A heat-resistant, salt-alkali-resistant and ionic liquid-tolerant cellulase and its application

By isolating the cellulase gene c5-cel4 from the bottom mud of Aibi Salt Lake in Xinjiang and expressing the cellulase gene c5-cel4 in Escherichia coli, the heat-resistant, alkali-resistant and salt-resistant cellulase C5-CEL4 was obtained, which solved the problem of cellulase in high temperature and high saline-alkali environment, and achieved efficient application in industry.

CN119842671BActive Publication Date: 2025-07-11DALI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510049182.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-13
Publication Date
2025-07-11
Estimated Expiration
2045-01-13

AI Technical Summary

Technical Problem

Existing cellulases are prone to inactivation under high temperature and high saline and alkali environments, making it difficult to effectively catalyze the conversion reaction in industry, and lacks saline and alkali-resistant cellulases.

Method used

The cellulase gene c5-cel4 was isolated from the bottom mud metagenome of Aibi Salt Lake in Xinjiang, and the recombinant vector was constructed to express it in E. coli, and heat-resistant, alkali-resistant and salt-resistant cellulase C5-CEL4 was obtained. Recombinant cellulase with high activity was obtained through heterologous expression and purification.

Benefits of technology

C5-CEL4在高温、高盐碱环境下保持高活性,适用于造纸、纺织、食品和生物燃料等领域,提供了高效的酶源储备。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119842671B_ABST
    Figure CN119842671B_ABST
Patent Text Reader

Abstract

The present invention discloses a cellulase that is heat-resistant, alkali-resistant, salt-resistant, and resistant to ionic liquids and its application. It belongs to the technical field of cellulases. A novel cellulase gene c5-cel4 was obtained from the metagenome of the sediment at the bottom of Lake Aibi in Xinjiang, cloned, and heterologously expressed in Escherichia coli. C5-CEL4 has the characteristics of heat resistance, alkali resistance, salt resistance, and high tolerance to ionic liquids. In addition, this enzyme can be secreted and expressed in Escherichia coli, and the C-terminus of the protein is excised from amino acid residues 315 to 448. The secretion of this enzyme is related to the sequence of amino acid residues 315 to 448 at the C-terminus of the protein, and it can also tolerate most metal ions, inhibitors, and alcohols. This indicates that C5-CEL4 is an ideal candidate enzyme for biomass conversion, washing, and textile industrial production, and has great potential application prospects in feed, food, and bioenergy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of cellulase, and more specifically, to a heat-resistant, salt-alkali-resistant, and ionic liquid-tolerant cellulase and its application. Background Art

[0002] Cellulose is a renewable organic macromolecular polysaccharide and is the most abundant in renewable plant biomass. The effective degradation of cellulose by cellulase is a key step in the conversion of lignocellulose. The complete hydrolysis of cellulose into glucose requires the combined action of endo-1,4-D-glucanase (EC3.2.1.4), exo-1,4-D-glucanase (EC3.2.1.91), and β-glucosidase (1,4-D-glucosidase, EC3.2.1.21). Among them, endo-1,4-D-glucanase acts on the amorphous region inside the cellulose molecule, randomly launches attacks, making the polymer more easily hydrolyzed by other cellulolytic enzymes, and is the main enzyme group for internal bond hydrolysis.

[0003] At present, cellulase is widely used in various industries and products such as pulp and paper, biofuels, food, brewing, textiles, animal feed, bio-nanomaterials, phenolic aldehyde, etc. However, in high-temperature and high-salt-alkali industrial environments, the enzyme is extremely easy to inactivate. Therefore, the thermal stability and salt-alkali tolerance of cellulase are particularly important.

[0004] Although many heat-resistant cellulases have salt tolerance and polyphilicity, very few can effectively catalyze and convert reactions in high-salt environments. Therefore, screening salt-alkali-tolerant cellulases is beneficial to reducing costs and improving industrial efficiency.

[0005] In summary, how to provide a salt-alkali-tolerant cellulase is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides a heat-resistant, salt-alkali-resistant, and ionic liquid-tolerant cellulase and its application.

[0007] In order to achieve the above object, the present invention adopts the following technical scheme:

[0008] A heat-resistant, salt-alkali-resistant, and ionic liquid-tolerant cellulase, characterized in that its amino acid sequence is as shown in SEQ ID NO.6.

[0009] The coding gene of the above-mentioned cellulase.

[0010] Furthermore, its nucleotide is as shown in SEQ ID NO.5.

[0011] A recombinant vector containing the above-mentioned coding gene.

[0012] A recombinant bacterium comprising the above-mentioned recombinant vector.

[0013] Application of the above-mentioned cellulase in degrading CMC-Na, sugarcane bagasse xylan, beechwood xylan, and corncob xylan.

[0014] Application of the above-mentioned cellulase in food, feed, textile, and industrial production.

[0015] It can be seen from the above technical solutions that, compared with the prior art, the beneficial effects achieved by the present invention are as follows:

[0016] In the present invention, a new cellulase gene named c5-cel4 was isolated from the metagenomic data of the bottom mud of Aibi Salt Lake in Xinjiang. The gene sequence was cloned, a recombinant vector was constructed, and it was introduced into Escherichia coli. The activity of the recombinant cellulase was determined through heterologous expression and protein purification. The results showed that this enzyme is a heat-resistant, alkali-resistant, halophilic ionic liquid-tolerant cellulase and can be secreted extracellularly by Escherichia coli, which indicates that this enzyme can provide an enzyme source reserve for the utilization of cellulase in the fields of papermaking, textile, food, feed, and biofuels. Brief Description of the Drawings

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.

