Coptotermes formosanus Or-43884 gene and application thereof in prevention and control of termites

Abstract

The invention belongs to the technical field of insect genetic engineering, and particularly relates to a Coptotermes formosanus Or-43884 gene and application of the Coptotermes formosanus Or-43884 gene in control of termites, and the nucleotide sequence of the Coptotermes formosanus Or-43884 gene is shown as SEQ ID NO.1. According to the invention, the odour receptor protein gene Or-43884 of Coptotermes formosanus is found, and through expression of the odour receptor protein gene Or-43884 in Xenopus laevis oocytes and molecular docking analysis of Or-43884 protein, the odour receptor protein gene Or-43884 can be used for detecting the odour receptor protein gene Or-43884. The Or-43884 gene and the expression product of the Or-43884 gene are found to be key odor receptor genes in the process of identifying odor substances for Coptotermes formosanus to trigger nest group cleaning behaviors, and the function of the Or-43884 gene can be matched with a prevention and control method of applying drugs and pathogenic microorganisms for the termites, so that a new way is provided for prevention and control work of the termites.

Description

Technical Field

[0001] The present invention belongs to the technical field of insect genetic engineering, and specifically relates to Formosan termites Or-43884 Genes and their application in termite control. Background Art

[0002] Termites are a group of insects that can feed mainly on wood. Due to their special feeding habits, they can cause serious damage to human wooden buildings (cultural relics, ancient buildings, wooden furniture, etc.). Therefore, in the fields of housing construction and cultural relics protection, termites are a very serious pest, and a large amount of funds are spent every year to prevent and control them. Termites are social insects with fixed nests. It is difficult to completely kill all the individuals in termite nests hidden underground or in wooden structures by only controlling the worker ants that move around in the outside world. Therefore, the current comprehensive prevention and control of termites requires the use of chronic drugs, slow-release drugs or pathogenic microorganisms to carry out comprehensive prevention and control of individuals in termite nests.

[0003] However, as social insects, termites have the behavior of cleaning foreign objects from each other's body surface and quickly removing or burying dead individuals in the nest. This behavior is called the cleaning behavior of termites, which can help termites resist the harmful effects of foreign toxic compounds or microorganisms on termite colonies. Termites often live in a unified nest at a high density. This lifestyle increases the risk of disease or toxic substances spreading within their colonies, thereby enhancing the selection pressure of immunity at the individual and colony level of termites at the evolutionary level. Therefore, in the long-term evolution process, termite colonies have formed social behaviors dominated by cleaning behaviors to avoid the rapid spread of harmful substances within the nest, including self-isolation of infected worker ants, transportation of dead individual corpses (corpse cleaning) and nest cleaning. It can be seen that the above social behaviors can block the further spread of termite control drugs in the nest to a certain extent, reducing the control efficiency. Therefore, targeted means are needed for comprehensive prevention and control. At present, studies have shown that termites' cleaning of the nest is a behavior manipulated by olfactory response, which is affected by the pungent odor of volatile compounds, fatty acid compounds or some toxic compounds released by rotting corpses. Therefore, the detection mechanism of such warning compounds is crucial to maintaining the health of termite colonies, and the mechanistic study of their perception process is of great significance for further understanding the environmental adaptability of such social insects.

[0004] The olfactory information processing process of insects is carried out by olfactory receptor neurons (ORNs), olfactory bulbs, and projection neurons connected to the mushroom bodies of the brain. Among these neuronal components, olfactory receptors (ORs) located on the plasma membrane of ORNs dendrites recognize olfactory signals and conditionally regulate the switching of ligand-gated ion channels, thereby generating action potentials and triggering behavior. Olfactory receptors can detect volatile chemicals, including esters, alcohols, and phenolic compounds, thereby triggering behavior. Olfaction is an important sense in termites. Termites have 50 to 60 olfactory receptors, forming an ORx / ORco (olfactory receptor co-receptor) tetramer complex. The Orco unit controls the switching of ion channels, and the ORx unit controls the recognition process of gas molecules. Through research, it was found that the odor receptor recognition unit can sense volatile compounds such as β-pinene in the nest colony, thereby triggering the nest cleaning behavior of worker ants in the colony. Therefore, if the sense of smell of termites can be interfered with, the cleaning behavior of termites' nests can be further interfered with. Combined with the use of drugs or pathogenic microorganisms targeting termites, green control of termites can be achieved. Summary of the invention

[0005] In view of the need for products or methods for interfering with termite olfactory sense in the prior art, the present invention provides a Formosan termite Or-43884 Genes and their application in preventing and controlling termites, the specific technical solutions are as follows: In a first aspect, the present invention provides a Formosan termite Or-43884 The gene, the nucleotide sequence is shown in SEQ ID NO.1.

