasmid PJ23119_ωRNA-lambda-1.

[0034] Table 1 Primer name Sequence (5'-3') 1 GAGTGTCTTCTGCTTGATTCTTTTTTTGAATTCTCTAG 2 ACTAGTATTATACCTAGGACTGAGCTAGCTG 3 GTCCTAGGTATAATACTAGTCAGATGCCAGGTATGTGGATATACAGC 4 GAATCAAGCAGAAGACACTCTTGACATCCTCCACGCCCT The specific steps are as follows: PCR reaction system (50 μL): 2 μL forward primer (100 μM), 2 μL reverse primer (100 μM), 25 μL 2×Phanta buffer, 1 μL dNTP mixture (10 mM each), 1 μL template, 1 μL DNA polymerase and 18 μL ultrapure water. The PCR program set according to the Phanta Super Fidelity DNA polymerase manual is as follows: 95°C pre-denaturation for 5 min, then 30 cycles (95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 4 min), 72°C final extension for 10 min, 12°C insulation. The obtained recombinant plasmid was transferred to Escherichia coli DH5α competent cells, and the clones were cultured at 37°C for 12 h. Then the clones were picked out and transferred to 10 mL LB liquid culture medium containing 50 μg / mL spectinomycin, and cultured at 37°C, 180 rpm for 10 h, sequenced and identified, and the plasmid was extracted.

[0035] PJ23119_ωRNA-lambda-1 was transformed into E. coli DH5α, BL21(DE3), and BL21(DE3)ΔtnpB competent cells by chemical transformation. The transformed cells were incubated in 10 ml of LB medium without antibiotics at 37°C for 8 h, then serially diluted (1:5) and inoculated on LB agar medium containing 50 μg / mL spectinomycin at 37°C for 16 h.

[0036] The results showed that endogenous EcoTnpB had efficient RNA-guided chromosomal DNA cleavage activity in strain BL21(DE3).

[0037] (3) Identification of EcoTnpB TAM sequence.

[0038] First, establish the ωRNA-TAM library. Step 1: Using the DNA fragment containing the TTTAT flanking target (from the pTarget plasmid) as a template, use primers 1 and 2 in Table 2 to amplify a ~500 bp fragment (fragment 1), which includes 5N adjacent to the target, and use primers 3 and 4 in Table 2 to amplify a ~1000 bp fragment (fragment 2).

[0039] Table 2 Primer name Sequence (5'-3') 1 TTGAGTGAGCTGATACCGCTCG 2 TCACATTCTTGCCCGCCTGA 3 TCAGGCGGGCAAGAATGTGANNNNNCTTATCATCCCCTTTTGCTTATGGAG 4 AGTGGAACGAAAACTCACGTTAAGG The specific steps are as follows: The PCR reaction system is the same as in Example 1 (2). The PCR program set according to the Phanta Super-Fidelity DNA polymerase manual is as follows: 98°C pre-denaturation for 30 seconds, followed by 15 cycles (98°C denaturation for 15 seconds, 58°C annealing for 15 seconds, 72°C extension for 30 seconds), and 72°C final extension for 10 minutes. Purification was performed using the Axygen DNA gel extraction kit.

[0040] Step 2: Fusion PCR to generate ω RNA-TAM library. The PCR reaction system was the same as in Example 1 (2). The PCR program set according to the Phanta Super-Fidelity DNA polymerase manual was as follows: 93°C pre-denaturation for 3 min, followed by 10 cycles (95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 1 min), and 72°C final extension for 10 min.

[0041] Plasmid pET28a_PT7_10xHis_MBP_EcoTnpB_PJ23119_ωRNA was constructed. The linearized vector was amplified by PCR using primers 1 and 2 in Table 3 with pET28a as a template, and then the target fragment was amplified by PCR using primers 3 and 4 with the synthetic gene MBP as a template, and the target fragment was amplified by PCR using primers 5 and 6 with BL21 (DE3) EcoTnpB as a template, and finally the fragment was connected to the linearized pET28a vector by using a one-step cloning method to obtain the plasmid pET28a_PT7_10xHis_MBP.

[0042] Table 3 Primer name Sequence (5'-3') 1 GATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTT 2 TGGTGGTGGTGATGGTGATGGTGATGATGCATTGGTATATCT 3 ACCATCACCATCACCACCACCACggcGAAGAGGGGGAAATTG 4 TAATCGTTTCATAGATCCACCTCCTCCACTACCT 5 GGTGGATCTATGAAACGATTACAGGCATTTAAATTC 6 TTAGCAGCCGGATCTCAGTGGTGGTGGTGGTG The specific steps are as follows: The PCR reaction system is the same as in Example 1 (2). The PCR program set according to the Phanta Super-Fidelity DNA polymerase manual is as follows: 95°C pre-denaturation for 5 minutes, then 30 cycles (95°C denaturation for 30 seconds, 58°C annealing for 30 seconds, 72°C extension for 3 minutes), 72°C final extension for 10 minutes, and 12°C insulation. The obtained recombinant plasmid was transferred into Escherichia coli BL21 (DE3) competent cells, and the clones were cultured at 37°C for 12 hours. Then the clones were picked out and transferred to 10mL LB liquid culture medium containing 50μg / mL kanamycin, and cultured at 37°C, 180rpm for 10 hours, sequenced and identified, and the plasmid was extracted.

[0043] The linearized vector was amplified by PCR using primers 1 and 2 in Table 4 with pET28a_PT7_10xHis_MBP as a template, and then the ωRNA with TAM was amplified by PCR from BL21 (DE3) using primers 3 and 4. Finally, the fragment was connected to the linearized pET28a vector using a one-step cloning method to obtain the plasmid pET28a_PT7_10xHis_MBP_EcoTnpB_PJ23119_ωRNA.

[0044] Table 4 Primer name Sequence (5'-3') 1 TTGACAGCTAGCTCAGTCCTAGGTATAATACT 2 TCAGGCGGGCAAGAATGTGATTGACATCCTC 3 TTGCCCGCCTGATTTTTTTGAATTCTCTAGTTCT 4 CTAGGACTGAGCTAGCTGTCAAAATAAACAAATAGGGGTTC The specific steps are as follows: The PCR reaction system is the same as in Example 1 (2). The PCR program set according to the Phanta Super-Fidelity DNA polymerase manual is as follows: 95°C pre-denaturation for 5 minutes, then 30 cycles (95°C denaturation for 30 seconds, 55°C annealing for 30 seconds, 72°C extension for 6 minutes), 72°C final extension for 10 minutes, and 12°C insulation. The obtained recombinant plasmid was transferred to Escherichia coli BL21 (DE3) competent cells, and the clones were cultured at 37°C for 12 hours. Then the clones were picked out and transferred to 10mL LB liquid culture medium containing 50μg / mL kanamycin, and cultured at 37°C, 180rpm for 10 hours, sequenced and identified, and the plasmid was extracted.

[0045] The pET28a_PT7_10xHis_MBP_EcoTnpB_PJ23119_ωRNA was transferred into the competent Escherichia coli BL21 (DE3) by chemical transformation and cultured at 37°C for 12 h. Then the clone was picked out and transferred to 10 mL of LB liquid culture medium containing 50 μg / mL kanamycin, and cultured at 37°C and 180 rpm for 10 h. The 2% volume was transferred into 100 mL of LB liquid culture medium containing 50 μg / mL ampicillin and kanamycin, and cultured at 37°C and 180 rpm for 2 h. After that, IPTG (final concentration 0.1 mM) was added for induction, and cultured at 37°C and 180 rpm for 12 h.

[0046] The bacterial solution was centrifuged at 8000 rpm and 8°C to collect the cells. 0.4 g of cells were weighed and added to 8 mL of disruption buffer (20 mM Tris-Hcl pH 8.0, 500 mM NaCl, 5 mM mercaptoethanol, 25 mM imidazole, 5% glycerol) for resuspending, and ultrasonically disrupted at 150 W for 15 min. The cells were centrifuged at 8000 rpm and 4°C in a low-temperature centrifuge to collect the supernatant.

[0047] EcoTnpB RNP complex was purified using a gravity column pre-packed with Ni-NTA agarose purification resin as follows: Step 1: Add 2 mL of ultrapure water and mix thoroughly with the resin. After the ultrapure water has completely dripped, add another 2 mL of ultrapure water and repeat the washing 3 times. Step 2: Add 2 mL of solution A (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 5 mM mercaptoethanol, 50 mM imidazole, 5% glycerol) and mix thoroughly with the resin to equilibrate the column material. After the resin is completely dripped, add more and repeat the washing three times. Step 3: Add the supernatant and the resin and mix thoroughly. Place on ice for 30 minutes. Open the plunger and wait for the supernatant to drip completely before proceeding to the next step. Step 4: Slowly add 2 mL of solution A, add more after it has completely dripped, and repeat the washing 3 times; Step 5: Slowly add 2 mL of solution B (20 mM Tris-Hcl pH 8.0, 500 mM NaCl, 5 mM mercaptoethanol, 200 mM imidazole, 5% glycerol), repeat twice, collect the eluate and determine the protein concentration.

[0048] Take 1 μg of ωRNA-TAM library and use reaction buffer (10mM Tris-HCl pH7.5, 100mM NaCl, 10mM CoCl2) and the EcoTnpB-RNP complex (complex formed by EcoTnpB and ωRNA) of the above step (final protein concentration 0.5g / L), react at 37°C for 30min to obtain the enzyme cleavage product.