[0018] Figure 1 For the extracellular fermentation broth and activity monitoring of the recombinant cellulase C5-CEL4 in Example 1 of the present invention, where A represents the extracellular fermentation situation; B represents the activity result;

[0019] Figure 2 For the SDS-PAGE gel diagram of the recombinant cellulase C5-CEL4 in Example 1 of the present invention, where A represents the gel diagram of the extracellular purified enzyme; B represents the gel diagram of the intracellular purified enzyme; Lane 1 represents the protein molecular weight marker; Lane 2 represents the cells of Escherichia coli DH5α / pSHY211-c5-cel4; Lane 3 represents the purified enzyme C5-CEL4; Lane 4 represents the zymogram analysis of the purified enzyme;

[0020] Figure 3 For the C-terminal sequencing analysis of the protein of the recombinant cellulase C5-CEL4 based on LC-MS / MS in Example 1 of the present invention, where A represents the total ion current chromatogram, Chymotrypsin TIC diagram; B represents the total ion current chromatogram, Pepsin-TIC diagram; C represents the C-terminal secondary mass spectrum diagram;

[0021] Figure 4 This is the phylogenetic tree diagram obtained from the maximum likelihood analysis based on the amino acid sequence in Example 1 of the present invention, showing the phylogenetic positions of C5-CEL4 and related cellulases, and the bootstrap values (expressed as percentages of 1000 replicates) are given at the nodes;

[0022] Figure 5 This is the multiple sequence alignment diagram of the amino acid sequence of C5-CEL4 in Example 1 of the present invention. 8BQA, 8BQC, 8C10, 4MIR, and 1EGZ are the PBD IDS of the amino acid sequences. Residues with a homology level of 100% are highlighted in red. Among them, 8BQA and 8BQC are from Cellvibrio japonicus, 8C10 is from Teredinibacter waterburyi, 4MIR is from the soil metagenome, and 1EGZ is from Dickeya chrysanthemi;

[0023] Figure 6 This is the protein structure analysis of C5-CEL4 in Example 1 of the present invention. Among them, A is the domain prediction of the protein sequence of C5-CEL4 using InterPro, and this structure describes a cellulase catalytic domain (CD); B is the cellulase C5-CEL4 of the GH5 family, and homologous modeling is performed using the GH5 family endoglucanase from Microbulbifer rhizosphaerae as a template on the SWISS-MODEL server (UniProt accession number: A0A7W4WCK3);

[0024] Figure 7 This is the effect of temperature and pH on the activity and stability of the recombinant cellulase C5-CEL4 in Example 1 of the present invention. Among them, A represents the effect of temperature on the activity of C5-CEL4; B represents the effect of pH on the activity of C5-CEL4; C represents the effect of temperature on the stability of the intracellular enzyme C5-CEL4; D represents the effect of pH on the stability of the intracellular enzyme C5-CEL4; the initial activity is 100%, and each value in the figure represents the mean ± SEM (n = 3). For the extracellular enzyme, 100% = 24.36 + 0.63 U / mg, and for the intracellular enzyme, 100% = 19.6 ± 3.47 U / mg;

[0025] Figure 8Effects of NaCl and ionic liquid on intracellular enzyme C5-CEL4 in Example 1 of the present invention. Among them, A represents the effect of NaCl on the activity of C5-CEL4; B represents the effect of NaCl concentration on the stability of C5-CEL4 after incubation for 9 months; C represents the effect of ionic liquid on the activity of intracellular enzyme C5-CEL4; D represents the effect of ionic liquid on the stability of intracellular enzyme C5-CEL4 after incubation at 4°C for 24 h; the initial activity is 100%, and each value in the figure represents mean ± SEM, 100% = 19.6 ± 3.47 U / mg;

[0026] Figure 9 Predicted surface electrostatic potential of C5-CEL4 in Example 1 of the present invention. Among them, A represents the surface electrostatic potential of C5-CEL4; B represents the surface electrostatic potential obtained by flipping A in Pymol 2.6 by 180°; negative and positive electrostatic potentials are represented by red and blue respectively;

[0027] Figure 10 Thin layer chromatography analysis of C5-CEL4 hydrolyzing CMC-Na in Example 1 of the present invention. Among them, lane 1, standards: glucose (G1), cellobiose (G2), cellotriose (G3), cellotetraose (G4); lane 2, CMC-Na without enzyme solution; lane 3, C5-CEL4 purified by hydrolyzing CMC-Na. Detailed implementation manners

[0028] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0029] The medicaments required for the present invention are conventional experimental medicaments, purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods, which will not be elaborated one by one here.

[0030] Example 1

[0031] 1 Materials and methods

[0032] 1.1 Sample collection and metagenomic sequencing

[0033] The sampling point is located in Ebinur Lake, Xinjiang (45°09′35″N, 83°53′21″E). The surface temperature of Ebinur Lake is about 7.8 °C, and the pH value is 8.49. The sediment samples were quickly frozen on dry ice for DNA isolation and metagenomic sequencing. DNA isolation was performed using the powersoil Kit (MOBIO dnasy PowerSoil Kit, USA). Metagenomic sequencing was carried out by GENWIZ in Suzhou using the HiSeq 2500 instrument, and sequence analysis was performed using the IMG server (https: / / img.jgi.doe.gov / cgi-bin / mer / main.cgi).