[0006] In a second aspect, the present invention provides the Formosan termite Or-43884 protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0007] In a third aspect, the present invention provides a recombinant vector, wherein the recombinant vector comprises Coptotermes Formosanus Or- 43884 Gene, the Formosan termite Or-43884 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0008] In a fourth aspect, the present invention provides a genetically engineered bacterium, wherein the genetically engineered bacterium comprises Coptotermes Formosanus Or- 43884 Gene, the Formosan termite Or-43884 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0009] In a fifth aspect, the present invention provides the above Or-43884 The application of the gene, or the above-mentioned recombinant vector, or the above-mentioned genetically engineered bacteria in the preparation of products for preventing and controlling termites.

[0010] Furthermore, the present invention also provides a gene combination, which comprises Or-43884 Genes and their co-receptors Orco Gene, and application of the combined gene in preventing and controlling termites.

[0011] In the present invention, by using African clawed frog ( Xenopus laevis ) Oocyte in vitro expression Or-43884 Genes and their co-receptors Orco gene, combined with bipolar voltage patch clamp technique, demonstrated Or-43884 The gene's recognition function for odor substances; Or-43884 By interfering with gene expression, we found Or-43884 The loss of the gene causes the Formosan termite ( Coptotermes formosanus ) decreased the antennal potential response to β-pinene and fatty acid odorants, while β-pinene and fatty acid compounds are enriched in termite tissues. The changes in the content of these compounds in termites can help termites judge the physiological status of other individuals in the nest, which proves Or-43884 The role of genes in the olfactory recognition of odor substances has also been confirmed Or-43884 The gene is one of the key odor receptor genes that regulate the nest cleaning behavior of Formosan termites. Or- 43884 The gene and Or-43884 protein can be used as targets in the design and screening of olfactory and behavioral regulators of Formosan termites, and further, Or-43884 The gene and Or-43884 protein can be used as targets in the prevention and control of termites.

[0012] In the control of termites, the odor receptors from the Formosan termites can be Or-43884 The gene is interfered with to affect its odor recognition and downstream ion channel switching function, thereby hindering its odor recognition process, so as to assist the use of other chemical control agents and achieve the effect of preventing and controlling termites.

[0013] Furthermore, the application method is to silence or knock down the termites Or-43884 Genes that reduce termites' olfactory sensitivity to irritating odor molecules and interfere with their cleaning behavior.

[0014] Furthermore, the odor stimulating molecules include β-pinene and fatty acid compounds.

[0015] Furthermore, the irritating odor molecules are volatile compounds that can trigger the cleaning behavior of termites.

[0016] Furthermore, the termite is Formosan termite.

[0017] In a sixth aspect, the present invention provides the formosan termite Or-43884The dsRNA of the gene, the nucleotide sequence of the dsRNA is shown as SEQ ID NO.5.

[0018] In a seventh aspect, the present invention provides a Formosan termite Or-43884 Application of dsRNA of a gene in the preparation of products for preventing and controlling termites.

[0019] In an eighth aspect, the present invention provides a method for controlling termites, comprising: Or-43884 The dsRNA of the gene is introduced into termites, reducing the termites' olfactory sensitivity to irritating odor molecules and interfering with the termites' cleaning behavior.

[0020] Furthermore, the introduction pathways include: (1) Formosan termites Or-43884 The dsRNA of the gene is injected into the termites; Or, (2) Feed termites with Formosan termites Or-43884 dsRNA of the gene.

[0021] Furthermore, the injection is oral injection.

[0022] Furthermore, the termite is Coptotermes Formosanus.