[0049] 100ng 5N TAM library is contained 1g / L EcoTnpB-RNP complex, 20mM Tris-HCl buffer (pH8.0), 5mM 2-mercaptoethanol, 1mM EDTA, 100mM NaCl, 2mM MnCl2.Reaction is stopped by adding 10 times of loading dye solution.5N TAM library and cleavage product remaining in the reaction mixture are separated by gel electrophoresis.A small part gel at about 500bp band is cut out, as the initial template of deep sequencing.Use primer 1 and primer 2 in table 5 with the initial template of deep sequencing, deep sequencing product is amplified by PCR.

[0050] Table 5 Primer name Sequence (5'-3') 1 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTGCAGAAGCTTAGATCTATTACCC 2 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCAGGCGGGCAAGAATGTGA The specific steps are as follows: The PCR reaction system is the same as in Example 1 (2). The PCR program set according to the Phanta Super-Fidelity DNA polymerase manual is as follows: 95°C pre-denaturation for 5 min, then 30 cycles (95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 1 min), 72°C final extension for 10 min, and 12°C insulation.

[0051] The amplified products were sequenced deeply, and the results showed that TTTAT, GTTAT, CTTAT, GTTAC, ATTAT, and CTTAC sequences were enriched in the 5N region ( Figure 1 d) in.

[0052] Example 2: Analysis of the properties of EcoTnpB protein (1) Activity of EcoTnpB protein at different temperatures. The pET-10xhis-MBP-EcoTnpB-ωRNA plasmid was constructed, and the EcoTnpB-RNP complex was purified. The EcoTnpB-RNP complex was subjected to a cleavage experiment at different temperatures in vitro with a 1500 bp DNA fragment containing a 20 base pair (bp) target sequence, which carried the TTTAT-Guide fragment. The specific steps were as follows: 1 g / L EcoTnpB-RNP complex and 100 ng of the double-stranded oligo cloned DNA fragment carrying the TTTAT-Guide sequence were added to a buffer containing 20 mM Tris-HCl buffer (pH 8.0), 5 mM 2-mercaptoethanol, 1 mM EDTA, 100 mM NaCl, and 2 mM MnCl2, and reacted at different temperatures (4-72°C) for 20 minutes. The reaction was stopped by adding 30 mM EDTA, 50% (v / v) glycerol, 1% (w / v) SDS, 0.25% (w / v) xylene cyanol FF, and 0.25% (w / v) bromophenol blue. 10× loading dye was then added and the cleavage reaction was analyzed by agarose or denaturing PAGE electrophoresis.

[0053] The results showed that the programmed enzyme had specific cleavage activity at 24 to 48°C, with the best enzyme activity at 40°C ( Figure 2 a) in the figure.

[0054] (2) Metal ion dependence. According to the method described in 1, the reaction temperature was set at 40°C, and the 2mM MnCl2 in the buffer was replaced with CuCl2, CaCl2, CoCl2, ZnCl2, NiCl2 or MgCl2, respectively, to test the metal ion dependence. The results showed that the activity was highest in the presence of cobalt ions, and it was also lower in the presence of manganese ( Figure 2 b) in the above.

[0055] (3) Double-stranded DNA cleavage method. The double-stranded DNA fragments formed after fragment cleavage were further recovered and sequenced. Sanger sequencing of the cleavage products showed that EcoTnpB cleaved downstream of the Guide after the 14th to 20th nt on the non-target strand (NTS) and after the 21st and 22nd nt on the target strand (nt). Figure 2 c) in.

[0056] These results show the activity of EcoTnpB protein at different temperatures, its dependence on metal ions, and differences in double-stranded DNA cleavage, revealing some unique properties of this type of protein.

[0057] Example 3: Optimizing the editing efficiency of EcoTnpB protein The factors affecting the editing efficiency of TnpB mainly include the length of the RNA scaffold sequence (Scaffold), the length of the guide sequence (Guide) and the tolerance of the guide sequence (Guide) mismatch. In order to improve the editing efficiency of EcoTnpB, the effects of ωRNA length, Guide length, single base mismatch of Guide and double base mismatch of Guide on the editing efficiency of EcoTnpB were tested to obtain the technical solution with optimal editing efficiency.

[0058] (1) RNA scaffold length test. The RNA scaffold sequence and guide sequence were synthesized by extending from the 5' end to the 3' end according to the first base of the sequence shown in SEQ ID NO.2. The plasmids containing RNA scaffold sequences of different lengths (the guide length was uniformly set to 20nt) were transferred into BL21 (DE3), and the lethality of the strain was analyzed to evaluate the interference efficiency of guide sequences of different lengths. The interference plasmids of ωRNA of different lengths were constructed as follows: pωRNA-300nt-lambda-1 (Scaffold 1~300nt); pωRNA-260nt-lambda-1 (Scaffold 1~260nt); pωRNA-220nt-lambda-1 (Scaffold 1~220nt); pωRNA-200nt-lambda-1 (Scaffold 1~200nt); pωRNA-180nt-lambda-1 (Scaffold 1~180nt); pωRNA-160nt-lambda-1 (Scaffold 1~160nt); pωRNA-140nt-lambda-1 (Scaffold 1~140nt); pωRNA-120nt-lambda-1 (Scaffold 1~120nt); pωRNA-100nt-lambda-1 (Scaffold 1~100nt); pωRNA-80nt-lambda-1 (Scaffold 1~80nt); pωRNA-60nt-lambda-1 (Scaffold 1~60nt); pωRNA-40nt-lambda-1 (Scaffold 1~40nt); pωRNA-0nt-lambda-1.

[0059] The plasmid interference experiment was carried out using the above plasmids. The specific method is as follows: Step 1: Transfer the constructed recombinant plasmid into E. coli DH5α competent cells and culture the clones at 37°C for 12 hours. Then pick out the clones and transfer them to 10mL LB liquid medium containing 50μg / mL spectinomycin, and culture them at 37°C and 180rpm for 10 hours, sequence and identify, and extract the plasmid; Step 2: Transfer the clone successfully edited in step 1 into 10 mL of LB liquid medium containing 50 μg / mL spectinomycin and culture at 37°C, 180 rpm for 12 h to extract the plasmid; Step 3: The above plasmids were transformed into competent E. coli BL21 (DE3), and the transformed cells were incubated in 10 ml of LB medium without antibiotics at 37°C for 8 h, then serially diluted (1:5) and inoculated on LB agar medium containing 50 μg / mL spectinomycin at 37°C for 16 h.

[0060] The results showed that EcoTnpB editing requires a scaffold length of 300 nt to 160 nt, and editing cannot be performed when the scaffold length is less than 140 nt ( Figure 3 a) in the figure.

[0061] (2) Guide length test. The RNA scaffold sequence and guide sequence were synthesized by extending from the 5' end to the 3' end of the first base of the sequence shown in SEQ ID NO.2. The interference plasmids containing guide sequences of different lengths (the scaffold length was uniformly set to 200nt) were transferred into BL21 (DE3) and the lethality of the strain was analyzed to evaluate the interference efficiency of guide sequences of different lengths. The interference plasmids with guide sequences of different lengths constructed are as follows: pωRNA-lambda-1-guide 0nt; pωRNA-lambda-1-guide 10nt (5'-GAGTGTCTTC); pωRNA-lambda-1-guide 12nt (5'-GAGTGTCTTCTG); pωRNA-lambda-1-guide 14nt (5'-GAGTGTCTTCTGCT); pωRNA-lambda-1-guide 16nt (5'-GAGTGTCTTCTGCTTG); pωRNA-lambda-1-guide 18nt (5'-GAGTGTCTTCTGCTTGAT); pωRNA-lambda-1-guide 20nt (5'-GAGTGTCTTCTGCTTGATTC); pωRNA-lambda-1-guide 22nt (5'-GAGTGTCTTCTGCTTGATTCCT); pωRNA-lambda-1-guide 24nt (5'-GAGTGTCTTCTGCTTGATTCCTCT); pωRNA-lambda-1-guide 26nt (5'-GAGTGTCTTCTGCTTGATTCCTCTGC); pωRNA-lambda-1-guide 28nt (5'-GAGTGTCTTCTGCTTGATTCCTCCTGCTG); pωRNA-lambda-1-guide 30nt (5'-GAGTGTCTTCTGCTTGATTCCTCCTGCTGGC).

[0062] The plasmid interference experiment was carried out using the above plasmid, and the specific method was the same as steps 1-3 of Example 3(1).

[0063] The results showed that the guide needs to be at least 14 nt in length to mediate efficient cleavage of chromosomal DNA ( Figure 3 b) in the above.

[0064] (3) Test of guide base mismatch. The test experimental model is the same as above. By introducing base mutations (A→T, T→A, C→G, G→C) into the guide sequence, the effect of the guide sequence on the activity of EcoTnpB endonuclease was studied. The constructed single base mismatch guide interference plasmid is as follows: pωRNA-lambda-1-guide 20nt-01 (5'-CAGTGTCTTCTGCTTGATTC); pωRNA-lambda-1-guide 20nt-02 (5'-GTGTGTCTTCTGCTTGATTC); pωRNA-lambda-1-guide 20nt-03 (5'-GACTGTCTTCTGCTTGATTC); pωRNA-lambda-1-guide 20nt-04 (5'-GAGAGTCTTCTGCTTGATTC); pωRNA-lambda-1-guide 20nt-05 (5'-GAGTCTCTTCTGCTTGATTC); pωRNA-lambda-1-guide 20nt-06 (5'-GAGTGACTTCTGCTTGATTC); pωRNA-lambda-1-guide 20nt-07 (5'-GAGTGTGTTCTGCTTGATTC); pωRNA-lambda-1-guide 20nt-08 (5'-GAGTGTCATCTGCTTGATTC); pωRNA-lambda-1-guide 20nt-09 (5'-GAGTGTCTACTGCTTGATTC); pωRNA-lambda-1-guide 20nt-10 (5'-GAGTGTCTTGTGCTTGATTC); pωRNA-lambda-1-guide 20nt-11 (5'-GAGTGTCTTCAGCTTGATTC); pωRNA-lambda-1-guide 20nt-12 (5'-GAGTGTCTTCTCCTTGATTC); pωRNA-lambda-1-guide 20nt-13 (5'-GAGTGTCTTCTGGTTGATTC); pωRNA-lambda-1-guide 20nt-14 (5'-GAGTGTCTTCTGCATGATTC); pωRNA-lambda-1-guide 20nt-15 (5'-GAGTGTCTTCTGCTAGATTC); pωRNA-lambda-1-guide 20nt-16 (5'-GAGTGTCTCTGCTTCATTC); pωRNA-lambda-1-guide 20nt-17 (5'-GAGTGTCTTCTGCTTGTTTC); pωRNA-lambda-1-guide 20nt-18 (5'-GAGTGTCTTCTGCTTGAATC); pωRNA-lambda-1-guide 20nt-19 (5'-GAGTGTCTTCTGCTTGATAC); pωRNA-lambda-1-guide 20nt-20 (5'-GAGTGTCTTCTGCTTGATTG).

