MiRNA simulant for targeted inhibition of expression of large yellow croaker SOCS1 gene and application of miRNA simulant

Abstract

The invention discloses a miRNA simulant for inhibiting expression of a large yellow croaker SOCS1 gene and application of the miRNA simulant, and belongs to the field of molecular biotechnology and gene engineering. The miRNA simulant is miR-7132a, and the nucleotide sequence of the miRNA simulant is shown as SEQ ID NO. 2. The invention discloses a miR-7132a simulant which is synthesized by a sense strand and an antisense strand, and the nucleotide sequence of the miR-7132a simulant is shown as SEQ ID NO.3-SEQ ID NO.4. When the miR-7132a simulant is transfected in primary head kidney lymphocytes of large yellow croakers, the mRNA level of SOCS1 genes of the large yellow croakers can be remarkably reduced, and T and B lymphocyte proliferation can be promoted, so that adaptive immune response is enhanced. Therefore, the miR-7132a simulant has a potential application value in development of the pseudosciaena crocea immunomodulator.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology and genetic engineering, and specifically relates to a miRNA mimic for targeted inhibition of SOCS1 gene expression in large yellow croaker and an application thereof. Background Art

[0002] Adaptive immunity is the ability to accurately identify pathogen-specific antigens through specific receptors on the surface of T cells and B cells, effectively eliminate pathogens, and protect the body from pathogen infection. In addition, adaptive immunity has immune memory. After the initial immunization, the immune system will retain memory T cells and memory B cells. When the same pathogen invades again, these memory cells will quickly initiate the primary immune response, produce a faster and stronger immune response, and thus eliminate the pathogen more quickly. Adaptive immunity also has a wide range of antigen recognition capabilities and can recognize and respond to many different types of pathogens, including viruses, bacteria, fungi, and parasites (FA Bonilla and HC Oettgen. 2010. Adaptiveimmunity. JAllergy Clin Immunol, 125(2 Suppl 2), S33-40). Suppressor of cytokine signaling 1 (SOCS1) is an important negative regulator of the interleukin-4 (IL-4) and IL-13 signaling pathways. It inhibits IL-4 and IL-13 downstream signaling by acting on JAK or STAT molecules, negatively regulating adaptive immune responses (Miao M, et al. 2024. IL-13 facilitates ferroptotic death in asthmatic epithelial cells via SOCS1-mediated ubiquitinated degradation ofSLC7A11. Redox Biol.). Therefore, screening molecules that inhibit SOCS1 function is expected to be developed into immune-modulating drugs.

[0003] MicroRNA is a non-coding RNA of about 22 nt in length that is widely found in eukaryotes. It targets the 3'UTR of mRNA by binding to the RNA silencing complex, degrading mRNA or inhibiting mRNA translation, and is widely involved in biological processes such as development and immunity. MiRNA mimics can precisely regulate the expression of target genes. At the same time, miRNA mimics are easy to synthesize and are widely used in disease treatment and other fields (BR Cullen. 2013. MicroRNAs as mediators of viral evasion of the immune system. Nat Immunol, 14(3), 205-210.).

[0004] So far, no miRNA mimics have been used to regulate the expression of SOCS1 gene and its adaptive immune response in large yellow croaker. Summary of the invention

[0005] The object of the present invention is to provide a miRNA (miR-7132a) mimic targeting and inhibiting the expression of SOCS1 gene in large yellow croaker and its application in preparing a reagent for regulating SOCS1 gene expression in large yellow croaker and / or preparing an immunomodulatory drug for large yellow croaker.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: The present invention provides a miRNA mimic, wherein the miRNA is miR-7132a, and its nucleotide sequence is shown in SEQ ID NO.2; the miR-7132a mimic is synthesized by a sense chain and an antisense chain, the nucleotide sequence of the sense chain is shown in SEQ ID NO.3, and the nucleotide sequence of the antisense chain is shown in SEQ ID NO.4.

[0007] The present invention also provides the use of the miRNA mimics in preparing a reagent for regulating the expression of SOCS1 gene of large yellow croaker.

[0008] Furthermore, in the above application, the miRNA mimics inhibit the expression of SOCS1 gene.

[0009] The present invention also provides the use of the above-mentioned mimetic in the preparation of immunomodulatory drugs for large yellow croaker.

[0010] Furthermore, in the above application, the large yellow croaker immunomodulatory drug promotes the proliferation of large yellow croaker T cells and B cells.