[0023] In the ninth aspect, the present invention provides the use of the above-mentioned Or-43884 protein in identifying odor compounds, wherein the odor compounds are one or more of α-pinene, β-pinene, oleic acid, linoleic acid, cycloeicosane, and American cockroach alcohol (Periplanolide, InChI key: LVSITINFLJGFCE-QPUJVOFHSA-N), Germacren A (GermacrenA, InChI key: XMRKUJJDDKYUHV-SJRHNVSNSA-N), and Supellapyrone (Supellapyrone, InChI key: MXIKDHHQNDZAAJ-VXGBXAGGSA-N) purified from insect tissues.

[0024] Furthermore, the present invention also provides a complex of the Or-43884 protein and its co-receptor Orco protein, and the use of the complex in identifying odor compounds.

[0025] In this application, it is found that Or-43884 protein has recognition function for a variety of odor compounds. Or-43884 Genes and their co-receptors OrcoThe gene was transferred into African clawed frog oocytes for expression, and combined with the bipolar voltage patch clamp technique, it was found that African clawed frog oocytes acquired the ability to respond to α-pinene and β-pinene as well as long-chain unsaturated fatty acids C18:1 and C18:2. Molecular docking analysis of the Or-43884 protein found that the unsaturated fatty acid C18:1 had the strongest binding affinity with the Or-43884 protein. Other compounds, including cycloeicosane, periplanolide, germacren A, and supellapyrone, also had strong binding affinity with the Or-43884 protein. In addition, the in vivo Or-43884 The antennal potential response value of the gene-silenced Formosan termites to the unsaturated fatty acid C18:1 is significantly lower than that of the wild-type Formosan termites, which also indirectly proves the recognition function of Or-43884 protein for odor compounds. This recognition function of Or-43884 protein makes Or-43884 protein applicable to compound detection, or in the preparation of products for detection or treatment of olfactory-related diseases, or in the fields of pest trapping and detection.

[0026] Compared with the prior art, the present invention has the following beneficial effects: The present invention discovered an odor receptor protein gene of Formosan termites Or-43884 Gene, through its expression in African clawed frog oocytes, and molecular docking analysis of Or-43884 protein, found Or-43884 The gene and its expression product are key odor receptor genes for the process in which Formosan termites recognize odor substances to trigger nest cleaning behavior. Or-43884 This function of the gene can be combined with the application of drugs and pathogenic microorganisms against termites, providing a new approach for termite prevention and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The representative potential response curves of membrane current recorded by two-electrode voltage clamp in African Xenopus oocytes; A and B are African Xenopus oocytes expressing Or-43884 protein, and C and D are untreated oocytes; A and C represent the electrophysiological responses of oocytes to α-pinene, β-pinene, linoleic acid, and oleic acid, and B and D represent the electrophysiological responses of oocytes to linolenic acid, leaf alcohol, geraniol, and DEET.

[0028] Figure 2 Statistical diagram of the mean values ​​of the maximum chemically induced currents produced by Xenopus oocytes expressing Or-43884 protein in response to different substances.

[0029] Figure 3Mean statistical plot of the maximum membrane current induced by oleic acid in Xenopus oocytes expressing Or-43884 protein.

[0030] Figure 4 In the body of the Formosan termite Or-43884 Schematic diagram of gene interference efficiency, ds GFP It is the negative control group.

[0031] Figure 5 Schematic diagram of the antennal potential response of the antennae of Formosan termites to different types of fatty acids and their derivatives; A is the antennal potential response result of the wild-type Formosan termites, B is the antennal potential response value of the wild-type Formosan termites, paraffin oil is used as a negative control, phenol (Phenol) and indole (Indole) are used as positive controls; fatty acids and their derivatives include lauric acid (C12:0), myristic acid (C14:0), palmitic acid (C16:0), palmitoleic acid (C16:1), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2) and linolenic acid (C18:3).