[0065] The constructed double base mismatched Guide interference plasmid is as follows: pωRNA-lambda-1-guide 20nt-01 / 02 (5'-CTGTGTCTTCTGCTTGATTC); pωRNA-lambda-1-guide 20nt-03 / 04 (5'-GACAGTCTTCTGCTTGATTC); pωRNA-lambda-1-guide 20nt-05 / 06 (5'-GAGTCACTTCTGCTTGATTC); pωRNA-lambda-1-guide 20nt-07 / 08 (5'-GAGTGTGATCTGCTTGATTC); pωRNA-lambda-1-guide 20nt-09 / 10 (5'-GAGTGTCTAGTGCTTGATTC); pωRNA-lambda-1-guide 20nt-11 / 12 (5'-GAGTGTCTTCACCTTGATTC); pωRNA-lambda-1-guide 20nt-13 / 14 (5'-GAGTGTCTTCTGGATGATTC); pωRNA-lambda-1-guide 20nt-15 / 16 (5'-GAGTGTCTTCTGCTACATTC); pωRNA-lambda-1-guide 20nt-17 / 18 (5'-GAGTGTCTTCTGCTTGTATC); pωRNA-lambda-1-guide 20nt-19 / 20 (5'-GAGTGTCTTCTGCTTGATAG).

[0066] The plasmid interference experiment was carried out using the above plasmid, and the specific method was the same as steps 1-3 of Example 3(1).

[0067] The results showed that a single mismatch within positions 1-13 and two consecutive mismatches within positions 1-16 significantly reduced the cell-killing activity of EcoTnpB, indicating that EcoTnpB conforms to the general pattern observed in other RNA-guided endonucleases, which show high specificity for the Guide-proximal or protospacer-adjacent motif (Guide)-proximal region ( Figure 3 c) in.

[0068] Example 4: Heterologous construction of pωRNA plasmids edited in BL21 (DE3) (1) Editing of different TAMs in BL21(DE3).

[0069] Construct PJ23119_ωRNA-lambda-1(TTTAT)_donor_547-bp deletion template, PJ23119_ωRNA-lambda-2(ATTAT)_donor_547-bp deletiontemplate, PJ23119_ωRNA-lambda-3(GTTAT)_donor_547-bp deletion template, PJ23119_ωRNA-lambda-4(CTTAT)_donor_547-bp deletiontemplate, PJ23119_ωRNA-lambda-5(GTTAC)_donor_547-bpdeletion template, PJ23119_ωRNA-lambda-6(CTTAC)_donor_547-bpdeletiontemplate.

[0070] The linearized vector was amplified by PCR using primers 1 and 2 in Table 6 with PJ23119_ωRNA-lambda-1 / 2 / 3 / 4 / 5 / 6 as a template, and then the upstream and downstream homology arms of lambda-1 were amplified by PCR using primers 3-6 with BL21 (DE3) as a template. The two fragments were connected to the linearized PJ23119_ωRNA-lambda-1 / 2 / 3 / 4 / 5 / 6 vector using a one-step cloning method to obtain the desired plasmid.

[0071] Table 6 Primer name Sequence (5'-3') 1 GATCTATTACCCTGTTATCCCTACTCGA 2 TGTAAGCTTCTGCAGGTCGACTCTAGAGAA 3 TGCAGAAGCTTACACCTTCGTAAGACTGTAGTGT 4 GCCAACATTGAGTTATTAAAATTGCCATCCCAACAGCATTGCATAT 5 GTTGGGATGGCAATTTTAATAACTCAATGTTGGCCTGTATAGCTTCA 6 ATAACAGGGTAATAGATCACGACTGCTACGACCACTG The specific steps are as follows: The PCR reaction system is the same as in Example 1 (2). The PCR program set according to the Phanta Super-Fidelity DNA polymerase manual is as follows: 95°C pre-denaturation for 5 min, then 30 cycles (95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 3 min), 72°C final extension for 10 min, and 12°C insulation. The obtained recombinant plasmid was transferred into Escherichia coli BL21 (DE3) competent cells, and the clones were cultured at 37°C for 12 h. Then the clones were picked out and transferred to 10 mL of LB liquid culture medium containing 50 μg / mL kanamycin, and cultured at 37°C, 180 rpm for 10 h, sequenced and identified, and the plasmid was extracted.

[0072] The above plasmids were used for gene editing experiments. The specific method is as follows: Step 1: Transfer the constructed recombinant plasmid into E. coli DH5α competent cells and culture the clones at 37°C for 12 hours. Then pick out the clones and transfer them to 10mL LB liquid medium containing 50μg / mL spectinomycin, and culture them at 37°C and 180rpm for 10 hours, sequence and identify, and extract the plasmid; Step 2: Transfer the clone successfully edited in step 1 into 10 mL of LB liquid medium containing 50 μg / mL spectinomycin and culture at 37°C, 180 rpm for 12 h to extract the plasmid; Step 3: The plasmid obtained in step 2 was transferred into BL21 (DE3) competent cells and spread on a plate containing 50 μg / mL spectinomycin. The cells were cultured at 37°C for 12 h, and the editing site colony PCR was used to verify whether the genome was successfully edited.

[0073] The results showed that it was possible to achieve a high knockout efficiency of the gene ( Figure 4 a), and the deletion of 547 bp sequence at this site was verified by sequencing ( Figure 4 b). Different TAMs have high editing efficiency in E. coli BL21(DE3) ( Figure 4 c) in.

[0074] (2) Editing effects of different editing types. Targeting BL21(DE3) specific-1 (5'-GCTGAGTCTTCCAGTACAGG), specific-2 (5'-GTTGGTCGCTTTTCCGGCTA), and specific-3 (5'-GTAATTCTGGCATTCCGTTC) sites, PJ23119_ωRNA-specific-1(TTTAT_Guide)_donor_25-bp replacement template, PJ23119_ωRNA-specific-2(TTTAT_Guide)_donor_100-bpinsertion template, and PJ23119_ωRNA-specific-3(TTTAT_Guide)_donor_360-bpdeletion template were constructed. 5'-TTTAT on the lacZ site and purA site of the E. coli genome was selected as the target site for TAM to construct plasmids pReRNA-N20-lacZ and pReRNA-N20-purA: Using primers 1-4 in Table 7 and the Escherichia coli BL21 (DE3) genome as a template, PCR was used to amplify the upstream and downstream homology arm fragments containing the 25-bp replacement template at the specific-1 site, and then primers 5 and 6 were used to amplify the linearized vector by PCR using PJ23119_ωRNA-lambda-1 as a template. Finally, the two fragments were connected to the linearized PJ23119_ωRNA-lambda-1 vector using a one-step cloning method to obtain the plasmid PJ23119_ωRNA_-lambda-1_donor_25-bpreplacement template. Mutation primers were designed according to the 20nt after 5'-TTTAT at the specific-1 site of the Escherichia coli BL21 (DE3) genome. As shown in primers 7 and 8, the mutant PJ23119_ωRNA_-lambda-1_donor_25-bp replacement template was used as a template by PCR to obtain the mutant PJ23119_ωRNA-specific-1_donor_25-bpreplacement template.

[0075] Table 7 Primer Name Sequence (5'-3') 1 GCTTAGATCTATTACCCTAGGCAAGCACCTCCGGGACCT 2 TATCAACGGTGGTATATCCAGTGAGTTGTAGCTGTCGCC 3 TGGATATACCACCGTTGATATTACCTCTGGCGCAGGTGA 4 TGAACTCGAGTAGGGATAACTGCAGCAACTGCGGCAGAG 5 GTTATCCCTACTCGAGTTCATGTGCAGCTCCATAAGCAAAAGG 6 AGGGTAATAGATCTAAGCTTCTGCAGTCTAGAGAATTCAAA 7 TCAAGCAATCATCCTGTCAGGGAGTTTTTTTGAATTCTCTAG 8 CTCCCTGACAGGATGATTGCTTGACATCCTCCACGCCCTGA The specific steps are as follows: The PCR reaction system is the same as in Example 1 (2). The PCR program set according to the Phanta Super Fidelity DNA polymerase manual is as follows: 95°C pre-denaturation for 5 min, then 30 cycles (95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 3 min), 72°C final extension for 10 min, and 12°C insulation.

