SiRNA for inhibiting interleukin-8 and application thereof

Abstract

The invention relates to siRNA for inhibiting interleukin-8 and application of the siRNA, and belongs to the technical field of biology. The invention provides siRNA (small interfering Ribonucleic Acid) for inhibiting interleukin-8. A positive-sense strand of the siRNA comprises a nucleic acid molecule of which the nucleotide sequence is shown as any one of SEQ ID NO.1-21; the antisense strand of the siRNA comprises a nucleic acid molecule of which the nucleotide sequence is as shown in any one of SEQ ID NO.22 to 42. Experiments prove that all the siRNAs have high inhibitory activity on interleukin-8. The invention also provides a modified siRNA (small interfering Ribonucleic Acid) for inhibiting interleukin-8, wherein the modification comprises methoxy modification, fluoro modification and / or phosphorothioate group connection. Experiments prove that the modified siRNA has high inhibitory activity on interleukin-8 at the concentration of 0.1 to 10 nM.

Description

[0001] This application is a divisional application of "The application date is October 25, 2024, the application number is: 202411499425.1, and the invention name is a siRNA for inhibiting interleukin-8 and its application". Technical Field

[0002] The invention relates to siRNA for inhibiting interleukin-8 and application thereof, belonging to the field of biotechnology. Background Art

[0003] Interleukin-8 (IL-8), also known as CXCL8, is encoded by the IL8 gene transcription and is an endogenous cytokine produced by a variety of cells. It was first discovered in lipopolysaccharide-induced human peripheral blood mononuclear cell culture fluid. The main biological function of interleukin-8 is to chemotaxis and activate neutrophils, prompting them to migrate to the site of inflammation and participate in the regulation of immune and inflammatory responses. Studies have shown that many patients with autoimmune or infectious inflammation have abnormal interleukin-8 expression levels, and studies have confirmed that interleukin-8 inhibitors can achieve the effect of treating inflammation by inhibiting leukocyte respiratory burst and free radical release.

[0004] In addition to participating in the regulation of immune and inflammatory responses, interleukin-8 is also involved in the occurrence and development of tumors. Studies have shown that most tumors, including liver cancer, breast cancer, nasopharyngeal carcinoma, colorectal cancer and gastric cancer, can secrete interleukin-8 to promote their own growth, and the overexpression of interleukin-8 is closely related to malignant biological behaviors such as tumor cell proliferation, invasion and metastasis. At the same time, studies have shown that interleukin-8 is an important inflammatory response factor and immunosuppressive factor that is indispensable in the tumor microenvironment. It has the ability to recruit immunosuppressive cells to inhibit anti-tumor immune responses and is closely related to tumor resistance. Therefore, interleukin-8 can be used as a target for tumor immunotherapy to treat or assist in the treatment of various cancers by inhibiting tumor proliferation, invasion, metastasis and drug resistance.

[0005] Small interfering RNA (siRNA) is a double-stranded RNA of 20 to 25 nucleotides in length, which mainly mediates specific gene silencing involving specific enzymes through the RNA interference (RNAi) mechanism. In the RNAi pathway, siRNA interferes with gene expression by hybridizing with complementary mRNA molecules. This interference triggers mRNA degradation, thereby inhibiting the gene expression of specific genes. This specific way of regulating gene expression allows siRNA to be used as a targeted therapeutic drug to specifically regulate the expression of disease-related genes, thereby achieving the purpose of treating diseases. If siRNA that can effectively inhibit the expression of interleukin-8 can be developed, it will be a more effective and targeted drug for the treatment of inflammation and cancer. Summary of the invention

[0006] To solve the above problems, the present invention provides an siRNA for inhibiting interleukin-8, wherein the siRNA contains a sense strand and an antisense strand; the sense strand and the antisense strand are at least partially reverse-complementary to form a double-stranded region; the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in any one of SEQ ID NOs.1 to 21; and the antisense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in any one of SEQ ID NOs.22 to 42.

[0007] In one embodiment of the present invention, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.1, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.22;

[0008] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.2, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.23;

[0009] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.3, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.24;

[0010] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.4, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.25;

[0011] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.5, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.26;

[0012] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.6, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.27;

[0013] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.7, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.28;

[0014] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.8, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.29;

[0015] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.9, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.30;

[0016] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.10, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.31;

[0017] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.11, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.32;

[0018] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.12, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.33;

[0019] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.13, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.34;

[0020] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.14, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.35;

[0021] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.15, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.36;

[0022] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.16, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.37;

[0023] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.17, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.38;

[0024] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.18, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.39;

[0025] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.19, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.40;

[0026] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.20, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.41;

[0027] Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.21, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.42.