[0034] 1.2 Prediction and sequence analysis of cellulase sequences

[0035] Based on functional prediction, a cellulase gene sequence was predicted from the metagenomic database and named c5-cel4. The translation of the amino acid sequence was performed using the Expasy-Translate tool. The protein sequence of c5-cel4 was aligned using the BLASTp program (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Multiple sequence alignment and homology modeling of amino acids were performed using RCSB PDB, SWISS-MODEL, AlphaFold Protein Structure Database (ebi.ac.uk), MEGA 7, and ESPript3.0. SignalP (http: / / www.cbs.dtu.dk / services / SignalP / ) was used to predict signal peptides, and Search-InterPro (ebi.ac.uk) was used to predict protein domains. Phylogenetic analysis was performed using MEGA 7, and a phylogenetic tree was constructed using the maximum likelihood method and the Poisson correction model.

[0036] 1.3 Cloning, expression, purification, and identification of C5-CEL4

[0037] Degenerate primers were designed using Primer 5.0: c5-cel4-F( CATCATCATCATCATCATGAA ATGATATTCGGCGCAGGTGCCCAG, SEQ ID NO.1) and c5-cel4-R( GTGCTCGAGTGCGGCCGCAAGThe full-length c5-cel4 gene was amplified using TCAGTTGGCGCTGCATTCCGGC, SEQ ID NO.2). The underlined sequence represents the homologous recombination fragment of the pSHY211 vector (Characterization of a GH10 extremely thermophilic xylanase from the metagenome of hot spring for prebiotic production.) after digestion with BamH I and Hind III enzymes. PCR was performed using TransStar FastPfu Fly DNA polymerase (TransGen Biotech, China). The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min, 98°C for 20 s, 55°C for 30 s, 72°C for 2 min, for 29 cycles, and final extension at 72°C for 10 min. The PCR product was inserted into the pSHY211 vector using the pEASY-Uni seamless cloning and assembly kit (TransGen Biotech, China) to obtain the expression plasmid pSHY211-c5-cel4. Escherichia coli DH5α was used for the cloning of the c5-cel4 gene. Escherichia coli was grown on LB medium containing 100 μg / mL kanamycin, and the DNA isolation and purification kit was purchased from Sangon (China).

[0038] Express and purify recombinant Escherichia coli DH5α with pSHY211-c5-cel4. In 15 mL of LB liquid medium containing 100 μg / mL kanamycin, culture overnight at 37 °C and 180 r / min as the seed solution. Inoculate the seed solution into a mixed liquid medium containing 200 mL of basal salts and 100 mL of LB at an inoculation amount of 5%, where the mixed liquid medium contains 100 μg / mL kanamycin. Incubate with shaking at 37 °C and 180 r / min for 36 h. Then centrifuge at 4000 r / min for 30 min and collect the supernatant as the crude extracellular enzyme solution. Collect the Escherichia coli biomass, resuspend the Escherichia coli biomass in 25 - 30 mL of PBS buffer (pH 7.6) containing 10 mM imidazole, place it in an ice-water bath for ultrasonic disruption, centrifuge the lysate at 4 °C and 12,000 r / min for 20 min, and take the supernatant as the crude intracellular enzyme solution. Add the filtered crude intracellular and extracellular enzyme solutions to the equilibrated Ni-NTA nickel column (Histrap, TransGen Biotech, China) respectively, resuspend the nickel column packing, place it in a 500 mL conical flask, and shake at ≤15 °C and 150 r / min for 1.5 h for binding to increase the amount of bound protein. Purify the intracellular and extracellular proteins according to the method previously reported by Yin et al. (2017) (The Hybrid Strategy of Thermoactinospora rubra YIM 77501T for Utilizing Cellulose as a Carbon Source at Different Temperatures) for the characterization of recombinant cellulase. Measure the protein concentration using a Bradford protein assay kit (Order NO.C5-CEL403031, Sangon Biotech, China) with bovine serum albumin as the standard. Electrophorese the purified C5-CEL4 enzyme using 12% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis), and stain the protein bands with Coomassie Brilliant Blue R-250. Evaluate the cellulase activity in the gel using zymography. Briefly, the samples are dissolved in a 12% SDS-acrylamide gel containing 0.5% (w / v) CMC-Na. After electrophoresis, wash with 2.5% (v / v) Triton X-100 (pH 7.0) for 30 min, soak in 200 mM phosphate buffer for 15 min, and incubate at 45 °C in phosphate buffer (pH 7.0) for 1 h. Finally, stain the gel with 0.2% (w / v) Congo red at 25 °C for 10 min, and remove Congo red with 1 mol / L sodium chloride until a clear activity band is visible against the background of the gel.