[0076] Using primers 1-4 as shown in Table 8, the homology arm fragments upstream and downstream of the specific-2 site were amplified by PCR using the Escherichia coli BL21 (DE3) genome as a template, and then primers 5 and 6 were used to mutate the 100-bp pinsertion template by PCR. Primers 7 and 8 were used to amplify the linearized vector by PCR using PJ23119_ωRNA-lambda-1 as a template. Finally, the three fragments were connected to the linearized PJ23119_ωRNA-lambda-1 vector by using a one-step cloning method to obtain the plasmid PJ23119_ωRNA-lambda-1_donor_100-b pinsertion template. Mutation primers were designed according to the 20 nt after 5'-TTTAT of the specific-2 site of the Escherichia coli BL21 (DE3) genome, as shown in primers 9-10, using PJ23119_ωRNA-lambda-1_donor_100-bp insertion Template was used as template to obtain the mutant PJ23119_ωRNA-specific-2_donor_100-bpinsertion template by PCR.

[0077] Table 8 Primer Name Sequence (5'-3') 1 AGCTTAGATCTATTACCCTATTGGCCTGAGCAACGTCAC 2 CTGGATATACCACCGTTGATATATAAACAGGGGAAGTAA 3 ATCAACGGTGGTATATCCAGTGAACCGCTGAAGATAAACAA 4 TGAACTCGAGTAGGGATAACTTTATTAGACCCCAATAATATG 5 TTGAGTGAGCTGATACCGCTCGCCG 6 TCAGTCGATCATAGCACGAT 7 GTTATCCCTACTCGAGTTCATGTGCAGCTCCATAAGCAAAA 8 AGGGTAATAGATCTAAGCTTCTGCAGTCTAGAGAATTCAAA 9 TCAAGCTGAGTCTTCCAGTACAGGTTTTTTTGAATTCTCTAG 10 CTGTACTGGAAGACTCAGCTTGACATCCTCCACGCCCTGAA The specific steps are as follows: The PCR reaction system is the same as in Example 1 (2). The PCR program set according to the Phanta Super Fidelity DNA polymerase manual is as follows: 95°C pre-denaturation for 5 min, then 30 cycles (95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 3 min), 72°C final extension for 10 min, and 12°C insulation.

[0078] Using primers 1-4 as shown in Table 9 and the Escherichia coli BL21 (DE3) genome as a template, the upstream and downstream homology arm fragments of the specific-3 site were amplified by PCR, and then primers 5 and 6 were used to amplify the linearized vector by PCR with PJ23119_ωRNA-lambda-1 as a template. Finally, the two fragments were connected to the linearized PJ23119_ωRNA-lambda-1 vector by using a one-step cloning method to obtain the plasmid PJ23119_ωRNA-lambda-1_donor_360-bpdeletion template. Mutation primers were designed according to the 20 nt after 5'-TTTAT at the specific-2 site of the Escherichia coli BL21 (DE3) genome, as shown in primers 7 and 8, and the mutant PJ23119_ωRNA-specific-3_donor_360-bp deletion template was obtained by PCR using PJ23119_ωRNA-lambda-1_donor_360-bpdeletiontemplate as a template.

[0079] Table 9 Primer Sequence Sequence (5'-3') 1 GACCTGCAGAAGCTTATGCTTGCTCAATAAATTTTTCAATCC 2 TTAATCAGCGGAGACCGGCAAATAACCGTCAATTAACCGTG 3 TTGACGGTTATTTGCCGGTCTCCGCTGATTAAATCCGGGTTT 4 AATCATCTTCGTAAAATTTCAAAGGAAATAGATTTACAATAT 5 GTTATCCCTACTCGAGTTCATGTGCAGCTCCATAAGCAAAA 6 AGGGTAATAGATCTAAGCTTCTGCAGTCTAGAGAATTCAAA 7 GTGAGTTATGATTGGCGAGATTTTTTTGAATTCTCTAG 8 TCTCGCCAATCATAACTCACTTGACATCCTCCACGCCCTGA Editing at the specific-1 site / specific-2 site / specific-3 site of the Escherichia coli genome, the specific steps are as follows, the same as steps 1-3 of Example 4 (1).

[0080] The results showed that EcoTnpB could cope with different editing methods and successfully edited ( Figure 4 c) in.

[0081] Example 5: Endogenous construction of pωRNA plasmid edited in BL21 (DE3) EcoTnpB (1) Endogenous target site editing. The present invention designed targets existing in BL21 (DE3), edited four genes, namely maeA, cadA, purA and recA, and constructed PJ23119_ωRNA-maeA+500-bp deletion template, PJ23119_ωRNA-cadA+900-bp deletion template, PJ23119_ωRNA-purA+1300-bp replacement template and PJ23119_ωRNA-recA+1000-bp deletion template.

[0082] To construct the plasmid PJ23119_ωRNA-maeA+500-bp deletion template, primers 1-4 in Table 10 were used to amplify the upstream and downstream homology arm fragments of the maeA site by PCR using the Escherichia coli BL21 (DE3) genome as a template, and then primers 5 and 6 were used to amplify the linearized vector by PCR using PJ23119_ωRNA-lambda-1 as a template. Finally, the three fragments were connected to the linearized PJ23119_ωRNA-lambda-1 vector by using a one-step cloning method to obtain the plasmid PJ23119_ωRNA-lambda-1+500-bpdeletion template. Mutation primers were designed according to the 20 nt after 5'-TTTAT of the maeA site of the Escherichia coli BL21 (DE3) genome, as shown in primers 7 and 8, using PJ23119_ωRNA-lambda-1+500-bp deletion. The mutant PJ23119_ωRNA-maeA+500-bpdeletion template was obtained by PCR using the template.

[0083] Table 10 Primer sequences Sequence (5'-3') 1 AGAAGCTAGATCTATTACCCTATGGAGCTGACCAAATGGGTGG 2 TCACTGGATATACCACCGTTGATATGTAACTCACTCTTTTTGAAT 3 ATATCAACGGTGGTATATCCAGTGACGGGATGGGCATTCCGATCG 4 ACATGAACTCGAGTAGGGATAACTAAAGACTTTCTGCCGCGCCG 5 GTTATCCCTACTCGAGTTCATGTGCAGCTCCATAAGCAAAAGG 6 AGGGTAATAGATCTAAGCTTCTGCAGTCTAGAGAATTCAAA 7 ATCCCTTACGCTGGCCCTGTTTTTTTTGAATTCTCTAGA 8 ACAGGCCAGCGTAAGGGATTTGACATCCTCCACGCCCTGA The specific steps are as follows: The PCR reaction system is the same as in Example 1 (2). The PCR program set according to the Phanta Super Fidelity DNA polymerase manual is as follows: 95°C pre-denaturation for 5 minutes, then 30 cycles (95°C denaturation for 30 seconds, 58°C annealing for 30 seconds, 72°C extension for 3 minutes), 72°C final extension for 10 minutes, and 12°C insulation. The obtained recombinant plasmid was transferred into Escherichia coli BL21 (DE3) competent cells, and the clones were cultured at 37°C for 12 hours. Then the clones were picked out and transferred to 10mL of LB liquid culture medium containing 50μg / mL spectinomycin, and cultured at 37°C and 180rpm for 10 hours to verify whether the editing was successful.

[0084] However, editing of maeA using this strategy failed, as sequencing of eight randomly selected colonies grown after transformation showed that no editing had occurred in maeA. Sequencing of ω RNA sequences in edited plasmids extracted from these colonies revealed that their 3' scaffold and / or guide sequences did not match the PCR-based site-directed mutagenesis destination sequences ( Figure 5 d in ). Similarly, editing the three genes cadA, purA, and recA using the above strategy also failed, and the ωRNA sequence in the extracted editing plasmid was mismatched ( Figure 5d in Figure 5). However, if the third nucleotide position downstream of the 5' end of the guide sequence was intentionally designed to mismatch the target of maeA, PCR-based site-directed mutagenesis could be successfully achieved. The results showed that when a perfectly matching guide sequence was introduced into the editing plasmid using PCR-based site-directed mutagenesis, a gapped plasmid encoding a functional ω RNA killed the cells after transformation. A few colonies survived because they were transformed with a gapped plasmid containing a non-functional ω RNA, presumably generated during the PCR process.

[0085] (2) Introduction of inducible promoter P BAD Construct target site editing. Construct plasmid PBAD_ωRNA-maeA+500-bpdeletion template, use primers 1 and 2 in Table 11 and pKD46 plasmid as template to amplify P by PCR. BAD The fragment was then amplified by PCR using primers 3 and 4 with PJ23119_ωRNA-lambda-1+500-bp deletion template as the template to obtain a linearized vector. Finally, the fragment was connected to the linearized vector using a one-step cloning method to obtain the plasmid PBAD_ωRNA-lambda-1+500-bpdeletion template. The mutant PBAD_ωRNA-maeA+500-bp deletion template was obtained by PCR using the primers shown in the mutant primer sequences 7 and 8 designed according to the 20 nt after 5'-TTTAT of the maeA site of the Escherichia coli BL21 (DE3) genome in the above (1).

[0086] Table 11 Primer sequences Sequence (5'-3') 1 ACCGCATATGCTGGATCCTTATGACAACTTGACGGCTACATCA 2 TCTTAAAGTTAAACAAATTATTTCTAGAGGATGGAGAAACAGTA 3 TTTGTTTAACTTTAAGAAGGAGACAGATGCCAGGTATGTGGATA 4 GGATCCAGCATATGCGGTGTGAAATACCGCACAG The specific steps are as follows: The PCR reaction system is the same as in Example 1 (2). The PCR program set according to the Phanta Super Fidelity DNA polymerase manual is as follows: 95°C pre-denaturation for 5 min, then 30 cycles (95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 5 min), 72°C final extension for 10 min, and 12°C insulation.