[0028] In one embodiment of the present invention, the nucleotide sequence of the sense strand of the siRNA is shown as SEQ ID NO.1, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.22;

[0029] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.2, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.23;

[0030] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.3, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.24;

[0031] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.4, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.25;

[0032] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.5, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.26;

[0033] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.6, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.27;

[0034] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.7, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.28;

[0035] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.8, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.29;

[0036] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.9, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.30;

[0037] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.10, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.31;

[0038] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.11, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.32;

[0039] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.12, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.33;

[0040] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.13, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.34;

[0041] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.14, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.35;

[0042] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.15, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.36;

[0043] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.16, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.37;

[0044] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.17, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.38;

[0045] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.18, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.39;

[0046] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.19, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.40;

[0047] Alternatively, the nucleotide sequence of the sense strand of the siRNA is as shown in SEQ ID NO.20, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.41;

[0048] Alternatively, the nucleotide sequence of the sense strand of the siRNA is shown as SEQ ID NO.21, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.42.

[0049] In one embodiment of the present invention, at least one nucleotide in the sense strand or the antisense strand of the siRNA is a modified nucleotide.

[0050] In one embodiment of the present invention, all nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides, and these modifications on the nucleotide groups will not significantly weaken or lose the function of the siRNA disclosed herein to inhibit interleukin-8 gene expression.

[0051] In one embodiment of the present invention, the modification comprises methoxy modification, fluorine modification and / or phosphorothioate linkage.

[0052] In one embodiment of the present invention, the "phosphorothioate linkage" means that at least a portion of the phosphate groups in the phosphate-sugar backbone of at least one single strand in the sense strand and the antisense strand of the siRNA is a phosphate group having a modified group.

[0053] In one embodiment of the present invention, the phosphate group having a modified group is a phosphorothioate group formed by replacing at least one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom.

[0054] In one embodiment of the present invention, the fluorinated modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 7th, 8th, and 9th nucleotides of the sense strand are fluorinated modified nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorinated modified nucleotides;

[0055] The methoxy-modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 1st, 2nd, 3rd, 4th, 5th, 6th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th nucleotides of the sense strand are methoxy-modified nucleotides, and at least the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th nucleotides of the antisense strand are methoxy-modified nucleotides;

[0056] The nucleotides linked by the thiophosphate groups are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 1st and 2nd, and the 2nd and 3rd nucleotides of the sense strand are linked by the thiophosphate groups, and at least the 1st and 2nd, the 2nd and 3rd, the 19th and 20th, and the 20th and 21st nucleotides of the antisense strand are linked by the thiophosphate groups.

[0057] The present invention also provides a recombinant plasmid, which expresses the above siRNA.

[0058] In one embodiment of the present invention, the vector of the recombinant plasmid includes at least one of a viral vector or a non-viral vector; the viral vector includes at least one of a flavivirus vector, a retrovirus vector, a phage vector, an adenovirus vector, an adeno-associated virus vector, a vaccinia virus vector, a hybrid virus vector, a baculovirus vector, a herpes simplex virus vector or a lentivirus vector; the non-viral vector includes a plasmid vector.

[0059] In one embodiment of the present invention, the plasmid vector comprises a pUC plasmid, a derivative plasmid of a pUC plasmid, a pAAV plasmid, a derivative plasmid of a pAAV plasmid, a PGEM plasmid and / or a derivative plasmid of a PGEM plasmid.

[0060] In one embodiment of the present invention, the preparation method of the recombinant plasmid is: designing shRNA according to siRNA; connecting shRNA with a linearized vector to obtain the recombinant plasmid.

[0061] The present invention also provides a host cell, wherein the genome of the host cell is integrated with the above siRNA; or the host cell carries the above recombinant plasmid.

[0062] In one embodiment of the present invention, the host cell comprises fungi, bacteria, plant cells and / or animal cells.

[0063] The present invention also provides the use of the above siRNA, the above recombinant plasmid or the above host cell in preparing a drug for preventing and / or treating a disease, characterized in that the disease is a disease related to the expression of interleukin-8.

[0064] In one embodiment of the present invention, the disease associated with the expression of interleukin-8 includes cancer and / or inflammation.

[0065] In one embodiment of the present invention, the cancer includes liver cancer, breast cancer, nasopharyngeal cancer, colorectal cancer and / or gastric cancer.