[0039] Cut the target protein band into 1 mm 3The colloidal particles are loaded into a 1.5 mL EP tube. Decolorize with a 50% ACN (acetonitrile)-50% 50 mM NH4HCO3 (ammonium bicarbonate) solution, place for 10 - 30 min, aspirate and discard. Repeat this operation until the colloidal particles are colorless. Add 1000 μL of 100% ACN, place for 30 min. Wait until the colloidal particles turn white and shrink into a mass, then discard the ACN and leave to dry at room temperature. Reduction alkylation: Add 100 μL of 10 mM DTT (dithiothreitol) solution to the sample, reduce in a water bath at 56 °C for 1 h, aspirate and discard the supernatant; Add 100 μL of 20 mM IAM (iodoacetamide) solution to the sample, react at room temperature in the dark for 1 h, aspirate and discard the supernatant. Add 500 μL of decolorizing solution to the sample, vortex and then aspirate and discard; Add 1000 μL of 100% ACN to the sample. Wait until the colloidal particles turn white and shrink into a mass, then discard the ACN and leave to dry at room temperature. Add 50 μL of trypsin with a concentration of 25 ng / μL (diluted with 50 mM NH4HCO3), seal and place in a water bath at 37 °C for enzymatic digestion for 16 h. Peptide extraction: Add 100 μL / tube of extraction solution (5% trifluoroacetic acid TFA - 50% ACN - 45% water), place in a water bath at 37 °C for 1 h, then sonicate for 5 min and centrifuge for 5 min. Transfer the extraction solution to another new EP tube, repeat the extraction once, combine the extraction solutions, and dry by vacuum centrifugation. The peptides after enzymatic digestion are desalted using a desalting column and the solvent is evaporated dry in a vacuum centrifugal concentrator at 45 °C.

[0040] Use Easy-nLC 1200 / Q Exactive TM Hybrid Quadrupole-Orbitrap TMData acquisition was performed using a Mass Spectrometer high-resolution liquid chromatography-mass spectrometry system. Chromatographic separation: Mobile phase A was an aqueous solution containing 0.1% formic acid, and mobile phase B was a solution containing 0.1% FA (formic acid) and 80% ACN; from 0 to 2 min, 4 - 8% B; from 2 to 35 min, 8 - 28% B; from 35 to 55 min, 28 - 40% B; from 55 to 56 min, 95% - 95% B, from 56 to 66 min, 95% - 95% B, flow rate 0.6 μL / min. Chromatographic column: 150 μm i.d.×170 mm, packing: Reprosil-Pur 120 C18-AQ 1.9 μm. Mass spectrometry acquisition: Full MS: Resolution (70000), AGC target (4e8), Maximum IT (20 ms), Number of scan ranges (1), Scan range Spectrum (300 - 1800 m / z), Datatype (Profile); dd-MS2: Resolution (17500), AGC target (1e5), Maximum IT (50 ms); TopN: (20); NCE stepped NCE (30). Analysis was performed using Byonic software.

[0041] Degenerate primers were designed using Primer5.0: c5-cel4-gh5-F2( CATCATCATCATCATCATGAA ATGATATTCGGCGCAGGTGC, SEQ ID NO.3) and c5-cel4-gh5-R2( GTGCTCGAGTGCGGCCGCAA G TCAGCTGGAGCTCGAAGAGGAA, SEQ ID NO.4) to amplify the c5-cel4-gh5 enzyme gene. The methods for cloning, expressing, and purifying c5-cel4-gh5 were the same as those for c5-cel4. The monoclonal bacteria of C5-CEL4 and C5-CEL4-GH5 were respectively inoculated into a mixed liquid medium containing 6 mL of basal salt and 3 mL of LB, and the mixed liquid medium contained 100 μg / mL of kanamycin. C5-CEL4 and C5-CEL4-GH5 were each inoculated into three test tubes, with three replicates set, and cultured with shaking at 37 °C and 180 r / min for 36 h. Centrifugation was carried out at 4 °C and 12000 r / min for 20 min, and the supernatant was collected as the extracellular crude enzyme solution. The Escherichia coli biomass was collected, and the Escherichia coli biomass was resuspended in 5 mL of PBS buffer (pH 7.6), placed in an ice-water bath for ultrasonic disruption, and the lysate was centrifuged at 4 °C and 12,000 r / min for 20 min, and the supernatant was taken as the intracellular crude enzyme solution. The differences in extracellular and intracellular activities between C5-CEL4 and C5-CEL4-GH5 were compared.

[0042] 1.4 Enzyme Activity Assay

[0043] Using 1% (w / v) sodium carboxymethyl cellulose (CMC-Na) as the substrate, the 3,5-dinitrosalicylic acid (DNS) method was used to determine the release amount of reducing sugar, and the activity against CMC-Na was measured. The activity of each unit of CMCase was defined as the amount of enzyme that released 1 μmol of reducing sugar equivalent to glucose per minute. Measurement method: Take 10 μL of purified enzyme and add it to 90 μL of the optimal pH buffer containing 1% CMC-Na, react at the optimal temperature for 30 min, quickly add 150 μL of DNS to terminate the reaction after taking it out, and heat shock at 90 °C for 10 min for color development. After taking it out and cooling, take 150 μL of the reaction mixture and add it to a 96-well culture plate, and measure its absorbance at 540 nm using a microplate reader. Each group of experiments was set with 3 parallels and 1 control.