[0087] The above plasmids were used for gene editing experiments. The specific method is as follows: Step 1: Transfer the constructed recombinant plasmid into E. coli BL21 competent cells and culture the clones at 37°C for 12 hours. Then pick out the clones and transfer them to 10 mL of LB liquid medium containing 50 μg / mL spectinomycin, and culture them at 37°C and 180 rpm for 10 hours, sequence and identify, and extract the plasmid; Step 2: Transfer the clone successfully edited in step 1 into 10 mL of LB liquid medium containing 50 μg / mL spectinomycin and culture at 37°C, 180 rpm for 12 h to extract the plasmid; Step 3: The plasmid obtained in step 2 was transferred into BL21 (DE3) competent cells and spread on a plate containing 50 μg / mL spectinomycin and 0.1 M L-arabinose, cultured at 37°C for 12 h, and the editing site colony PCR was used to verify whether the genome was successfully edited.

[0088] Colony PCR and Sanger sequencing of PCR products showed 100% editing efficiency.

[0089] Repeat the above steps to edit cadA, recA, lacZ, tnpB, purA, arcA, mazF, and yohK. The results showed that except for purA, whose editing efficiency was only ~25%, the editing efficiency of other genes was above 50% ( Figure 5 f).

[0090] Example 6: EcoTnpB can be continuously edited in BL21(DE3) In order to achieve continuous editing, the present invention introduces a plasmid digestion system sacB. Using the plasmid of Example 5, using primers 1 and 2 as shown in Table 11 with the Bacillus subtilis genome as a template, the sacB fragment was amplified, using primers 3 and 4 with PBAD_ωRNA-maeA+500-bp deletion template as a template, a linearized vector PBAD_ωRNA-maeA+500-bp deletion template was amplified, and the sacB fragment was connected to the linearized vector by one-step cloning to obtain the PBAD_ωRNA-maeA+500-bp deletion template-sacB plasmid.

[0091] Table 12 Primer sequences Sequence (5'-3') 1 AAGAGCGCCTGATGCGGTATTATGAACATCAAAAAGTTTGCAAA 2 CGCACAGATGCGTAAGGAGAATTATTTGTTAACTGTTAATTGTCC 3 TTCTCCTTACGCATCTGTGCGGTATTTCACACCGCAT 4 AATACCGCATCAGGCGCTCTTCCGCTTCCTGCTCAC The specific steps are as follows: The PCR reaction system is the same as in Example 1 (2). The PCR program set according to the Phanta Super Fidelity DNA polymerase manual is as follows: 95°C pre-denaturation for 5 min, then 30 cycles (95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 5 min), 72°C final extension for 10 min, and 12°C insulation.

[0092] The operation was the same as above, and PBAD_ωRNA-cadA+900-bp deletion template-sacB / PBAD_ωRNA-purA+1300-bp replacement template-sacB / PBAD_ωRNA-lacZ+25-bp replacement template-sacB / PBAD_ωRNA-yohK+30-bp replacement template-sacB were constructed, and the maeA / cadA / purF / arcA / yohK sites in the Escherichia coli BL21(DE3) genome were continuously edited. The results are shown in Figure 5 , the specific method is as follows: Step 1: Transform the plasmid into BL21 competent cells and verify whether the genome is successfully edited according to steps 1-3 of Example 5(2); Step 2: Transfer the clone successfully edited in step 1 into 10 mL of LB liquid medium containing 20 g / L sucrose and culture at 37°C and 180 rpm for 12 h; Step 3: Take 10 μL of the bacterial solution from step 2 into a sterilized and dried EP tube, then add 990 μL of sterile water to dilute, repeat the dilution for a total of 10,000 times, take 30 μL of the diluted bacterial solution and spread it on a non-antibiotic plate, and culture it at 37°C for 12 h; Step 4: Use a sterilized and dried toothpick to take a single colony from the plate cultured for 12 hours in step 3, and use the copy printing method to copy it on a plate containing 50 μg / mL spectinomycin and a plate without antibiotics. After copying, culture at 37°C for 12 hours; Step 5: If there is no growth on the plate containing spectinomycin, the plasmid is successfully eliminated. Find the corresponding colony on the non-antibiotic plate, take a single colony into 10mL of LB liquid culture medium containing 50μg / mL non-antibiotic and culture it at 37℃, 180rpm for 12h, add it to the bacterial preservation tube with 30% glycerol solution at a volume ratio of 1:1, write the corresponding editing site mark and time, and store it at -80℃ for later use; Step 6: Prepare edited Escherichia coli BL21 (DE3) competent cells, the specific method is as follows: take 10 μL from the edited bacterial tube and streak it on the antibiotic-free plate, and culture it at 37°C for 12 hours; take a single colony on the plate and transfer it to 10mL LB liquid culture medium and culture it at 37°C and 180rpm for 10 hours; take the above seed liquid and inoculate it into a 100mL LB liquid culture medium conical flask at a 1% inoculation rate, and culture it at 37°C and 180rpm for 2 hours; take out the conical flask and put it in a pre-prepared ice box and ice bath for 15 minutes; take out the conical flask, and divide the cooled bacterial liquid into 50mL EP tubes that have been sterilized and dried in advance on the clean bench, and ice bath for 15 minutes. After balancing the 50mL EP tube on a balance, put it in a low-temperature centrifuge and centrifuge it at a temperature of 4°C and a speed of 5000rpm for 10 minutes; after the centrifugation, take out 50mL from the low-temperature centrifuge EP tube, put it in an ice box, take it out from the clean bench, discard the residual culture medium in the supernatant, add 10mL of pre-sterilized 0.1M CaCl2 solution, resuspend it in an ice bath for 30min; put it in a low-temperature centrifuge, centrifuge it at 4°C and 4000rpm for 10min; after centrifugation, take out the 50mL EP tube from the low-temperature centrifuge, put it in an ice box, take it out from the clean bench, discard the supernatant, add 2mL of pre-sterilized 0.1M CaCl2+15% glycerol solution, and after complete resuspending, divide it into 1.5mL EP tubes that have been sterilized and dried in advance according to 100μL of liquid per tube, write the corresponding competent state mark and the time of making the competent state, and store it at -80°C for use; Step 7: Repeat steps 1-6 to continuously edit the cadA / purA / purA / lacZ / yohK sites in the E. coli BL21 (DE3) genome.

[0093] The results showed that the EcoTnpB system performed five consecutive rounds of genome editing, with each round of editing efficiency comparable to that observed in a single round of editing ( Figure 5 f).

[0094] Example 7: Editing effect of EcoTnpB system in different E. coli hosts The present invention further tested the editing effect of EcoTnpB in different E. coli hosts, and selected representative hosts DH5α, JM109, W3100, and MG1655 for testing. The specific steps are as follows: Step 1: Add plasmids PBAD_ωRNA-maeA+500-bp deletion template-sacB and PBAD_ωRNA-purA+1300-bp replacement template-sacB into DH5α, JM109, W3100, and MG1655 competent cells, respectively, and place on ice for 30 minutes; Step 2: Heat shock the competent cells in a 42°C water bath for 90 seconds, add 600 μL of pre-cooled LB liquid medium in a clean bench, place in a shaker, and incubate at 37°C and 180 rpm for 1 hour; Step 3: Centrifuge the competent cells obtained in step 3 at 6000 rpm for 1 min, discard 500 μL of supernatant on the clean bench, resuspend and apply to a plate containing 50 μg / mL spectinomycin, and culture at 37°C for 12 h. Use colony PCR at the editing site to verify whether the genome has been successfully edited.

[0095] The results showed that the recA-deficient hosts (strains DH5α and JM109) could not only be successfully edited by the EcoTnpB system, but also exhibited CFU formation efficiencies at least 9 times higher than those of the recA wild-type hosts (strains BL21 (DE3), W3110, and MG1655). Figure 6 The above results show that the EcoTnpB system is not affected by the recA homologous recombinase and has a wide range of application values ​​in different Escherichia coli hosts.

[0096] Example 8: The EcoTnpB system can be used to construct multi-copy integrated strains The use of plasmids to express recombinant genes is subject to structural and segregation instability, host heterogeneity, and the need for antibiotics. Integrative expression offers an alternative strategy to overcome the challenges associated with plasmid-based expression, but the introduction of high-copy number expression cassettes into the host chromosome is often essential to achieve high yields of the target protein. While one-at-a-time integration approaches are tedious, the chemically induced chromosome evolution system (CIChE) can efficiently generate approximately 40-60 consecutive copies of a gene within the E. coli chromosome. The construction of multicopy strains using the CIChE system initially involved integrating into the chromosome a DNA cassette containing the sequence of interest, an antibiotic resistance gene, and two identical regions with low homology to the host genome sequence at both ends of the DNA cassette. Gradually increasing the antibiotic concentration in the culture medium promoted DNA cassette replication in the cell through DNA crossovers between identical regions. Taking advantage of its high efficiency, the EcoTnpB system was applied to simultaneously insert multiple evolvable DNA cassettes into sites within the chromosome. Next, colonies containing DNA cassettes inserted into multiple sites were placed in the CIChE system to simultaneously increase the copy number of each site ( Figure 7-Figure 9 ).