[0032] Figure 6 for Or-43884 Schematic diagram of the antennal potential response of the Formosan termite antennae whose genes are inhibited by double-stranded RNA to different types of fatty acids and their derivatives; A is Or-43884 The antennal potential response of the Formosan termite whose gene was inhibited by double-stranded RNA. B is RNA interference Or-43884 The antennal potential response values ​​of the Formosan termites after gene expression, paraffin oil was used as a negative control, and phenol (Phenol) and indole (Indole) were used as positive controls; fatty acids and their derivatives include lauric acid (C12:0), myristic acid (C14:0), palmitic acid (C16:0), palmitoleic acid (C16:1), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2) and linolenic acid (C18:3).

[0033] Figure 7 A diagram of a 3D printed device used to detect and analyze the cleaning behavior of Formosan termites. The dead termites are placed inside eight holes on the disc of the device, and the termites can use the soil in the device to cover the dead termites inside the holes or move the dead termites.

[0034] Figure 8 for Or-43884 Schematic diagram of the comparison of the nest cleaning behavior of termites after gene interference; Control represents the control group of termites, ds Or-43884 express Or-43884 Termites with disrupted genes.

[0035] Fig. 9Schematic diagram of the three-dimensional structure of the OrCo-Or-43884 complex (A) and the molecular docking prediction results of the key binding sites of the Or-43884 receptor and its ligand compound (B); among them, pLDDT (Predicted Local Model Decay Time) represents the prediction confidence of the protein 3D structure, and C is the binding site map of the ligand compound and each amino acid of Or-43884.

[0036] Fig.10 The molecular docking prediction results of the binding affinity between Or-43884 protein and related hormonal chemicals of different termite species. DETAILED DESCRIPTION

[0037] In order to make those skilled in the art better understand the scheme of the present invention, the technical scheme of the present invention is clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed descriptions are all exemplary and are only embodiments of a part of the present invention, rather than all embodiments.

[0038] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work should fall within the scope of protection of the present invention.

[0039] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those of ordinary skill in the art to which this application belongs. The experimental materials used in the examples of the present invention are all conventional experimental materials in the art and can be purchased through commercial channels. Experimental methods without specifying detailed conditions were performed according to conventional experimental methods or according to the operating instructions recommended by the supplier.

[0040] The Formosan termites used in the present invention are mature colonies collected from Ningbo, Jiaxing and Hangzhou, Zhejiang Province, China, and cultured in a dark environment at 27° C. and 75% humidity with pine wood blocks as a food source.

[0041] Or-43884 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the Or-43884 protein is shown in SEQ ID NO.2. Orco The nucleotide sequence of the gene is shown in SEQ ID NO.3, and the amino acid sequence of the Orco protein is shown in SEQ ID NO.4.

[0042] SEQ ID NO.1:

[0043] SEQ ID NO.2: MVFGLLQASKNNPQEESTSKKILDLQMKCFVVGGIRPSENIRSSSRKLAAFNFYAAMTVIIYIPSLVGQAAAVYLESDDVAELTAIAFPAIAGYLHFLISSYLLLNRKPLEQIILRTEESFEECRCRLPLTREHNLIIDEAKKKIRKFSWIFMITNAVTWFLWMSLPLVFRLNHYMNKQGSWAQNITETDDKIQWDYVCYKMWLPRVIYQEPYYYFVWAYQAFLIGILLVDNTAYNSTYYALTIFTAAHFKVVANLIDDIDRYIMAPYSTNNPEQSSIWYDTKNENLLQEGKSFVKQKILKNSGFSRSGNNDDETSQLDEYRLLIPEGITAEDYLVNCIKYHQALLRYVEDVDGVFSNLLFIFFSLNGALMCITVFQATVGSGETGSFKFLGAMITVWVPIFLICWFGELLTEQSEAVERAIYACKWFNASQRFKKYVQFVIMRSQKVVRLSAGHFFAVSLEGFANMANTVYAYYTILMQAQE SEQ ID NO.3: SEQ ID NO.4: MYKFRLHGLVADMWPLIRVMQMTGFFLLDYHEDMSFGWASIRAGYATSVSCIMVIQFLLLFINLMKQAGDVNDLTANTITVLFFLHSVTKFFYFAIRRAKFYRTLATWNNANSHPLFSENQSRHHATAVSSMRRLVMYVGIGIIVSGIAWTGITFVGDSVHGIRDPDNRNETIFEEVPRLMLRSWYPWNALSGGGYVVSFIIQIIWLFLALSHAMMMDTMFCCWLIYTCEQLIHLKEIMKPLMELSASLDTVVPHSADLFRAVSATTNAPITSGDGEGIRAIYSNQHDFSNFRLNTGTLANVNSGSVGPNGLTKKQELLVRSAIKYWVERHKHVVRFVSNIGDTYGSALLLHMLTSTVTLTLLAYQATKIDTVNVYACTVIGYLVYTLAQVFLFCFFGNRLIEESSSVMEAAYSCQWYDGSEEAKTFIQIVCQQCQKAMSISGAKFFTVSLDLFASVLGAVVTYFMVLVQLN SEQ ID NO.5: TTGATGGCGTCTTCAGCAACCTCCTGTTCATATTCTTCTCTCTGAATGGGGCCCTCATGTGTATTACAGTGTTTCAGGCAACAGTGGGCTCTGGAGAGACGGGTTCTTTCAAATTCCTGGGCGCCATGATTACTGTTTGGGTTCCAATATTCCTTATCTGCTGGTTCGGAGAGCTTCTGACAGAGCAGAGCGAAGCCGTGGAACGAGCAATATATGCATGCAAATGGTTCAACGCTTCCCAGCGCTTCAAGAAATACGTACAGTTCGTTATCATGCGGTCTCAGAAAGTTGTGCGGCTGTCAGCAGGACACTTCTTTGCTGTATCTCTGGAAGGATTTGCTAACATGGCCAATACTGTTTACGCCTACTACACAATCCTGATGCAAGCCCAG。