[0044] 1.5 Enzymatic Properties

[0045] The optimal pH of the purified enzyme C5-CEL4 was determined at pH 3.0 - 10.0 (citrate-disodium hydrogen phosphate buffer, pH 3.0 - 8.0; glycine-sodium hydroxide buffer, pH 8.0 - 10.0). The optimal temperature was determined by measuring the activity of C5-CEL4 at different temperatures (20 - 75 °C) at the optimal pH. To evaluate the thermal stability and pH stability, the purified C5-CEL4 was incubated at different temperatures (40, 45, 50, 55, and 60 °C) for different times (0, 20, 40, 60, 80, 100, and 120 min) and at gradient pH (3.0 - 13.0) for different times (4 °C, 12 and 24 h), and then the residual enzyme activity was measured.

[0046] 1.6 Effects of Salt, Ionic Liquid, Metal Ion and Chemical Reagent on Enzyme Activity

[0047] The optimal salt concentration (0, 0.1, 0.3, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0 M of NaCl) was determined at 50 °C and pH 7. The purified enzyme solution was incubated in a salt solution at pH 7.0 (0 - 5 M) at 4 °C for 9 months, and then the residual enzyme activity was measured (without desalting). The surface electrostatic potential of C5-CEL4 was predicted by AlphaFold Protein Structure Database and Pymol 2.6 software.

[0048] The relative enzyme activity was determined by adding different ionic liquids (i.e., 1-butyl-3-methylimidazolium tetrafluoroborate BMIM-BF4, 1-butyl-3-methylimidazolium acetate BMIM-Ac, and 1-ethyl-3-methylimidazolium chloride EMIM-Cl) at different concentrations (w / v, 1%, 2.5%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%) at 50 °C and pH 7. The purified enzyme solution was incubated (4 °C) for 24 h in the above three ionic liquid solutions (w / v, 1%, 5%, 10%, 20%, 30%, 40%, 45%, 50%) at pH 7.0, and then the residual enzyme activity was measured.

[0049] Effects of metal ions, chemical reagents, and ionic liquids on the activity of C5-CEL4. 1 mM and 10 mM metal ions (Na + , K + , Mg 2+ , Fe 3+ , Ca 2+ , Zn 2+ , Co 2+ , Cu 2+ , Ag + , Mn 2+ , Pb 2+ and Ni 2+ ), 0.1% and 1% of different chemical reagents (EDTA, PMSF, DTT, Tween80, SDS, CTAB, corresponding full names are ethylenediaminetetraacetic acid, phenylmethylsulfonyl fluoride, dithiothreitol, polysorbate-80, sodium dodecyl sulfate, cetyltrimethylammonium bromide), 1% and 10% of different alcohols (Methanol, Ethanol, IPA, β-ME, corresponding full names are methanol, ethanol, isopropanol, β-mercaptoethanol) were added to the reaction system of the enzyme solution respectively. Taking the enzyme activity measured by the untreated enzyme solution as the control (100%), the relative enzyme activity was determined.

[0050] 1.7 Determination of substrate specificity

[0051] The control conditions were tested using the same procedure as above, and no additives were added to the reaction mixture. CMC-Na, sugarcane bagasse xylan, beechwood xylan, corncob xylan, microcrystalline cellulose, and cellobiose were used as substrates (1%, w / v) to explore the substrate specificity of intracellular and extracellular C5-CEL4 enzymes. The kinetic constants of intracellular and extracellular C5-CEL4 enzymes were determined with different concentrations of CMC-Na and sugarcane bagasse xylan from 2 to 20 mg / mL, and incubated at 50 °C and pH 7 for 5 / 10 min. The maximum velocity Km (Michaelis-Menten constant) and Vmax (maximum velocity of the reaction) constants of the reaction were calculated using the Lineweaver-Burk plot.

[0052] 1.8 Thin-layer chromatography analysis of hydrolysis products

[0053] The reaction mixture composed of 1% CMC-Na and 10 μg of purified enzyme was incubated at the optimal pH and temperature for 2 h. The hydrolysis products of CMC were characterized by thin-layer chromatography (TLC) using a silica gel 60 plate (Merck, Darmstadt, Germany). The solvent was 1-butanol / acetic acid / water (2:1:1, v / v / v). Sugars were detected after spraying with freshly prepared 5% (v / v) H2SO4 ethanol and treatment at 120 °C for 10 min. Sugar standards were glucose (G1), cellobiose (G2), cellotriose (G3), and cellotetraose (G4).

[0054] 1.9 Statistical analysis

[0055] Unless otherwise stated, all experiments were set up with three replicates, and all analyses were performed using the mean value. The results were statistically analyzed using SPSS 20.0 and expressed as mean ± SEM. Statistical analysis was performed using one-way analysis of variance, and Tukey's test was used for comparison of multiple experimental groups (0.01 < p value < 0.05).

[0056] 2 Results

[0057] 2.1 Cloning, heterologous expression, and purification of the C5-CEL4 gene

[0058] DNA samples were extracted from the sediment of Lake Ebinur in Xinjiang for sequencing. A candidate cellulase gene sequence was obtained by similarity search of the cellulase sequence and named c5-cel4. The full-length nucleotide sequence of c5-cel4 was 1347 bp, encoding 448 amino acids. No obvious signal peptide sequence was found in c5-cel4, suggesting that the enzyme might be localized in the cytoplasm. The deduced signal peptide-free protein consisted of 448 amino acids, with a theoretical molecular size of 47.54 KDa and a theoretical pI of 4.51.