[0097] (1) Integration and expression of cherry red fluorescent protein gene (mCherry). In this study, the IS4 site was selected for integration and expression. PBAD_IS4_donor(chIB_PT7_mCherry_pCat_CmR_chIB)-sacB was constructed. Primers 1 and 2 in Table 13 were used to amplify the IS4 upstream and downstream gene fragments by PCR using the Escherichia coli genome as a template. Primers 3 and 4 were then used to amplify the linearized vector by PCR using the plasmid PBAD_ωRNA-maeA+500-bp deletion template-sacB as a template. The IS4 upstream and downstream gene fragments were connected to the linearized vector by one-step cloning using ClonExpress Ultra OneStep Cloning Kit V2 to obtain the plasmid PBAD_ωRNA-maeA+IS4-sacB. Primers 5 and 6 were used to amplify the CHIB gene fragment of the continuous induced chromosomal evolution (CIChE) DNA cassette by PCR using the Saccharomyces cerevisiae genome as a template. Primers 7 and 10 were used to amplify the mCherry fragment by PCR using the mCherry gene synthesized by Qingke as a template. Primers 9 and 10 were used to amplify the PBAD_ωRNA-maeA+IS4-sacB linearized vector by PCR using the plasmid PBAD_ωRNA-maeA-sacB+IS4 as a template. The ClonExpress Ultra One Step Cloning Kit V2 was used to connect the CHIB gene fragment of the continuous induced chromosomal evolution (CIChE) DNA cassette, the mCherry fragment and the PBAD_ωRNA-maeA+IS4-sacB linearized vector by one-step cloning to obtain the plasmid PBAD_IS4(TTTAT_Guide)_donor(chIB_PT7_mCherry). Primers 11 and 12 were used to amplify the CmR gene fragment by PCR with plasmid pACYCDuet as template. The continuous induced chromosomal evolution (CIChE) DNA cassette CHIB gene fragment, mCherry fragment and PBAD_ωRNA-maeA+IS4-sacB linearized vector were connected by one-step cloning using ClonExpressUltra One Step Cloning Kit V2 to obtain plasmid PBAD_ωRNA-maeA_donor(chIB_PT7_mCherry_pCat_CmR_chIB)-sacB.Primers 13 and 14 were used to design mutation primers based on the 20 nt after 5'-TTTAT at the IS4 site of the Escherichia coli BL21 (DE3) genome, as shown in sequences 9-10 in the following table. The mutant PBAD_IS4(TTTAT_Guide)_donor(chIB_PT7_mCherry_pCat_CmR_chIB)-sacB was obtained by PCR using PBAD_ωRNA-maeA_donor(chIB_PT7_mCherry_pCat_CmR_chIB)-sacB as a template.

[0098] Table 13 Primer sequences Sequence (5'-3') 1 AGAAGCTAGATCTATTACCCTTGGTATTACGCCTGATATGATTTA 2 TTGCTTTCTTGGGGCCAGCCGTTCAGCGTCTCTGCT 3 TTGCTTTCTTGGGGCCAGCCGTTCAGCGTCTCTGCT 4 TCTTGAGGGGTTTTTTGCTGCTCAGCGAGAATCGTCGAAAAGG 5 GCCCCAAGAAAGCAATTAGCTTCTAAGGCT 6 ATTAAAACCTATATTTTTGTAATAAAAAATAAC 7 AAATATAGGTTTTAATAGATCTCGATCCCGCGAA 8 CAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCA 9 TTACAAAAATATAGGTTTTAATCTGCTCAGCGAGAATCG 10 CTTACGTGCCGATCACGCACAAAGATATAGTTCCTCCTTTCAGC 11 TGATCGGCACGTAAGAGGTTCCAACTTTCA 12 CTTTCTTGGGGCTCAGTCCTGCTCCTTTAATGATGATG 13 ATCGTCCGGGTTCACTGGCGTTTTTTTGAATTCTCTAGAGTC 14 CCAGTGAACCCGGACGATTTGACATCCTCCACGCCCTGAAGGA The specific steps are as follows: The PCR reaction system is the same as in Example 1 (2). The PCR program set according to the Phanta Super-Fidelity DNA polymerase manual is as follows: 95°C pre-denaturation for 5 min, then 30 cycles (95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 3 min), 72°C final extension for 10 min, and 12°C insulation.

[0099] The integrative evolution method is as follows: The above plasmids were used for gene editing experiments. The specific method is as follows: Step 1: Gene editing and plasmid elimination operations are the same as steps 1-4 of Example 6.

[0100] Step 2: Find the corresponding single colony on the plate without any resistance, take the single colony into 10mL of LB liquid culture medium containing 50μg / mL of no resistance and culture it at 37℃, 180rpm for 12h, add it to the bacterial preservation tube with 30% glycerol solution at a volume ratio of 1:1, write the corresponding editing site marker (S-5sites-mCherry) and time, and store it at -80℃ for later use; Step 3: Take S-5sites-mCherry from step 2, and continuously induce chromosome evolution by adding 1μg / mL chloramphenicol to 10mL LB medium. After growing to the stable phase, mix with 30% glycerol in a 1:1 ratio, write the corresponding mark and time, and store at -80℃ for later use. At the same time, transfer 100μL of the medium to a new culture tube. In the new test tube, double the concentration of the antibiotic and let it grow to the stable phase. Repeat this step until the antibiotic concentration reaches 640μg / mL.

[0101] Step 4: Take 10 μL of the strain evolved in step 3 and inoculate it into 10 mL of LB medium. Incubate it at 37°C for 10 h. Transfer 1 mL of the bacterial solution into 100 mL of LB liquid medium without antibiotics. Then incubate it at 37°C, 180 rpm. When the OD 600 When the p-value reached 0.6, IPTG (final concentration 0.1 mM) was added to induce expression. The culture was then cultured at 28°C for 10 h. The cells were collected by centrifugation at 12000 rpm for 1 min and resuspended in phosphate buffer (pH 7.5). The proteins in the cells were extracted and analyzed by SDS-PAGE.

[0102] For bacteria with integrated expression cassettes, genomic DNA was extracted using the FastDNA SPIN kit (MP Biomedicals). RT-PCR templates for plasmid expression strains contained plasmid and genomic DNA and were prepared as described previously. Briefly, OD 600 The cells were diluted to 0.6-0.8 twice, and then resuspended with an equal volume of PBS. The cells were lysed by heating at 95°C for 10 minutes, and 1 μL of lysate was used for RT-PCR reaction. The comparative Ct method was used to compare the copy number of the target gene in different hosts. CmR and mCherry were used as target genes, and gyrA was used as the internal reference gene.

[0103] The results showed that the EcoTnpB system could generate colonies with all five sites edited in the BL21(DE3)ΔrecA strain ( Figure 7 ). The colony with the expression cassette inserted into all five sites was called S-5-sites-mCherry, and the copy number was evolved using the CIChE system. The present invention screened colonies resistant to up to 640µg / ml chloramphenicol, with a copy number of ~627 for mCherry and ~693 for CmR. The control strain (S-plasmid-mCherry) using a plasmid with the pMB1 replication origin for expression contained only about 23 copies of mCherry. The results show that EcoTnpB combined with the CIChE system can effectively construct high-copy number integrated expression strains.

[0104] (2) Integration and expression of nitrilase from Alcaligenes faecalis ZJUTB10 (nit). The IS4 site was selected for integration and expression. PBAD_IS4-sacB_donor (chIB_PT7_nit_pCat_CmR_chIB) was constructed. Acidovorax facilisZJB09122 nitrilase (nit) replaced the mCherry gene fragment and constructed PBAD_IS4_donor(chIB_PT7_nit_pCat_CmR_chIB)-sacB.

[0105] The specific method is as follows: Step 1: The integration expression method is specifically as shown in steps 1-4 of Example 8; Step 2: Take 10 μL of the constructed strain in step 1 and add it to 10 mL LB liquid culture medium and culture it at 37°C, 180 rpm for 12 h. Then inoculate it into 100 mL LB liquid culture medium at a ratio of 1% and culture it at 37°C, 180 rpm for 2 h. Add IPTG (final concentration 0.1 μM), culture it at 28°C, 180 rpm for 12 h, and collect the bacteria by centrifugation at 8000 rpm, 4°C for 10 min.

[0106] Step 3: Using the bacteria obtained in step 2 as a catalyst and 1-cyanocyclohexylacetonitrile as a substrate, the reaction system is as follows: 50 mL of phosphate buffer (200 mmol / L, pH 7.0) was added with wet nitrilase bacteria (final concentration 5 g / L) and 600 mM 1-cyanocyclohexylacetonitrile, 35° C., 200 rpm, and the reaction was centrifuged to remove the bacteria for 12 h. The reaction yield of the product 1-cyanocyclohexylacetic acid was detected by HPLC.

[0107] Liquid phase detection conditions: 1-Cyanocyclohexylacetic acid (1-CA) was analyzed by high performance liquid chromatography. The column type was J&K Scientific C18-H column (4.6×250mm, 5μm, 120Å); the mobile phase was acetonitrile = 76:24 (v:v). The aqueous phase in the mobile phase was phosphate buffer: 0.58g / L (5mmol / L) diammonium hydrogen phosphate, 1.8375g / L (13mmol / L) sodium perchlorate, perchloric acid was used to adjust the pH to 1.8, and the solvent was ultrapure water; the organic phase of the mobile phase was chromatographic grade acetonitrile. The flow rate was 1mL / min, the injection volume was 10μL, the UV detection wavelength was 215nm, and the column temperature was 40℃. The analysis time was 20min.

[0108] Step 4: Take 10 μL of the strain evolved in step 2 and inoculate it into 10 mL of LB medium. Incubate it at 37°C for 10 h. Transfer 1 mL of the bacterial solution into 100 mL of LB liquid medium without antibiotics. Then incubate it at 37°C, 180 rpm. When the OD 600When the p-value reaches 0.6, IPTG (final concentration 0.1 mM) is added to induce expression. The culture is then cultured at 28°C for 10 h. The cells are collected by centrifugation at 12000 rpm for 1 min and resuspended in phosphate buffer (pH 7.5). The proteins in the cells are extracted and analyzed by SDS-PAGE. The copy number detection of the integrated expression strain is the same as in Example 8 (1).