[0011] The beneficial effects of the present invention are: The present invention provides a miR-7132a mimic that can target SOCS1 in large yellow croaker, and the mimic can be transferred into the primary lymphocytes of the head kidney of large yellow croaker to effectively reduce the transcription level of SOCS1. At the same time, it can also promote the proliferation of T cells and B cells, thereby enhancing the adaptive immune response. The above results show that the miR-7132a mimic can be used for the development of large yellow croaker immunomodulatory drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 The results of miR-7132a mimics inhibiting the expression level of pmiRGLO-SOCS1-3'UTR; Figure A is a schematic diagram of the miR-7132a mimic sequence and its bound large yellow croaker SOCS1 3'UTR sequence and mutant sequence; Figure B is the effect of NCmimics and miR-7132amimics on the luciferase activity of cells transfected with pmiRGLO-SOCS1-3'UTR or its mutant plasmids.

[0013] Figure 2 The results of SOCS1 mRNA levels in primary head kidney lymphocytes of large yellow croaker after transfection with miR-7132a mimics are shown in Figure A. Figure A shows the effects of NC mimics and miR-7132a mimics on endogenous miR-7132a levels; Figure B shows the effects of NC mimics and miR-7132amimics on endogenous SOCS1 transcription levels.

[0014] Figure 3 The results of the proliferation ratio of T cells and B cells in primary head kidney lymphocytes after transfection with miR-7132a mimics are shown in Figure A. + Flow cytometry of T cell ratio; Figure B shows the proliferation of Zap70 + T cell statistics; Figure C shows the proliferation of IgM + B cell ratio flow cytometry; Figure D is the proliferation of IgM + B cell statistics results. DETAILED DESCRIPTION

[0015] In order to make the technical solutions and advantages of the present invention more clear, the invention contents of the present invention are described in detail through the following examples, but they should not be regarded as limiting the scope of the present invention.

[0016] The methods used in the implementation of the following cases are conventional methods unless otherwise specified, and the materials used are commercially available unless otherwise specified.

[0017] Example 1 Prediction and verification of miR-7132a mimics targeting SOCS1 of large yellow croaker The target mRNA sequence of the miRNA mimic of the present invention is shown in SEQ ID NO. 1 in the sequence table. The target sequence of the miRNA mimic is located at 42-63 bases after the termination codon (TAA) of the mRNA sequence (AGGACGCGGTTTTTACCAAGTA).

[0018] The nucleotide sequence of miR-7132a described in the present invention is shown as 3'-CGACUCCCGAAACUGGUUCAG-5' (SEQ ID NO. 2).

[0019] The miR-7132a mimics of the present invention have sequence specificity in that the sense strand sequence is 5'-GACUUGGUCAAAGCUCCUCAGC-3' (SEQ ID NO. 3) and the antisense strand sequence is 5'-GCUGAGGAGCUUUGACCAAGUC-3' (SEQ ID NO. 4).

[0020] The software miRanda and PITA were used to predict the binding site of miR-7132a in the 3'UTR region of the mRNA sequence of the SOCS1 gene of large yellow croaker (GenBank accession number: XM_010729149.3). The sequence of the binding site was: 5'-AGGACGCGGUUUUUACCAAGUA-3'. The large yellow croaker SOCS1 3'UTR sequence and the corresponding mutant sequence (5'-AGGACGCGGUUUUUGUUGGACA-3') were inserted into the SacI restriction site and Xbal restriction site of the pmiRGLO vector (Promega) by homologous recombination, and named pmiRGLO-SOCS1-WT and pmiRGLO-SOCS1-MUT. HEK-293T cells were cultured at 2×10 5 / well was inoculated into a 24-well plate, and 0.5 mL of prepared DMEM complete medium (containing 10% fetal bovine serum from Gibco, USA and 1% penicillin / streptomycin from Nearshore Protein) was added, and cultured in an incubator at 37°C and 5% carbon dioxide. When the cells grew to 80%, the synthetic miRNA mimics and pmiRGLO-SOCS1-WT or pmiRGLO-SOCS1-MUT were transfected into HEK-293T cells using the transfection reagent Lipofectamine 2000 (Invitrogen), and the final concentration of miRNA mimics was 100 nM / well. After 36 hours, the luciferase activity of the cell samples was detected using the dual luciferase reporter system detection kit (E1910; Promega), and the Renilla luciferase activity was used as an internal reference. The results are shown in Figure 1As shown, transfection of miR-7132a mimics inhibited the luciferase activity of pmiRGLO-SOCS1-WT cells, but had no effect on the luciferase activity of pmiRGLO-SOCS1-MUT cells, indicating that miR-7132a mimics may inhibit the expression of upstream genes by binding to the 3'UTR of SOCS1 in large yellow croaker.