[0066] The present invention also provides an interleukin-8 inhibitor, the components of which include the above-mentioned siRNA, the above-mentioned recombinant plasmid and / or the above-mentioned host cell.

[0067] In one embodiment of the present invention, the inhibitor further comprises a pharmaceutically acceptable excipient; the pharmaceutically acceptable excipient includes a carrier, a diluent, a binder and / or a lubricant.

[0068] The present invention also provides a drug for preventing and / or treating a disease, wherein the disease is a disease related to the expression of interleukin-8; the components of the drug include the above-mentioned siRNA, the above-mentioned recombinant plasmid and / or the above-mentioned host cell.

[0069] In one embodiment of the present invention, the disease associated with the expression of interleukin-8 includes cancer and / or inflammation.

[0070] In one embodiment of the present invention, the cancer includes liver cancer, breast cancer, nasopharyngeal cancer, colorectal cancer and / or gastric cancer.

[0071] In one embodiment of the present invention, the composition of the drug further comprises a pharmaceutically acceptable excipient; the pharmaceutically acceptable excipient comprises a carrier, a diluent, a binder and / or a lubricant.

[0072] The technical solution of the present invention has the following advantages:

[0073] The present invention provides an siRNA for inhibiting interleukin-8, wherein the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in any one of SEQ ID NOs. 1 to 21; and the antisense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in any one of SEQ ID NOs. 22 to 42. Experiments have shown that the siRNAs all have high inhibitory activity against interleukin-8, and therefore, the siRNAs have great application prospects in the preparation of drugs for preventing and / or treating diseases related to the expression of interleukin-8 (such as cancer and inflammation, etc.).

[0074] Furthermore, the nucleotides at positions 7, 8, and 9 of the sense strand of the siRNA are fluorine-modified nucleotides, the nucleotides at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxy-modified nucleotides, and the nucleotides at positions 1 and 2, and at positions 2 and 3 are linked by thiophosphate groups; the nucleotides at positions 2, 6, 14, and 16 of the antisense strand of the siRNA are fluorine-modified nucleotides, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by thiophosphate groups. Experiments have shown that the modified siRNA has high inhibitory activity against interleukin-8 at a concentration of 0.1 to 10 nM. Therefore, the modified siRNA has great application prospects in the preparation of drugs for preventing and / or treating diseases related to the expression of interleukin-8 (such as cancer and inflammation, etc.). DETAILED DESCRIPTION

[0075] The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0076] If no specific experimental steps or conditions are specified in the following examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be purchased commercially.

[0077] In the following embodiments, capital letters C, G, U, and A represent ribonucleotides; lowercase letter m represents that the nucleotide adjacent to the left of the letter m is a methoxy-modified nucleotide; lowercase letter f represents that the nucleotide adjacent to the left of the letter f is a fluorinated-modified nucleotide; lowercase letter s represents that the nucleotides adjacent to the left and right of the letter s are modified with a phosphorothioate group.

[0078] Example 1: A siRNA for inhibiting interleukin-8

[0079] This embodiment provides a siRNA for inhibiting interleukin-8. The nucleotide sequence of the siRNA is designed based on the target mRNA, as shown in Table 1.