[0044] Example 1 Or-43884 Cloning of the gene Or-43884 The genes were screened through transcriptome analysis of Formosan termites tissues.

[0045] Total RNA from Formosan termites was extracted by TRIzol method and reverse transcribed into cDNA template using HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). The operation procedure was referred to the kit manual. Primers were designed to connect SpeⅠ and PstⅠ restriction sites for Or-43884 gene: Or-43884-F-bd (5'-GGACTAGTGCCACCTTACTCCTGGGCTTGCATCAG-3'), Or-43884-R-bd (5'-GCTCTAGACATTGCACCCGGATTACGTTT-3').

[0046] The Or-43884 gene was amplified using the reverse transcribed cDNA as a template, and the amplified product was purified. The purified product and the expression vector pT7Ts were double-digested with restriction endonucleases, ligated with T4 ligase, and transformed into competent E. coli cells. The reaction system is as follows: Table 1 Reaction system for cloning Or-43884 gene

[0047] After ligation and transformation, the plates were coated with bacteria and cultured overnight. After that, the bacteria were picked to extract DNA and then subjected to first-generation Sanger sequencing. The bacterial solution with correct sequencing was used to extract plasmids according to the instructions of FastPure Plasmid Mini Kit-BOX 2 (Nanjing Novozyme Biotechnology Co., Ltd.).

[0048] The open reading frame of the Or-43884 gene of Coptotermes formosanus is composed of 1452 nucleotides, encoding 483 amino acids. The molecular weight of Or-43884 is 55.75 KDa, the isoelectric point is 6.15, and the instability coefficient is 40.73.

[0049] Example 2 Or-43884 Genes that recognize different odors (1) Or-43884 Gene transcription in vitro and microinjection into Xenopus laevis oocytes For injection into oocytes Or-43884 Genes and OrcocRNA of the gene was synthesized by linearizing the pT7Ts vector with SmaI and using the mMACHINE T7 kit according to the manufacturer's instructions. To collect Xenopus laevis oocytes at stages V and VI, frogs were first anesthetized with ethyl 3-aminobenzoate and then dissected. Fresh oocytes were washed three times with buffer (88 mM NaCl, 3 mM KCl, and 5 mM HEPES, pH 7.60) and then incubated in a wash buffer containing 2 mg / mL collagenase S-1 for 2 hours. Defollicled oocytes were washed and kept in a wash buffer containing 50 μg / mL gentamicin and 500 μM calcium chloride and incubated at 16°C for 24 hours.

