Millet methylated transferase gene SiMTA1 and application thereof

Abstract

The invention provides a millet methylated transferase gene SiMTA1 and application thereof, the millet SiMTA1 gene is obtained through homologous sequence alignment, the full length of a DNA sequence of the gene is 4239 bp, a CDS sequence is 2121 bp, and 706 amino acid residues are encoded. The SiMTA1 gene coding protein has an MT-A70 structural domain, and secondary structure prediction shows that the protein is mainly composed of irregular curls and alpha-helixes; the SiMTA1 gene promoter comprises a plurality of stress and plant hormone signal response elements. The invention further researches the characteristics of the millet methylated transferase gene SiMTA1 promoter and the response mode of the millet methylated transferase gene SiMTA1 promoter under stress and plant hormones, which show that salt, drought, auxin, cytokinin and the like can induce SiMTA1 expression, and SiMTA1 can participate in the millet stress and plant hormone response process and play a role. The invention provides a theoretical basis and candidate gene resources for subsequent improvement of stress-tolerant varieties of foxtail millet and cultivation of new varieties.

Description

Technical Field

[0001] The present application belongs to the technical field of millet gene stress resistance breeding and development, and specifically relates to a gene related to millet methylation modification - millet methyltransferase gene SiMTA1 and its application. Background Art

[0002] Millet (Setaria italica L.), also known as foxtail millet, is called millet after shelling. Botanically, it belongs to the genus Setaria of the Gramineae family. It is an annual grain crop of the Gramineae family that originated in the Yellow River Basin of my country. Millet has a long history of cultivation and was once a traditional dominant and staple crop in my country. It has strong drought and barrenness resistance. It is still one of the main grain crops in northern dryland ecological agricultural areas such as Shanxi, Hebei, Inner Mongolia, and Shandong. It plays an important role in food security and industrial revitalization in northern my country. The millet genome is diploid, has a C4 photosynthetic pathway, self-pollination, a high reproduction coefficient, and a short growth cycle. Not only has the whole genome been sequenced, but also the pan-genome and T2T genome assembly have been completed. The genetic background is clear, and it is a good model system for drought and stress resistance research. Millet is rich in nutrition and has balanced ingredients. Its edible crude fiber content is five times that of rice. It is a food crop with both nutritional and health functions. Therefore, the development of the millet industry plays an important role in improving people's dietary structure and promoting scientific and technological progress in the seed industry. It is also possible that it will be developed from a coarse grain crop to a staple food crop as people's needs change. At the same time, the crude protein content of millet straw is about 8%, and the crude protein content of forage millet straw is more than 15%. It is the highest quality forage in the Gramineae family and also plays an important role in the development of animal husbandry.

[0003] At present, the genome sequencing of millet has been completed, but the epigenetic research of millet is still in its early stages. The study of gene expression patterns in response to abiotic stress and plant hormones can provide a basis and clues for subsequent research on gene functions. It not only helps to reveal the stress tolerance response of millet and its epigenetic modification mechanism under stress, but also has important guiding significance for improving and breeding stress-resistant millet varieties.

[0004] m 6 A(N 6 -methyladenosine (6-methyladenosine) is the most common post-transcriptional modification of eukaryotic mRNA and an important form of RNA epigenetics, accounting for 80% of RNA methylation modification. 6 A modification is the N-terminal modification of adenosine (A) bases in RNA molecules, especially mRNA. 6 A chemical modification in which a methyl group (-CH3) is added to the position of the m 6A methylation modification is a dynamic reversible process catalyzed by a specific methyltransferase complex. The methyltransferase complex mainly includes three types of enzymes: writers (methyltransferases, such as METTL3 and METTL14), erasers (demethylases, such as FTO and ALKBH5), and readers (recognition proteins, such as YTH domain proteins and IGF2BP family proteins). The main mechanism of action is: methyltransferases are responsible for adding methyl groups to RNA molecules to form m 6 A modification; demethylase is responsible for removing m 6 A modification, maintaining the dynamic balance of modification; recognition protein can recognize and bind m 6 A modification, thereby regulating RNA stability, splicing, translation, nuclear export and other processes. Several key m 6 A methyltransferase, including MTA (Methyltransferase A), MTB (Methyltransferase B), FIP37 (FKBP12 interacting protein 37KD) and VIR (Virilizers). Among them, MTA is one of the earliest methyltransferases discovered in Arabidopsis, with m 6 A catalytic activity and together with FIP37 constitute the plant m 6 A core component of the A methyltransferase complex, which plays a key role in regulating shoot and root growth as well as leaf and flower development.