[0080] Table 1. siRNAs and their sequences that inhibit interleukin-8

[0081] siRNA Name Sense strand (5′ to 3′) serial number Antisense strand (5′ to 3′) serial number IL8-H-1 CAAUGAAUAGUUUUUUCAUU SEQ ID NO.1 AAUGAAAAACUAUUCAUUGUU SEQ ID NO.22 IL8-H-2 CUACAAAAAACAACAAAUA SEQ ID NO.2 UAUUUGUUGUUUUUUUGUAGAU SEQ ID NO.23 IL8-H-3 GAGAAUAUCCGAACUUUAA SEQ ID NO.3 UUAAAGUUCGGAUAUUCUCUU SEQ ID NO.24 IL8-H-4 GGAUUUUUUUCUGUUAAAU SEQ ID NO.4 AUUUAACAGAAAAAAAUCCAG SEQ ID NO.25 IL8-H-5 CAUUGAUUGAAUAGUUAUA SEQ ID NO.5 UAUAACUAUUCAAUCAAUGAU SEQ ID NO.26 IL8-H-6 GAUUGAAUAGUUAUAAAGA SEQ ID NO.6 UCUUUAUAACUAUUCAAUCAA SEQ ID NO.27 IL8-H-7 GGUUUUUAGAUUAAACAAA SEQ ID NO.7 UUUGUUUAAUCUAAAAACCCU SEQ ID NO.28 IL8-H-8 GUCAAUAUUAGUAAUUUCU SEQ ID NO.8 AGAAAUUACUAAUAUUGACUG SEQ ID NO.29 IL8-H-9 GAUUCUUAUAAUAUUAUUU SEQ ID NO.9 AAAUAAUAUUAUAAGAAUCUA SEQ ID NO.30 IL8-H-10 CUUAUAAUAUUAUUUUAAAU SEQ ID NO.10 AUUUAAAUAAUAUUAUAAGAA SEQ ID NO.31 IL8-H-11 CUUUAAGAUGUUUUUUAUGU SEQ ID NO.11 ACAUAAAAACAUCUUAAAGUU SEQ ID NO.32 IL8-H-12 GGUUGAAACUUGUUUAUUA SEQ ID NO.12 UAAUAAACAAGUUUCAACCAG SEQ ID NO.33 IL8-H-13 AGAUGUUAUAGUAAAUUUA SEQ ID NO.13 UAAAUUUACUAUAACAUCUUU SEQ ID NO.34 IL8-H-14 GGUUUGCUAGAAUGUGAUA SEQ ID NO.14 UAUCACAUUCUAGCAAACCCA SEQ ID NO.35 IL8-H-15 AGAACAUACUUAUAUGUAA SEQ ID NO.15 UUACAUAUAAGUAUGUUCUGG SEQ ID NO.36 IL8-H-16 GCUAGAAUGUGAUAUUUGA SEQ ID NO.16 UCAAAUAUCACAUUCUAGCAA SEQ ID NO.37 IL8-H-17 ACUUGUUUAUUAUGUACAA SEQ ID NO.17 UUGUACAUAAUAAACAAGUUU SEQ ID NO.38 IL8-H-18 GAACAUACUUAUAUGUAAA SEQ ID NO.18 UUUACAUAUAAGUAUGUUCUG SEQ ID NO.39 IL8-H-19 AGAGAAUAUCCGAACUUUA SEQ ID NO.19 UAAAGUUCGGAUAUUCUCUUG SEQ ID NO.40 IL8-H-20 CAAAUAGAUUCUUAUAAUA SEQ ID NO.20 UAUUAUAAGAAUCUAUUUGUA SEQ ID NO.41 IL8-H-21 GAAUAGUUAUAAAGAUGUU SEQ ID NO.21 AACAUCUUUAUACUAUUCAA SEQ ID NO.42 NC (control) CACUUACGCUGAGUACUUCGA SEQ ID NO.43 UCGAAGUACUCAGCGUAAGUGAU SEQ ID NO.44

[0082] Example 2: A siRNA for inhibiting interleukin-8

[0083] This embodiment provides an siRNA for inhibiting interleukin-8. The siRNA is prepared in accordance with Embodiment 1, wherein the nucleotides at positions 7, 8, and 9 of the sense strand of the siRNA are replaced with fluoro-modified nucleotides, the nucleotides at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are replaced with methoxy-modified nucleotides, and the nucleotides at positions 1 and 2, and between positions 2 and 3 are substituted with thiocyanate. The nucleotides at positions 2, 6, 14, and 16 of the antisense strand of the siRNA are replaced with fluorinated nucleotides, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are replaced with methoxy-modified nucleotides, and the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked via thiophosphate groups, as shown in Table 2.