[0109] The results showed that the number of nit copies in the S-5-sites-nit-192 strain reached ~165, while the control strain expressed by the PET-28 plasmid (S-plasmid-nit) had only ~32 copies. SDS-PAGE analysis showed that the expression level of nit in S-5-sites-nit-192 was significantly higher than that in S-plasmid-nit ( Figure 9 g in the figure). S-plasmid-nit can convert up to about 1.6 M of substrate, and S-5-sites-nit-192 can convert 3.0 M of substrate within 8 hours ( Figure 9 These results indicate that the EcoTnpB system proposed in the present invention combined with the CIChE system has great potential in constructing hosts for efficient integration and expression of industrial enzymes.

[0110] Example 9: EcoTnpB system to construct a coenzyme self-sufficient glufosinate high-yield strain L-phosphinothricin (L-PPT) is a broad-spectrum and highly effective chiral herbicide. It is a green method to use NADPH-dependent phosphinothricin dehydrogenase (GluDH) to perform reductive amination of PPO to generate L-PPT. In the present invention, the asymmetric reduction of PPO to chiral L-PPT is used as a model reaction. First, this embodiment provides a classic metabolic regulation strategy to enhance intracellular NADP(H) by knocking out key genes in the NAD(H) degradation pathway and integrating and expressing essential genes in the NADP(H) biosynthesis pathway. In addition, an artificial multi-enzyme cascade biocatalytic system was constructed based on the Escherichia coli chassis.

[0111] (1) Knock out mazG, a key gene in the NAD(H) degradation pathway. Construct PBAD_ωRNA-mazG+500-bpdeletion template-sacB. Use primers 1 and 2 in Table 14 to amplify the linearized vector by PCR with PBAD_ωRNA as a template, then use primers 3-6 to amplify the upstream and downstream homology arms by PCR with BL21(DE3)mazG as a template, and use a one-step cloning method to connect the two fragments to the linearized pET28a vector to obtain the plasmid PBAD_ωRNA+500-bpdeletion template-sacB. Use primers 7 and 8 to design mutation primers 9-10 based on the 20nt after 5'-TTTAT at the IS4 site of the Escherichia coli BL21(DE3) genome, and use PBAD_ωRNA-sacB+500-bp deletion template as a template to obtain the mutant PBAD_ωRNA-mazG+500-bpdeletion template-sacB by PCR.

[0112] Table 14 Primer sequence Sequence (5'-3') 1 TAGATCTATTACCCTTATTTACGCTTGCTGAACTG 2 CTCTTCGTAGACTTTATGAATTGTCCTGAAAATTG 3 AGGACAATTCATAAAGTCTACGAAGAGATCGACGAGGT 4 ACTCGAGTAGGGATAACGTTGAAAAGACGATGGAATAAC 5 GTTATCCCTACTCGAGTTCATGTGCAGCTCCATAAGCAAAA 6 AGGGTAATAGATCTAAGCTTCTGCAGTCTAGAGAATTCAAA 7 CGCTAATAGCAGCGCAAATATTTTTTTGAATTCTCTAGA 8 TATTTGCGCTGCTATTAGCGTTGACATCCTCCACGCCCT The EcoTnpB system mediates the knockout of the mazG site in the E. coli BL21 (DE3) genome. The specific steps are as follows: Step 1: The integration expression method is specifically as shown in steps 1-4 of Example 8; Step 2: Find the corresponding single colony on the plate without any resistance, take the single colony into 10mL of LB liquid culture medium containing 50μg / mL of no resistance and culture it at 37℃, 180rpm for 12h, add it to the bacterial preservation tube with 30% glycerol solution at a volume ratio of 1:1, write the corresponding editing site marker (BL21ΔmazG) and time, and store it at -80℃ for later use; Step 3: Take 10 μL of the strain obtained in step 2 and inoculate it into 10 mL of LB medium. Incubate it at 37°C for 10 h. Transfer 1 mL of the bacterial solution into 100 mL of LB liquid medium without antibiotics. Then incubate it at 37°C, 180 rpm. When the OD 600When the pH reaches 0.6, take 1 ml of bacterial culture solution, then centrifuge at 12,000 rpm for 1 minute at 4°C. Pour off the supernatant and use the cell pellet as a sample to detect the NAD(P)(H) concentration. Sample preparation for detecting the NAD(P)(H) concentration (µmol / L) during the PPO catalytic reaction: ultrasonically disrupt the intracellular NAD(P)(H) in an ice bath for 10 minutes, then centrifuge at 12,000 rpm for 1 minute at 4°C. The supernatant was used as a sample to detect the NAD(P)(H) concentration using the enzymatic™ NAD(H) / NADH Assay Kit and enzymatic™ NADP+ / NADPH Assay Kit (BioAssaySystems, Hayward, CA).

[0113] The results are as follows Figure 10 Figure a shows that the loss of mazG resulted in an intracellular NAD(H) concentration of 18.11µmol / gDCW, which was 46% higher than that of the starting strain. At the same time, the NADP+ concentration of the strain increased by 13.2% to 6.12µmol / gDCW. The results showed that inhibiting the NAD(H) degradation pathway by single gene knockout could improve the intracellular NAD(H) concentration and slightly increase the NADP+ concentration.

[0114] (2) Integrated expression of nadK and nicotinic acid phosphoribosyltransferase pncB. In order to further increase the intracellular NAD(H) level, the present invention attempts to integrate the expression of the key gene pncB (GenBank: AM946981.2) in the press-handler pathway and the PRPP synthesis module of BL21 (DE3).

[0115] In this study, mazG site was selected for integration expression. PBAD_mazG_donor(chIB_PT7_nadK_pncB_pCat_CmR_chIB)-sacB was constructed. Primers 1 and 2 in Table 15 were used to amplify the nadK fragment by PCR using the genome of Corynebacterium glutamicum as a template, and then primers 3 and 4 were used to amplify the pncB fragment by PCR using Escherichia coli BL21 as a template, and then primers 5 and 6 were used to amplify the pACYCDuet linearized vector using pACYCDuet as a template, and the two fragments were connected to the linearized vector by one-step cloning using ClonExpressUltra One Step Cloning Kit V2 to obtain the plasmid pACYCDuet-PT7-nadK-pnCB. Primers 7 and 8 were used to amplify the PT7-nadK-pnCB fragment using pET28a-PT7-nadK-pnCB as a template, and then primers 9 and 10 were used to amplify the PBAD_ωRNA-mazG+500-bp deletion template-sacB linearized vector by PCR using plasmid PPBAD_ωRNA-mazG+500-bp deletion template-sacB as a template. The ClonExpress Ultra One Step Cloning Kit V2 was used to connect the continuous induced chromosome evolution (CIChE) DNA box CHIB gene fragment and the PT7-nadK-pnCB fragment in Example 8 with the PBAD_ωRNA-mazG+500-bpdeletion template-sacB linearized vector by one-step cloning to obtain the plasmid PBAD_mazG_donor(chIB_PT7_nadK-pnCB)-sacB. The PBAD_mazG-sacB+_donor(chIB_PT7_nadK-pnCB) linearized vector was amplified by PCR using primers 11 and 12 with plasmid PBAD_mazG-sacB+_donor(chIB_PT7_nadK-pnCB) as a template. The continuous induced chromosomal evolution (CIChE) DNA cassette CHIB gene fragment, CmR and the PBAD_mazG_donor(chIB_PT7_nadK-pnCB)-sacB linearized vector were connected by one-step cloning using ClonExpress Ultra One Step Cloning Kit V2 to obtain plasmid PBAD_mazG_donor(chIB_PT7_mCherry_pCat_CmR_chIB)-sacB.

[0116] Table 15 Primer sequence Sequence (5'-3') 1 TTAAGAAGGAGATATACCGAGGACGATGGAGGCGCGCAG 2 TCTCCTTCTTAAAGTTAAACAAATTATATAGTAAGCAATAA 3 TTTAACTTTAAGAAGGAGAATGACACAATTCGC 4 CCGGATCTCACTCGAGTTAACTGGCTTTTTTAATATGCGGAA 5 CTCGAGTGAGATCCGGCTGCTAACAAAGCCCGAA 6 TATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGG 7 AAAAATATAGGTTTTAATAGATCTCGATCCCGCG 8 GCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAG 9 CTTGAGGGGTTTTTTGCTAAAGTCTACGAAGAGATCGACG 10 AATTGCTTTCTTGGGGCTGAATTGTCCTGAAAATTG 11 AAATATAGGTTTTAATTAAAGTCTACGAAGAGATCGACGAG 12 TCTTACGTGCCGATCACGCACAAAGATATAGTTCCTCCTTTCAGC The EcoTnpB system mediates the integration and expression of nadK and nicotinic acid phosphoribosyltransferase pncB at the mazG site of the E. coli BL21 (DE3) genome. The specific steps are as follows: Step 1: Transfer the constructed recombinant plasmid into E. coli BL21ΔmazG competent cells, and culture the clones at 37°C for 12 hours. Then pick out the clones and transfer them to 10mL LB liquid medium containing 50μg / mL spectinomycin, and culture them at 37°C and 180rpm for 10 hours, sequence and identify, and extract the plasmid; Step 2: Transfer the clone successfully edited in step 1 into 10 mL of LB liquid medium containing 50 μg / mL spectinomycin and culture at 37°C, 180 rpm for 12 h to extract the plasmid; Step 3: The plasmid obtained in step 2 was transferred into BL21ΔmazG competent cells and spread on a plate containing 50 μg / mL spectinomycin, cultured at 37°C for 12 h, and the editing site colony PCR was used to verify whether the genome was successfully edited.