[0059] The nucleotide sequence of this cellulase gene is shown as follows:

[0060]

[0061] The amino acid sequence of this cellulase is as follows:

[0062] MIFGAGAQAVEPLTVNGNRILAGGEVRSLAGPSFFWSNTGWGAERFYNESAVRWVKNDWNATIVRASLGVDGEGGYLEDPAGNKSRVVELVEAAIANDLYVIIDWHSHHAEDHPAEAVAFFEEMARNYGHHDNVIYEIYNEPLQISWSNTIKPYAETVISAIRAIDPDNLIVVGTPTWSQDVDTASWDPIQGHANIAYTLHFYAGTHTQYLRDKARTALNNGIALFVTEWGTVNANGDGGVAQDETQRWMDFLEANHISHANWALNDKDEGASALVPGVSATGGWGQSELTESGRLVRDIVRGWDGGGSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSGGSGALSCDPGNADVWNSGFVLSNVSVHNDGGADVDGWQVSLQFPQPIQLTNGWNGDFSLSGDGKTLTVANIGWNGYLQPGQSTSFGLQGSYSGNFLMPECSAN, SEQ ID NO.6.

[0063] The cellulase gene was successfully cloned into pSHY211 C-His (a pSHY211 vector with 6 His tags) as a His-tag fusion protein and further confirmed by sequencing. The recombinant cellulase C5-CEL4 can be secreted extracellularly. The monitoring of extracellular activity shows that the optimal fermentation time for enzyme production of C5-CEL4 is 36 h at 37 °C, and the specific activity of the enzyme reaches 0.886 U / mL ( Figure 1 A). The intracellular and extracellular crude enzyme solutions were purified using Ni-NTA nickel columns respectively. The purified intracellular and extracellular proteins both showed a 33 KDa band on 12% SDS-PAGE against the protein Marker, as Figure 2 shown. The actual protein molecular size differed greatly from the theoretical molecular size (47.54 KDa). By analyzing the sequenced sequence, the N-terminus of the protein sequence has a His tag, the C-terminus has no His tag and no stop codon. Therefore, the C-terminus was selected for protein sequencing analysis.

[0064] LC-MS / MS-based protein C-terminal sequencing analysis showed that the C-terminal sequence of the C5-CEL4 protein is IVRGWDGGGSSSSSS, SEQ ID NO.7, and the C-terminus terminates at the 314th amino acid of the protein sequence( Figure 3 ). Therefore, the theoretical size of the expressed target protein is 34.12KDa, and the theoretical pI is 4.69. The premature termination of the amino acid sequence results in a smaller expressed protein, and the actual protein molecular mass is consistent with the theoretical protein molecular mass (34.12KDa), indicating that the target protein has been successfully expressed and purified. Cellulase activity was detected by zymography, and the positive activity was shown as clear bands on a red background( Figure 2 ). Due to the cleavage of the amino acid sequence or premature termination during expression, C5-CEL4 lacks C-terminal amino acid residues 315 to 448, including the CBM domain. The catalytic domain of C5-CEL4 (C5-CEL4-GH5) was amplified by designing primers, and the activity differences between the two were compared. The results showed that the intracellular activities of C5-CEL4 and C5-CEL4-GH5 were not significantly different, but the extracellular activities were significantly different. The extracellular activity of C5-CEL4-GH5 was extremely low, probably because the amino acid sequence of C5-CEL4 lacks some parts related to extracellular secretion in Escherichia coli( Figure 1 B).

[0065] The nucleotide sequence (1347bp) of the cellulase gene c5-cel4 expressed in Escherichia coli is shown in SEQ ID NO.5.

[0066] The nucleotide sequence (945bp) of the cellulase gene c5-cel4-gh5 expressed in Escherichia coli is as follows:

[0067] ATGATATTCGGCGCAGGTGCCCAGGCGGTGGAGCCGTTGACCGTCAATGGCAACCGGATACTGGCCGGTGGTGAAGTGCGCAGCCTGGCCGGGCCCAGCTTCTTCTGGAGCAACACCGGCTGGGGCGCCGAGCGTTTCTACAACGAAAGCGCGGTGCGCTGGGTCAAGAACGACTGGAACGCCACCATCGTGCGCGCCTCCCTGGGTGTGGACGGAGAGGGCGGCTACCTGGAAGACCCGGCCGGCAACAAGAGCCGGGTGGTCGAACTGGTGGAGGCAGCCATTGCCAACGACCTCTACGTGATCATCGACTGGCACTCCCACCACGCCGAGGACCACCCCGCCGAAGCGGTAGCGTTTTTTGAGGAAATGGCCCGCAACTACGGTCATCACGACAACGTCATCTACGAAATCTACAACGAGCCATTACAGATTTCCTGGAGCAACACCATCAAGCCTTATGCGGAGACGGTCATTTCCGCCATCCGCGCCATCGATCCGGACAACCTGATCGTGGTGGGCACACCCACCTGGTCCCAGGACGTGGACACCGCCTCCTGGGACCCGATCCAGGGACACGCCAATATCGCCTACACCCTGCACTTCTACGCCGGCACCCATACGCAATACCTGCGCGACAAGGCGCGGACCGCATTGAACAACGGCATCGCGCTGTTCGTCACCGAGTGGGGTACCGTCAACGCCAACGGCGACGGCGGTGTCGCCCAGGATGAAACCCAGCGCTGGATGGACTTCCTCGAAGCCAACCATATCAGCCACGCAAACTGGGCACTGAACGACAAGGACGAGGGCGCCTCCGCCCTGGTGCCTGGCGTCAGCGCCACCGGCGGCTGGGGGCAGAGCGAACTGACCGAATCCGGCCGGCTGGTGCGGGATATAGTGCGGGGCTGGGATGGAGGCGGTTCCTCTTCGAGCTCCAGCTGA, SEQ ID NO.8。