[0084] Table 2. siRNAs and their sequences that inhibit interleukin-8

[0085] siRNA Name Sense strand (5′ to 3′) Antisense strand (5′ to 3′) IL8-H-1M1 CmsAmsAmUmGmAmAfUfAfGmUmUmUmUmUmCmAmUmUm AmsAfsUmGmAmAfAmAmAmCmUmAmUmUfCmAfUmUmGmsUmsUm IL8-H-2M1 CmsUmsAmCmAmAmAfAfAfAmCmAmAmCmAmAmAmUmAm UmsAfsUmUmUmGfUmUmGmUmUmUmUmUfUmGfUmAmGmsAmsUm IL8-H-3M1 GmsAmsGmAmAmUmAfUfCfCmGmAmAmCmUmUmUmAmAm UmsUfsAmAmAmGfUmUmCmGmGmAmUmAfUmUfCmUmCmsUmsUm IL8-H-4M1 GmsGmsAmUmUmUmUfUfUfUmCmUmGmUmUmAmAmAmUm AmsUfsUmUmAmAfCmAmGmAmAmAmAmAmAfAmAfUmCmCmsAmsGm IL8-H-5M1 CmsAmsUmUmGmAmUfUfGfAmAmUmAmGmUmUmAmUmAm UmsfsUmAmAmCfUmAmUmUmCmAmAmUfCmAfAmUmGmsAmsUm IL8-H-6M1 GmsAmsUmUmGmAmAfUfAfGmUmUmAmUmAmAmAmGmAm UmsCfsUmUmUmAfUmAmAmCmUmAmUmUfCmAfAmUmCmsAmsAm IL8-H-7M1 GmsGmsUmUmUmUmUfAfGfAmUmUmAmAmAmCmAmAmAm UmsUfsUmGmUmUfUmAmAmUmCmUmAmAfAmAfAmCmCmsCmsUm IL8-H-8M1 GmsUmsCmAmAmUmAfUfUfAmGmUmAmAmUmUmUmCmUm AmsGfsAmAmAmUfUmAmCmUmAmAmUmAfUmUfGmAmCmsUmsGm IL8-H-9M1 GmsAmsUmUmCmUmUfAfUfAmAmUmUmUmUmUmUmUm AmsAfsAmUmAmAfUmUmUmUmUmUmAfGmAfAmUmCmsUmsAm IL8-H-10M1 CmsUmsUmAmUmAmAfUfAfUmUmAmAmUmAmAmAmAm AmsUfsUmUmAmAfAmUmAmAmUmAmUmUfAmUfAmAmGmsAmsAm IL8-H-11M1 CmsUmsUmUmAmAmGfAfUfGmUmUmUmUmUmUmUmGmUm AmsCfsAmUmAmAfAmAmAmCmAmUmCmUfUmAfAmAmGmsUmsUm IL8-H-12M1 GmsGmsUmUmGmAmAfAfCfUmUmGmUmUmUmUmUmUm UmsAfsAmUmAmAfAmCmAmAmGmUmUmUfCmAfAmCmCmsAmsGm IL8-H-13M1 AmsGmsAmUmGmUmUfAfUfAmGmUmAmAmAmUmUmUmAm UmsAfsAmAmUmUfUmAmCmUmAmUmAmAfCmAfUmCmUmsUmsUmsUm IL8-H-14M1 GmsGmsUmUmUmGmCfUfAfGmAmAmUmGmUmGmAmUmAm UmsAfsUmCmAmCfAmUmUmCmUmAmGmCfAmAfAmCmCmsCmsAm IL8-H-15M1 AmsGmsAmAmCmAmUfAfCfUmUmAmUmAmUmGmUmAmAm UmsUfsAmCmAmUfAmUmAmAmGmUmAmUfGmUfUmCmUmsGmsGm IL8-H-16M1 GmsCmsUmAmGmAmAfUfGfUmGmAmUmAmUmUmUmGmAm UmsCfsAmAmAmUfAmUmCmAmCmAmUmUfCmUfAmGmCmsAmsAm IL8-H-17M1 AmsCmsUmUmGmUmUfUfAfUmUmAmUmGmUmAmCmAmAm UmsUfsGmUmAmCfAmUmAmAmUmAmAmAfCmAfAmGmUmsUmsUm IL8-H-18M1 GmsAmsAmCmAmUmAfCfUfUmAmUmAmUmGmUmAmAmAm UmsUfsUmAmCmAfUmAmUmAmAmGmUmAfUmGfUmUmCmsUmsGm IL8-H-19M1 AmsGmsAmGmAmAmUfAfUfCmCmGmAmAmCmUmUmUmAm UmsAfsAmAmGmUfUmCmGmGmAmUmAmUfUmCfUmCmUmsUmsGm LL8-H-20M1 CmsAmsAmAmUmAmGfAfUfUmCmUmUmAmUmAmAmUmAm UmsAfsUmUmAmUfAmAmGmAmAmUmCmUfAmUfUmUmGmsUmsAm IL8-H-21M1 GmsAmsAmUmAmGmUfUfAfUmAmAmAmGmAmUmGmUmUm AmsAfsCmAmUmCfUmUmUmAmUmAmAmCfUmAfUmUmCmsAmsAm NC (control) CfsAmsCfUmUfAmCfGmCfUmGfAmGfUmAfCmUfUmCfGmAf UmsCfsGmAfAmGfUmAfCmUfCmAfGmCfGmUfAmAfGmUfGmsAfsUm