[0117] Step 4: Transfer the clones obtained in step 3 into 10 mL of LB liquid medium containing 10 g / L sucrose and culture at 37°C and 180 rpm for 12 h; Step 5: Take 10 μL of the bacterial solution from step 4 into a sterilized and dried EP tube, then add 990 μL of sterile water to dilute, repeat the dilution for a total of 10,000 times, take 30 μL of the diluted bacterial solution and spread it on a plate, and culture it at 37°C for 12 h; Step 6: Use a sterilized and dried toothpick to take a single colony from the plate cultured for 12 hours in step 6, and use the copy printing method to copy it on a plate containing 50 μg / mL spectinomycin and a plate without any resistance. After copying, culture at 37°C for 12 hours. If there is no growth on the plate containing spectinomycin, the plasmid is successfully eliminated.

[0118] Step 7: Find the corresponding single colony on the plate without any resistance, take the single colony into 10mL LB liquid culture medium containing 50μg / mL without resistance and culture it at 37℃, 180rpm for 12h, add it to the bacterial preservation tube with 30% glycerol solution at a volume ratio of 1:1, write the corresponding editing site marker (S-mazG-sites-nadK-pncB) and time, and store it at -80℃ for later use; Step 8: Take S-mazG-sites-nadK-pncB from step 7, and continuously induce chromosome evolution by adding 1μg / mL chloramphenicol to 10mL LB medium. After growing to the stable phase, mix it with 30% glycerol in a 1:1 ratio, write the corresponding mark and time, and store it at -80℃ for later use. At the same time, transfer 100μL of the medium to a new culture tube. In the new test tube, double the concentration of the antibiotic and let it grow to the stable phase. Repeat this step until the antibiotic concentration reaches 320μg / mL.

[0119] The copy number detection of the integrated expression strain is the same as that of Example 8 (1). Step 9: Prepare the edited Escherichia coli BL21 (S-mazG-sites-nadK-pncB-320) competent cells. The specific method is as follows: take 10 μL from the edited bacterial preservation tube and streak it on the antibiotic-free plate, and culture it at 37°C for 12 hours; take a single colony on the plate and transfer it to 10mL LB liquid culture medium and culture it at 37°C and 180rpm for 10 hours; take the above seed liquid and inoculate it into a 100mL LB liquid culture medium conical flask at a 1% inoculation rate, and culture it at 37°C and 180rpm for 2 hours; take out the conical flask and put it into a pre-prepared ice box and ice bath for 15 minutes; take out the conical flask and divide the cooled bacterial liquid into 50mL EP tubes that have been sterilized and dried in advance on the clean bench, and ice bath for 15 minutes. After the EP tube is balanced on the balance, it is placed in a low-temperature centrifuge and centrifuged for 10 minutes at a temperature of 4°C and a speed of 5000rpm; after the centrifugation, the 50mL EP tube is taken out from the low-temperature centrifuge, placed in an ice box, taken out from the clean bench, the residual culture medium in the supernatant is discarded, 10mL of pre-sterilized 0.1M CaCl2 solution is added, and the ice bath is resuspended for 30min; it is placed in a low-temperature centrifuge and centrifuged for 10min at a temperature of 4°C and a speed of 4000rpm; after the centrifugation, the 50mL EP tube is taken out from the low-temperature centrifuge, placed in an ice box, taken out from the clean bench, the supernatant is discarded, 2mL of pre-sterilized 0.1M CaCl2+15% glycerol solution is added, and after complete resuspending, 100μL of liquid per tube is dispensed into pre-sterilized and dried 1.5mL EP tubes, and the corresponding competent state mark and the time of making the competent state are written, and then stored at a temperature of -80°C for standby use; Step 10: Transform the laboratory to construct the glufosinate-ammonium related plasmids: pETDute-GluDH and GDH, pACYCDute-NAD into the BL21 (S-mazG-sites-nadK-pncB-320) competent medium, spread on the plate containing 50 μg / ml ampicillin and 50 μg / ml chloramphenicol, culture at 37°C for 12 hours, and grow a single colony; Step 11: Inoculate the single clone from step 10 into 10 mL LB medium, culture at 37°C for 10 h, transfer 1 mL of the bacterial solution into 100 mL LB liquid medium containing 50 μg / ml ampicillin and 50 μg / ml chloramphenicol, and then culture at 37°C, 180 rpm. When the OD 600 When the p-value reached 0.6, IPTG (final concentration 0.1 mM) was added to induce expression. The culture was then incubated at 28°C for 10 h. The cells were collected by centrifugation at 12,000 rpm for 10 min.

[0120] Step 12: The bacteria collected in step 11 were used as whole-cell catalysts. After freezing at −20°C for 24 h, the freeze-dried whole-cell biocatalyst was used to asymmetric amination of PPO to obtain L-PPT. The reaction system contained 20 g / L whole-cell biocatalyst, 300 mM PPO, 360 mM glucose, and 450 mM (NH4)2SO4 (K2HPO4-KH2PO4, 0.1 M, pH 7.5). 12.0 M ammonium hydroxide was added at 35°C and a constant pH of 7.5.

[0121] The concentration of PPO was determined by HPLC using a C18 column (Unitary C18, 5µm, 100a, 4.6mm×250mm) at a flow rate of 1.0mL / min and a wavelength of 232nm. Each sample (10µL) was eluted with 50mM ammonium dihydrogen phosphate (pH3.8) buffer containing 0.1% tetrabutylammonium bromide and 12% acetonitrile as the mobile phase. The column temperature was maintained at 40°C. The retention time of PPO was 9.4min. The product containing L-PPT was determined at the fluorescence wavelength of λex=340nm and λem=450nm after derivatization with o-phthalaldehyde (OPA) and n-acetyl-l-cysteine ​​(NAC) at 30°C for 5min on the same HPLC instrument and column. The mobile phase was 50mM ammonium acetate (pH5.7) and methanol (9:1v / v). The column temperature was maintained at 35 °C and the flow rate was 1.0 mL / min.

[0122] The results show that: Figure 10 As shown in b and c, the nadK copy number of the S-mazG-sites-nadK-pncB-320 strain reached ~62, and the PPO conversion rate (%) increased from 36% of BL21 (DE3) to 99.9%. The cofactor-self-sufficient whole-cell biocatalyst system was successfully applied to the asymmetric synthesis of L-glufosinate. This engineering strategy may be helpful in constructing cofactor-self-sufficient systems for other oxidoreductases.

[0123] The above-mentioned embodiments are preferred examples of the present invention and are not intended to limit the protection scope of the present invention.

Claims

1. A gene editing system based on the endogenous EcoTnpB protein of Escherichia coli, characterized in that: include: a) EcoTnpB protein endogenously expressed by Escherichia coli or a nucleotide sequence encoding the EcoTnpB protein; b) an ωRNA molecule or a nucleotide sequence encoding the ωRNA molecule, wherein the sequence of the ωRNA molecule comprises an RNA scaffold sequence and a guide sequence complementary to a target sequence, and the ωRNA molecule can form a complex with the EcoTnpB protein and guide the EcoTnpB protein to recognize the target sequence; Wherein, the nucleotide sequence of the EcoTnpB protein is shown in SEQ ID NO.1; The RNA scaffold sequence includes a sequence extending from the first base of the sequence shown in SEQ ID NO.2 to the 3' end for at least 160 bases, and the guide sequence includes a sequence extending from the first base of the sequence shown in SEQ ID NO.2 to the 3' end for at least 14 bases.

2. The gene editing system according to claim 1, characterized in that: The RNA scaffold sequence includes any of the following: 1) The sequence shown in bases 1 to 300 of SEQ ID NO.2; 2) the sequence shown in bases 1 to 260 of SEQ ID NO.2; 3) the sequence shown in bases 1 to 220 of SEQ ID NO.2; 4) the sequence shown in bases 1 to 200 of SEQ ID NO.2; 5) the sequence shown in bases 1 to 180 of SEQ ID NO.2; 6) The sequence shown as bases 1 to 160 of SEQ ID NO.

2.

3. The gene editing system according to claim 2, characterized in that: The TAM sequence at the 5' end of the target sequence is one of TTTAT, ATTAT, GTTAT, CTTAT, GTTAC or CTTAC.

4. The gene editing system according to claim 3, characterized in that The length of the RNA scaffold sequence is 200-300 nt, and the length of the guide sequence is 14-20 nt.

5. The gene editing system according to claim 4, characterized in that: The ω RNA molecule is driven by an inducible promoter P BAD Regulation.

6. A vector system containing the gene editing system according to any one of claims 1 to 5.

7. An engineered host cell containing the gene editing system according to any one of claims 1 to 5, characterized in that: The engineered host cell is Escherichia coli.

8. An application of the gene editing system according to any one of claims 1 to 5, the vector system according to claim 6 or the engineered host cell according to claim 7 in the field of nucleic acid recognition or gene editing, wherein the application includes gene knockout, gene integration, multi-site continuous editing, multi-site simultaneous editing or multi-copy integrated expression.

9. A method for nucleic acid recognition or gene editing, characterized in that: The target nucleic acid molecule and the gene editing system according to any one of claims 1 to 5 are subjected to nucleic acid recognition or gene editing in a reaction system at 24 to 48°C.

10. An application of the gene editing system according to any one of claims 1 to 5 in constructing a high-yield L-phosphinothricin ammonium strain, characterized in that: by E. coli BL21(DE3) is the base strain, and the pyrophosphohydrolase gene is knocked out using the gene editing system gG , and the nicotinamide adenine dinucleotide kinase gene was integrated into nad nicotinic acid phosphoribosyltransferase gene pncB , thereby constructing a high-yield L-phosphinothricin strain.

Images