[0021] Example 2 Effect of miR-7132a mimics on inhibiting SOCS1 mRNA levels in primary head kidney lymphocytes of large yellow croaker The primary head kidney lymphocytes of large yellow croaker were separated by Percoll separation method and 2×10 6 / well inoculated into 6-well plates, added 2 mL of prepared DMEM complete medium (containing 10% fetal bovine serum and 1% penicillin / streptomycin), and placed in an incubator at 28°C and 5% carbon dioxide. After 4 hours, the miRNA mimics were transfected into the primary head kidney lymphocytes of large yellow croaker using the transfection reagent Lipofectamine 2000 (Invitrogen), and the final concentration of the miRNA mimics was 100 nM / well. After 24 hours, the total RNA of the cells was extracted using an RNA extraction kit (Novozymes), and then the RNA was reverse transcribed into cDNA using an RNA reverse transcription kit (Promega). Fluorescence quantitative PCR reaction was performed using cDNA as a template. The reaction system was as follows: 1 μL cDNA, 0.5 μL each of 10 μM upstream and downstream primers, 10 μL SYBR Green Mix (Novozymes), and 8 μL sterile water in a 20 μL system; reaction procedure: 95°C pre-denaturation for 30 s; 95°C denaturation for 5 s, 60°C annealing and extension for 30 s, 40 cycles, and finally 60-95°C melting curve stage. The mRNA levels of endogenous miR-7132a and SOCS1 were detected, and U6 was used as the internal reference of miRNA. β-actin As the internal reference of mRNA. The primer sequences used in the fluorescence quantitative PCR reaction are shown in Table 1. The downstream primers of miR-7132a and U6 are both miRNA-R. Figure 2 As shown, after transfection of miR-7132a mimics, the level of miR-7132a in primary head kidney lymphocytes of large yellow croaker was significantly upregulated, and the expression of SOCS1 mRNA in large yellow croaker was significantly downregulated, with a downregulation range of about 43%.

[0022] Table 1 Primers used in fluorescence quantitative PCR experiments

[0023] Example 3 Application of miR-7132a mimics to promote T cell and B cell proliferation in primary head kidney lymphocytes of large yellow croaker The experiment was divided into TRX group, IL-4 / 13A group and IL-4 / 13B group. The primary head kidney lymphocytes of large yellow croaker were separated by percoll separation method, labeled with CFSE (Sigma), cultured at 28℃ for 4 h, and transfected with miRNA mimics using transfection reagent Lipofectamine2000 (Invitrogen), with a final concentration of 100 nM / well. After 6 h, the control protein thioredoxin (TRX) with a final concentration of 100 ng / mL, 100 ng / mL of large yellow croaker IL-4 / 13A recombinant protein and 100 ng / mL of large yellow croaker IL-4 / 13B recombinant protein were added for treatment. After 48 h, the primary head kidney lymphocytes of large yellow croaker were labeled with Zap70 monoclonal antibody and anti-large yellow croaker IgM monoclonal antibody for large yellow croaker T cells and B cells, respectively. Finally, the proportion of proliferating cells in T cells and B cells was analyzed by flow cytometry. The results are shown in Figure 3 As shown in the figure, whether it is the TRX recombinant protein treatment group or the large yellow croaker IL-4 / 13A treatment group and IL-4 / 13B treatment group, after transfection with miR-7132a mimics, Zap70 + T cells and IgM + The proportion of proliferating cells in B cells was significantly higher than that in the random miRNA (NC mimics) transfection group, indicating that miR-7132a mimics targets SOCS1 in large yellow croaker, downregulates the mRNA level of SOCS1, weakens the function of SOCS1 in large yellow croaker, thereby enhancing the promoting effect of IL-4 / 13A and IL-4 / 13B on the proliferation of T cells and B cells, and strengthening the adaptive immune response of large yellow croaker.

[0024] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A miRNA mimic, characterized in that: The miRNA is miR-7132a, and its nucleotide sequence is shown in SEQ ID NO.2; the mimic of miR-7132a is synthesized by a sense chain and an antisense chain, the nucleotide sequence of the sense chain is shown in SEQ ID NO.3, and the nucleotide sequence of the antisense chain is shown in SEQ ID NO.

4.

2. Use of the miRNA mimics as claimed in claim 1 in preparing a reagent for regulating the expression of the SOCS1 gene of large yellow croaker.

3. The use according to claim 2, characterized in that: The miRNA mimics inhibit the expression of SOCS1 gene.

4. Use of the mimetic as claimed in claim 1 in the preparation of immunomodulatory drugs for large yellow croaker.

5. The use according to claim 4, characterized in that :The large yellow croaker immunomodulatory drug promotes the proliferation of large yellow croaker T cells and B cells.

Images