[0086] Experimental Example 1: Detection of inhibitory activity of siRNA for inhibiting interleukin-8

[0087] This experimental example provides an inhibitory activity detection experiment of siRNA for inhibiting interleukin-8. The experimental process is as follows:

[0088] Hep3B cells (purchased from the cell bank of the Chinese Academy of Sciences) were inoculated into MEM culture medium (purchased from Gibco, catalog number 11095-080) containing 10% (v / v) fetal bovine serum (FBS, purchased from Hyclone) and 1% (v / v) penicillin-streptomycin mixture (Penicillin-Streptomycin, purchased from Gibco, catalog number 15140122), and cultured in a 5% (v / v) CO2, 37°C cell culture incubator for 48 h; after the culture, the cultured Hep3B cells were digested with trypsin (purchased from GIBCO, catalog number 25200-072); after the digestion, the cells were first rinsed with PBS buffer and then resuspended with MEM culture medium to obtain a cell concentration of 3×10 5 Cell suspension of 100 cells / mL;

[0089] Use opti-MEM (purchased from Gibco, catalog number 31985-070) to dilute different siRNAs respectively to obtain siRNA dilution solutions containing different siRNAs; mix 25 μL of opti-MEM with 0.25 μL of Lipofectamine RNAiMAX transfection reagent (purchased from Thermo Fisher, catalog number 11668-019) to obtain transfection reagent dilution solution; take 25 μL of siRNA dilution solutions containing different siRNAs and mix them with the transfection reagent dilution solution respectively, and let stand at room temperature (25°C) for 15 minutes to obtain transfection solutions containing different siRNAs;

[0090] After the cell suspension was inoculated into a 96-well plate at an inoculation volume of 50 μL / well, a blank control group (BLANK), a transfection reagent control group (MOCK), a negative control group (NC), an IL8-H-1M1 experimental group, an IL8-H-2M1 experimental group, an IL8-H-3M1 experimental group, an IL8-H-4M1 experimental group, an IL8-H-5M1 experimental group, an IL8-H-6M1 experimental group, an IL8-H-7M1 experimental group, an IL8-H-8M1 experimental group, and an IL8-H-9M1 experimental group were set up in the 96-well plate. M1 experimental group, IL8-H-10M1 experimental group, IL8-H-11M1 experimental group, IL8-H-12M1 experimental group, IL8-H-13M1 experimental group, IL8-H-14M1 experimental group, IL8-H-15M1 experimental group, IL8-H-16M1 experimental group, IL8-H-17M1 experimental group, IL8-H-18M1 experimental group, IL8-H-19M1 experimental group, IL8-H-20M1 experimental group and IL8-H-21M1 experimental group, with 4 replicate wells in each group;

[0091] After the setup is completed, 50 μL of transfection solution containing different siRNAs is added to the wells of the experimental groups (the IL8-H-1M1 experimental group is given a transfection solution containing IL8-H-1M1, the IL8-H-2M1 experimental group is given a transfection solution containing IL8-H-2M1, and so on, wherein the final concentration of siRNA in the well is 10 nM), no reagent is added to the wells of the blank control group (BLANK), 50 μL of transfection solution without any siRNA is added to the wells of the transfection reagent control group (MOCK), and 50 μL of transfection solution containing NC is added to the wells of the negative control group (NC) (the final concentration of NC in the well is 10 nM), and the cells are cultured in a 5% (v / v) CO2, 37°C cell culture incubator for 48 h for transfection; after the transfection is completed, the liquid in the wells is discarded, the cells are collected, and the total RNA in the cells is extracted using a magnetic bead method cell total RNA extraction kit (Jima Gene-E31008-96) to obtain an RNA extract;

[0092] According to Table 3, a genomic DNA removal reaction system was configured to remove genomic DNA from the RNA extract to obtain a treated RNA extract (the reaction procedure for removing genomic DNA was: 42°C, 2 min); according to Table 4, a cDNA synthesis reaction system was configured to reverse transcribe the total RNA in the treated RNA extract to obtain a cDNA solution (the conditions for reverse transcription were: 50°C, 15 min; 85°C, 2 min); the cDNA solution was diluted 5 times with enzyme-free water, the diluted cDNA solution was used as a template, and the gene encoding glyceraldehyde-3-phosphate dehydrogenase (HGAPDH gene) was used as an internal reference gene, and an RT-qPCR probe method reaction system was configured according to Table 5 (the primers used in the reaction system are shown in Table 6), and the configured RT-qPCR probe method reaction system was used in Fluorescence quantitative PCR reaction was carried out on 480II (the amplification procedure of the fluorescence quantitative PCR reaction was: 95°C pre-denaturation for 10 min, 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, and the above denaturation, annealing, and extension process was repeated 40 times to obtain a product W containing the amplified target gene IL8 and the internal reference gene GAPDH; the product W was then subjected to an incubation procedure of 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s in sequence, and the real-time fluorescence quantitative PCR instrument collected the melting curves of the target gene IL8 and the internal reference gene GAPDH in the product W respectively), and the Ct values ​​of the test group target gene (IL8 mRNA) and the test group internal reference gene (GAPDH) were obtained; the comparative Ct (ΔΔCt) method was used to perform relative quantitative calculation of the target gene (IL8 mRNA) in each test group, and the calculation results are shown in Table 7;