[0068] The amino acid sequence (314 residues) of cellulase C5-CEL4-GH5 is expressed in Escherichia coli as follows:

[0069] MIFGAGAQAVEPLTVNGNRILAGGEVRSLAGPSFFWSNTGWGAERFYNESAVRWVKNDWNATIVRASLGVDGEGGYLEDPAGNKSRVVELVEAAIANDLYVIIDWHSHHAEDHPAEAVAFFEEMARNYGHHDNVIYEIYNEPLQISWSNTIKPYAETVISAIRAIDPDNLIVVGTPTWSQDVDTASWDPIQGHANIAYTLHFYAGTHTQYLRDKARTALNNGIALFVTEWGTVNANGDGGVAQDETQRWMDFLEANHISHANWALNDKDEGASALVPGVSATGGWGQSELTESGRLVRDIVRGWDGGGSSSSSS, SEQ ID NO.9.

[0070] By alignment in NCBI, the amino acid sequence of C5-CEL4 has a similarity of 90.97% with the cellulase from Microbulbifer litoralis (for all sequence analyses, the sequences use the actually expressed amino acid sequences). As Figure 4 shown, the phylogenetic analysis of the amino acid sequence shows that C5-CEL4 belongs to the glycoside hydrolase family of cellulases and clusters with the cellulase from Microbulbifer halophilus (GenBank: WP_265722981.1) with a support rate of 85%, and Microbulbifer halophilus is a moderately halophilic bacterium.

[0071] In the PDB database, the protein has a similarity of 70% with two GH5 family endoglucanases from Cellvibrio japonicus (PDB: 8BQA, 8BQC). The results of multiple sequence alignment show that C5-CEL4 has a relatively high homology with GH5 family cellulases 8BQA, 8BQC, 8C10, 4M1R, and endoglucanase 1EGZ( Figure 5 ).

[0072] Further protein sequence analysis shows that C5-CEL4 contains a cellulase catalytic domain (CD) and belongs to the GH5 family of cellulases( Figure 6A). Through SWISS-MODEL homology modeling, the GMQE value of this protein with the GH5 family endoglucanase from Microbulbiferrhizosphaerae is up to 0.94. C5-CEL4 has a highly conserved overall structure, namely a typical (β / α)8 TIM barrel fold, with 8 loops around the catalytic cleft ( Figure 6 B). This structural fold provides rich degrees of freedom for variation of the loops, enabling the protein to have catalytic diversity, including substrate specificity, thermal stability, and pH stability, etc.

[0073] 2.2 Effects of temperature and pH on C5-CEL4

[0074] The optimal reaction temperature for the activities of both intracellular pure enzyme and extracellular pure enzyme of C5-CEL4 is 50 °C, and the activities remain above 80% at 35 - 60 °C ( Figure 7 A). The optimal pH for the activities of both intracellular pure enzyme and extracellular pure enzyme of C5-CEL4 is 7.0, and more than 70% of the maximum activity is maintained between pH 6.0 and 8.0. Figure 7 B). Thermal stability analysis shows that C5-CEL4 still retains 100% activity after heat treatment at 40 °C for 2 h, and still retains 74% activity after heat treatment at 50 °C for 2 h, and its half-life at 55 °C and 60 °C is 70 min. Figure 7 C). pH stability analysis shows that within the range of pH 3.0 - 13.0, its activity remains above 50% of the initial activity. After the pure enzyme solution is incubated at 4 °C for 12 h and 24 h, its activity remains above 80% within the range of pH 4.0 - 12.0. Figure 7 D).

[0075] 2.3 Effects of salts and ionic liquids on C5-CEL4

[0076] As Figure 8 shown in A, the optimal reaction NaCl concentration for the activity of C5-CEL4 is 2.5 - 3.0 M, and the activity still remains above 100% at the nearly saturated salt concentration of 5 M. Salinity tolerance analysis shows that after C5-CEL4 is treated at different salt concentrations at 4 °C for 9 months, it still retains about 100% or more activity in NaCl with a concentration of 0.5 M - 5.0 M. Figure 8 B). When 1 mM / 10 mM NaCl, NaNO3, and Na2SO3 are added to the reaction mixture, the activity of C5-CEL4 still remains near 100%, indicating that the addition of different sodium salt anions has no obvious effect on the activity of C5-CEL4 (Table 1). The activity of C5-CEL4 is significantly increased to more than 110% of the initial activity in 1% - 10% EMIM-Cl ionic liquid. Figure 8C), in three ionic liquids with a concentration of 20%, it retained more than 60% of its relative activity. In addition, after incubation in three ionic liquids with a concentration of 40% for 24 h, the residual activity of C5-CEL4 was as high as about 90% or more, and it was even slightly activated( Figure 8 D). These results indicate that C5-CEL4 is a salt- and ionic liquid-tolerant cellulase.