[0050] (2) Two-electrode voltage clamp technique to record expression Or-43884 Gene expression in Xenopus laevis oocytes in response to odorants Healthy oocytes were selected and each oocyte was injected with 27.6 nL of Or-43884 : ORco cRNA mixture (1:1). The current of oocytes was measured at a resting potential of −20 mV by a two-microelectrode voltage clamp apparatus (OC-725D, Warner Instrument, Hamden, USA). The peak current was limited between 0.02 A and 0.05 A. Chemicals were dissolved in DMSO with a final DMSO concentration of 0.1%. The electrophysiological recording data were analyzed by the pCLAMP 6 software interface (Axon Instruments Inc., Foster City, USA). For each chemical, the current and voltage curves were calculated by averaging the signal within a 30 ms window after the transient decayed to the steady state (e.g. Figure 1 The results of two-electrode voltage clamp recording showed that untreated control Xenopus oocytes had no response to all the tested compounds, while Xenopus oocytes injected with the Or-43884 gene and its co-receptor Orco gene produced electrophysiological responses to α-pinene and β-pinene (termite alarm pheromones) and long-chain unsaturated fatty acids C18:1 (oleic acid) and C18:2 (linoleic acid), with response values ​​of about 20-30 nA (e.g. Figure 2 Then, the response of Xenopus oocytes co-expressing the Or-43884 / ORco gene to different concentrations of odorants was tested. -5 Long-chain unsaturated fatty acids at M concentrations can induce co-expression Or-43884 / ORco The electrophysiological response of the gene in Xenopus oocytes increased with increasing concentration (e.g. Figure 3 as shown).

[0051] Example 3 Determination of the odor recognition function of the Or-43884 gene using gene interference technology (RNAi) and electroantennogram technology (1) Or-43884 Gene interference Use the NCBI website (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) to design forward and reverse primers containing the T7 RNA polymerase promoter: Or-43884-F (5'-TAATACGACTCACTATAGGGCTGGGCTTGCATCAGGATTG-3'), Or-43884-R (5'-TAATACGACTCACTATAGGGTTGATGGCGTCTTCAGCAAC-3').

[0052] by Or-43884 The PCR fragment amplified from the gene open reading frame was used as a template and amplified and synthesized using the T7 High Yield transcription kit (Vazyme, China). Or-43884 Gene double-stranded RNA (dsRNA).

[0053] Double-stranded RNA of the jellyfish green fluorescent protein gene (dsGFP) was selected as a control. RNAi treatment was performed by oral injection. Ice-anesthetized termites were placed upside down on the surface and injected with approximately 200 ng of dsRNA. RNAi-treated termites were collected 24 h, 48 h, and 72 h after treatment.

[0054] (2) After genetic interference in Formosan termites, the Or-43884 The results showed that the average inhibition rate of gene expression in the interference group termites reached 53.3% (N = 6, such as Figure 4 As shown in Figure ), it can be seen that the double-stranded RNA sequence injected orally successfully inhibited Or-43884 Expression levels in the antennae of Formosan termites.

[0055] (3) Or-43884 Changes in antennal potential responses of Coptotermes formosanus before and after gene silencing Feeding Or-43884Formosan termites with dsRNA gene were subjected to antennal potential (EAG) measurement analysis by Syntech EAG 2000 program. The head of the worker ant was removed on ice, and the tip of one antenna was inserted into a glass capillary electrode filled with 0.7% NaCl solution. The antenna was positioned between the two electrodes in the center of the main airflow for stimulation. To measure the EAG response of the antenna, a piece of filter paper (3.5 × 1.5 cm, Whatman) was rinsed with the test chemical (10% v / v dissolved in paraffin oil) and used as an odor stimulus. Each EAG response was tested three times, and the peak height of depolarization was recorded for each chemical in millivolts. Workers treated with dsGFP and paraffin oil served as a control group.

[0056] The antennal potential results showed that Or-43884 The antennal potential response value of gene-silenced Formosan termites to unsaturated fatty acid C18:1 was significantly lower than that of wild-type Formosan termites and GFP gene-silenced Formosan termites (such as Figure 5 and Figure 6 as shown).