[0093] The relative quantification method is as follows:

[0094] ΔCt(test group)=Ct(test group target gene)-Ct(test group reference gene);

[0095] ΔCt(control group)=Ct(control group target gene)-Ct(control group internal reference gene);

[0096] ΔΔCt(test group)=ΔCt(test group)-ΔCt(control group average);

[0097] ΔΔCt(control group)=ΔCt(control group)-ΔCt(control group average);

[0098] When calculating, the expression level of IL8 mRNA in the test group was normalized with the transfection reagent control group as the benchmark, and the expression level of IL8 mRNA in the transfection reagent control group was defined as 100%;

[0099] Relative expression level of IL8 mRNA in the test group = 2 -ΔΔCt(测试组) ×100%;

[0100] For the same test group siRNA, the average relative expression level of IL8 mRNA in the test group at each concentration was the arithmetic mean of the relative expression levels of the three culture wells at that concentration;

[0101] The inhibition rate of siRNA on IL8 mRNA expression was calculated according to the following equation: inhibition rate = (1-relative expression level of IL8 mRNA in the test group) × 100%.

[0102] It can be seen from Table 7 that compared with the blank control group (BLANK) and the transfection reagent control group (MOCK), IL8-H-1M1 to IL8-H-21M1 all have inhibitory activity on interleukin-8, among which IL8-H-3M1, IL8-H-8M1, IL8-H-9M1 and IL8-H-19M1 have higher inhibitory activity on interleukin-8.

[0103] Table 3. Genome removal reaction system

[0104] Reagent name Single pore volume (μL) 4×gDNA removal premix / 4×gDNAwiper Mix 4 RNA Extraction Solution 12

[0105] Table 4 cDNA synthesis reaction system

[0106] Reagent name Single pore volume (μL) 5× Reverse Transcription Master Mix / 5×RTMix 4 RNA Extraction Solution 16

[0107] Table 5. RT-qPCR probe method reaction system

[0108] Reagent name Single pore volume (μL) 2× Dye method fluorescence quantitative PCR premix / 2× SYBR Mix 6.5 Upstream primer (10 μM) 0.26 Downstream primer (10 μM) 0.26 <![CDATA[Enzyme-free water / RNase-free ddH2O]]> 0.78 template 5.2 Total volume 13

[0109] Table 6. Primer information

[0110]

[0111] Table 7. Inhibitory effects of different siRNAs (IL8-H-1M1 to IL8-H-21M1) on IL8 mRNA expression levels

[0112] Group IL8 mRNA relative expression level Blank control group 0.72 Transfection reagent control group 1.00 NC 1.20 IL8-H-1M1 experimental group 0.46 IL8-H-2M1 experimental group 0.37 IL8-H-3M1 experimental group 0.22 IL8-H-4M1 experimental group 0.55 IL8-H-5M1 experimental group 0.22 IL8-H-6M1 experimental group 0.33 IL8-H-7M1 experimental group 0.38 IL8-H-8M1 experimental group 0.28 IL8-H-9M1 experimental group 0.27 IL8-H-10M1 experimental group 0.52 IL8-H-11M1 experimental group 0.35 IL8-H-12M1 experimental group 0.33 IL8-H-13M1 experimental group 0.21 IL8-H-14M1 experimental group 0.47 IL8-H-15M1 experimental group 0.37 IL8-H-16M1 experimental group 0.63 IL8-H-17M1 experimental group 0.36 IL8-H-18M1 experimental group 0.43 IL8-H-19M1 experimental group 0.29 IL8-H-20M1 experimental group 0.36 IL8-H-21M1 experimental group 0.41

[0113] Experimental Example 2: Detection of the inhibitory activity of siRNA for inhibiting interleukin-8 at different concentrations This experimental example provides an experiment for detecting the inhibitory activity of siRNA for inhibiting interleukin-8 at different concentrations. The experimental process is as follows:

[0114] On the basis of Experimental Example 1, IL8-H-3M1, IL8-H-8M1, IL8-H-9M1 and IL8-H-19M1 with higher inhibitory activity were selected as research objects. During the experiment, the concentration of siRNA in the wells was replaced from 10nM to 0.1nM, 1nM and 10nM respectively by adjusting the concentration of siRNA after dilution with opti-MEM. The experimental results are shown in Table 8.