[0077] As Figure 9 shown, the distribution of acidic amino acids on the protein surface is relatively high, making the overall electrostatic potential negative, which is conducive to weakening the surface hydrophobicity or enhancing the hydrophilicity of the enzyme, improving the water-binding ability of the enzyme, and preventing the aggregation of the enzyme in high-salt solutions.

[0078] 2.4 Effects of Metal Ions and Chemical Reagents on C5-CEL4

[0079] As shown in Table 1, the activity of C5-CEL4 can be activated by 1 mM Co 2+ (114.4 ± 1.1%), 1 mM Mn 2+ (135.6 ± 8.7%), 10 mM Mn 2+ (212.4 ± 0.4%). It is moderately inactivated in 1 mM and 10 mM K + , Mg 2+ , Fe 3+ , Ca 2+ , Zn 2+ , Cu 2+ , Ag + , Ni 2+ , and loses about 9% of its relative activity in 10 mM Pb 2+ . Co 2+ increases the relative activity by about 14%, and Mn 2+ strongly activates the enzyme activity (about 2.1-fold increase). The inhibitors 0.1% EDTA, PMSF, and DTT have no obvious effect on C5-CEL4, but when the concentration is increased to 1.0%, the enzyme is moderately inactivated in EDTA and PMSF. 0.1% Tween80 increases the relative activity of the enzyme by about 37%, and it is still slightly activated when the concentration is increased to 1%. 0.1% / 1.0% SDS and CTAB have a slight inhibitory effect on its activity. 1% and 10% methanol, ethanol, and isopropanol do not affect the enzyme activity. It still maintains 76% of its relative activity in 1% β-ME, but when the concentration is increased to 10%, the enzyme is directly inactivated.

[0080] Table 1 Effects of Different Ions and Chemical Reagents on the Activity of Intracellular Enzyme C5-CEL4

[0081]

[0082]

[0083] Note: The experimental data were analyzed for significance (p > 0.05 is not significant, 0.05 > p > 0.01 is significant and marked as *, p < 0.01 is extremely significant and marked as **), 100% = 19.6 ± 3.47 U / mg.

[0084] 2.5 Substrate Specificity and Kinetic Analysis of C5-CEL4

[0085] The substrate specificity of C5-CEL4 is shown in Table 2. The extracellular enzyme C5-CEL4 was active against CMC-Na (24.36 ± 0.23 U / mg), sugarcane bagasse xylan (13.24 ± 0.61 U / mg), and beechwood xylan (14.06 ± 0.53 U / mg), but not against corncob xylan, microcrystalline cellulose, and cellobiose. Similarly, the intracellular enzyme C5-CEL4 was active against CMC-Na (19.60 ± 3.47 U / mg), sugarcane bagasse xylan (2.50 ± 0.77 U / mg), and beechwood xylan (1.48 ± 2.01 U / mg), but not against corncob xylan, microcrystalline cellulose, and cellobiose.

[0086] The Km, Vmax, and Kcat of the extracellular enzyme C5-CEL4 for CMC-Na were 45.03 mg / mL, 158.73 μmol / min / mg, and 98.20 S -1 , respectively, and for sugarcane bagasse xylan were 16.05 mg / mL, 15.55 μmol / min / mg, and 12.32 S -1 . The Km, Vmax, and Kcat of the intracellular recombinant enzyme C5-CEL4 for CMC-Na were 101.71 mg / mL, 357.14 μmol / min / mg, and 220.95 S -1 (see Table 3).

[0087] Table 2 Substrate Specificity of C5-CEL4

[0088]

[0089] Table 3 Kinetic Parameters of C5-CEL4

[0090]

[0091]

[0092] 2.6 Thin Layer Chromatography (TLC) Analysis of C5-CEL4 Hydrolyzing CMC-Na

[0093] As Figure 10As shown, the hydrolysis products of CMC-Na were analyzed by TLC using C5-CEL4. The results showed that C5-CEL4 randomly cleaved the cellulose oligosaccharide chains, producing cellotriose (G3) by hydrolysis.

[0094] 3 Conclusions

[0095] In this invention, a new cellulase gene c5-cel4 was obtained from the metagenome of the sediment at the bottom of Aibi Salt Lake in Xinjiang, cloned, and heterologously expressed in Escherichia coli. The protein structure analysis of C5-CEL4 showed that the abundant distribution of acidic amino acids on the protein surface led to a negative overall electrostatic potential, which helped enhance the hydrophilicity of the enzyme surface and improve the water-binding ability of the enzyme, endowing the enzyme with salt tolerance. The enzymatic properties indicated that C5-CEL4 had hydrolytic activity towards both CMC-Na and sugarcane bagasse xylan, was a multifunctional cellulase, and had the characteristics of heat resistance, alkali resistance, salt tolerance, and high tolerance to ionic liquids. In addition, the enzyme could tolerate most metal ions, inhibitors, and alcohols. This indicated that C5-CEL4 was an ideal candidate enzyme for biomass conversion, washing, and textile industrial production, and had great potential application prospects in feed, food, and bioenergy.

[0096] In this specification, each embodiment is described in a progressive manner. The key point of each embodiment is to illustrate the differences from other embodiments. The same or similar parts among the embodiments can be referred to each other.

[0097] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features disclosed herein.