[0057] (4) Verification of using RNAi technology to treat worker ants Or-43884 Do genes play a regulatory role in nest cleaning? The nest cleaning behavior of termites was measured in a 3D printed device with eight 5 mm holes (e.g. Figure 7 As shown). The bottom of these holes is filled with five layers of cotton yarn to maintain humidity. Dead termites are placed in each hole, and then 200 apparently healthy worker termites are transferred to the device and allowed to move inside the device for 24 hours. The soil accumulated on the cotton yarn is then carefully collected and weighed, and the weight of the soil inside the cavity is used to assess the extent of the termite colony cleaning behavior. If there is a lot of soil in the hole, the surface termite colony has moved a lot of soil into the cavity, and the colony cleaning behavior is strong. On the contrary, it means that the colony cleaning behavior is weak.

[0058] The results are as follows Figure 8 As shown, Or-43884 In the gene-interfered Formosan termite treatment group, the weight of the soil inside the device cavity was significantly lower than that in the control group. Or-43884 The defect in gene function results in the inhibition of termites' nest-cleaning behavior.

[0059] Example 4 Protein modeling and molecular docking analysis The 3D protein model of Or-43884 protein was generated using AlphaFold2 ColabFold v1.5.276 (https: / / github.com / sokrypton / ColabFold). Molecular docking experiments were performed using Autodock Vina Tool (ADT) 1.5.6 and PyMOLv2.5. The 3D models of chemical ligands were downloaded from PubChem database or generated using MolView (https: / / molview.org / ). Prior to docking, all chemical ligands were energy minimized using the molecular mechanics (MM2) method, and the Or-43884 protein was optimized by removing potential water molecules in PyMOL software. After adding all hydrogen atoms and Kollman and Gasteiger charges to the Or-43884 protein, the molecular docking process was performed. The binding geometry of the Or-43884 protein and the selected chemical ligands was visualized by PyMOL (see Figure 2). Fig. 9 as shown).

[0060] Molecular docking results showed that among all the compounds tested, unsaturated fatty acid C18:1 had a strong binding affinity with Or-43884 protein (-7.00 kal / mol); compared with other long-chain alkanes, cycloeicosane was the most active ligand molecule for CforOR2 (-8.4 kal / mol). Pheromones that are attractive to cockroaches, such as Periplanolide, Germacren A, and Supellapyrone, also showed a strong binding affinity with Or-43884 protein (<-7.0 kal / mol) (e.g. Fig.10 The 3D structure of the protein shows that Or-43884 is a protein with seven α-helices. Gas compounds can bind to Or-43884 in its interhelical region, where amino acids Asn-232 and Asn-367 are the main binding sites for the ligand (e.g. Fig. 9 as shown).

Claims

1. Formosan termite gene Or-43884 , characterized in that, Said Or-43884 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The Or-43884 protein of Formosan termites, characterized in that: The amino acid sequence of the Or-43884 protein is shown in SEQ ID NO.

2.

3. A recombinant vector, characterized in that: The recombinant vector comprises the Or-43884 Gene.

4. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria comprises the Or-43884 Gene.

5. The method according to claim 1 Or-43884 The gene, or the recombinant vector as claimed in claim 3, or the genetically engineered bacteria as claimed in claim 4, in the preparation of products for controlling termites.

6. The Formosan termite according to claim 1 Or-43884 A dsRNA of a gene, characterized in that The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

5.

7. Use of the dsRNA according to claim 6 in preparing a product for controlling termites.

8. A method for preventing and controlling termites, characterized in that: include: Coptotermes formosanus Or-43884 The dsRNA of the gene is introduced into termites, reducing the termites' olfactory sensitivity to irritating odor molecules and interfering with the termites' cleaning behavior.

9. The method according to claim 8, characterized in that The introduction pathways include: (1) Formosan termites Or-43884 The dsRNA of the gene is injected into the termites; Or, (2) Feed termites with Formosan termites Or-43884 dsRNA of the gene.

10. The use of the Or-43884 protein in identifying odor compounds as claimed in claim 2, characterized in that: The odor compound is one or more of α-pinene, β-pinene, oleic acid, linoleic acid, cycloeicosane, American cockroach alcohol, germacene A, and superapiridone.

Images