[0115] As can be seen from Table 8, compared with the blank control group (BLANK) and the transfection reagent control group (MOCK), IL8-H-3M1, IL8-H-8M1, IL8-H-9M1 and IL8-H-19M1 all have high inhibitory activity against interleukin-8 at concentrations of 0.1 to 10 nM.

[0116] Table 8. Inhibition rate of IL8 mRNA expression level by different siRNAs (IL8-H-3M1 / IL8-H-8M1 / IL8-H-9M1 / IL8-H-19M1) at different concentrations (0.1 nM, 1 nM and 10 nM)

[0117]

[0118] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A siRNA for inhibiting interleukin-8, characterized in that: The siRNA contains a sense strand and an antisense strand; the sense strand and the antisense strand are at least partially reverse-complementary to form a double-stranded region; the sense strand of the siRNA comprises a nucleic acid molecule with a nucleotide sequence as shown in any one of SEQ ID NOs.1 to 7 or SEQ ID NOs.9 to 21; the antisense strand of the siRNA comprises a nucleic acid molecule with a nucleotide sequence as shown in any one of SEQ ID NOs.22 to 28 or SEQ ID NOs.30 to 42.

2. The siRNA according to claim 1, wherein The sense strand of the siRNA comprises a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO.1, and the antisense strand comprises a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO.22; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.2, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.23; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.3, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.24; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.4, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.25; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.5, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.26; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.6, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.27; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.7, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.28; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.9, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.30; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.10, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.31; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.11, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.32; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.12, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.33; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.13, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.34; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.14, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.35; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.15, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.36; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.16, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.37; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.17, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.38; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.18, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.39; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.19, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.40; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.20, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.41; Alternatively, the sense strand of the siRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.21, and the antisense strand comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO.

42.

3. The siRNA according to claim 1 or 2, wherein At least one nucleotide in the sense strand or the antisense strand of the siRNA is a modified nucleotide.

4. The siRNA according to claim 3, characterized in that The modifications include methoxy modification, fluorine modification and / or phosphorothioate linkage.

5. The siRNA according to claim 4, characterized in that The fluorinated modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 7th, 8th, and 9th nucleotides of the sense strand are fluorinated modified nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorinated modified nucleotides; The methoxy-modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 1st, 2nd, 3rd, 4th, 5th, 6th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th nucleotides of the sense strand are methoxy-modified nucleotides, and at least the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th nucleotides of the antisense strand are methoxy-modified nucleotides; The nucleotides linked by the thiophosphate groups are located in the antisense strand and the sense strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 1st and 2nd, and the 2nd and 3rd nucleotides of the sense strand are linked by the thiophosphate groups, and at least the 1st and 2nd, the 2nd and 3rd, the 19th and 20th, and the 20th and 21st nucleotides of the antisense strand are linked by the thiophosphate groups.

6. A recombinant plasmid, characterized in that: The recombinant plasmid expresses the siRNA according to any one of claims 1 to 5.

7. A host cell, characterized in that The genome of the host cell is integrated with the siRNA according to any one of claims 1 to 5; or the host cell carries the recombinant plasmid according to claim 6.

8. Use of the siRNA according to any one of claims 1 to 5, the recombinant plasmid according to claim 6 or the host cell according to claim 7 in the preparation of a drug for preventing and / or treating a disease, characterized in that: The disease is a disease associated with the expression of interleukin-8.

9. An interleukin-8 inhibitor, characterized in that The inhibitor comprises the siRNA according to any one of claims 1 to 5, the recombinant plasmid according to claim 6 and / or the host cell according to claim 7.

10. A drug for preventing and / or treating a disease, characterized in that: The disease is a disease associated with the expression of interleukin-8; the components of the drug include the siRNA according to any one of claims 1 to 5, the recombinant plasmid according to claim 6 and / or the host cell according to claim 7.

Images