[0005] According to existing research, it is speculated that methylation modification-related genes in millet may play a role in regulating its growth and development. Therefore, studying methylation modification-related genes in millet is of great significance for millet molecular breeding, variety improvement, and breeding of stress-resistant millet varieties. Summary of the invention

[0006] The purpose of this application is to provide a millet methyltransferase gene and study its basic characteristics, so as to lay a certain theoretical foundation for the molecular breeding of millet stress resistance.

[0007] The technical solution of this application is described in detail as follows.

[0008] A millet methyltransferase gene SiMTA1 has a DNA nucleotide sequence as shown in SEQ ID NO.1, a full length of 4239 bp, including 7 exons and 6 introns; a CDS base sequence as shown in SEQ ID NO.2, a full length of 2121 bp.

[0009] Analysis of the nucleotide sequence of the foxtail millet SiMTA1 gene revealed that the gene encodes 706 amino acids (the sequence is shown in SEQID NO.3), with an isoelectric point of 6.50, 83 positively charged residues (Arg+Lys), 87 negatively charged residues (Asp+Glu), and an instability coefficient of 54.64, indicating that it is an unstable protein. Prediction of the protein domains encoded by the SiMTA1 gene revealed that the protein sequence has 7 low-complexity regions, and contains an MT-A70 domain between the 490th and 650th amino acids, which can perform the function of a methyltransferase by binding to S-adenosylmethionine (SAM).

[0010] Analysis of the cis-acting elements of the forward and antisense chains of the promoter region of the foxtail millet SiMTA1 gene (SiMTA1-P) showed that it contained a variety of classic stress response and hormone regulatory elements, which are related to the plant's drought, low temperature, high salt stress response or hormone signal transduction.

[0011] Through the study of the basic characteristics of millet SiMTA1 gene, it was found that in millet, SiMTA1 gene regulates m 6 A methylation modification plays an important role in plant stress response. Its mechanism includes dynamic regulation of m 6 A modification level, regulation of ABA signaling pathways and integration of multi-signal networks, thereby enhancing plant stress resistance.

[0012] Therefore, further, the present invention also provides a gene editing vector containing the SiMTA1 gene. The gene editing vector is a pC1300-UBI:Cas9-SiMTA1 expression vector.

[0013] The gene editing vector construction method is as follows: according to the gene sequence of millet SiMTA1, two target sites are selected before the PAM sequence (AGG). The sticky end linker GGCA of the Aar I restriction endonuclease is added before the 5' end of the two target sites respectively, and the two selected target sequences are reversely complemented and the sticky end linker AAAC of the Aar I restriction endonuclease is also added to the 5' end. After the two pairs of sequences with linkers are synthesized, they are connected with the sgRNA after Aar I digestion using T4 DNA ligase, and after DH5α transformation, the positive plasmid and the Cas9 final vector are selected to construct the pC1300-UBI:Cas9-SiMTA1 expression vector.

[0014] The present invention also provides the use of the millet methyltransferase gene SiMTA1 in millet salt tolerance and / or drought tolerance, and the use of the millet methyltransferase gene SiMTA1 in creating salt-tolerant millet and / or drought-tolerant millet.

[0015] The present invention also provides the use of the gene editing vector in the salt tolerance and / or drought tolerance of millet; and the use of the gene editing vector in creating salt-tolerant millet and / or drought-tolerant millet.

[0016] The present invention shows that the SiMTA1 gene in millet is an RNA methyltransferase by sequence alignment and structural analysis. Analysis of the SiMTA1 promoter SiMTA1-P cis-acting element shows that it contains a variety of stress and hormone signal response elements, and its downstream gene SiMTA1 may be involved in related biological processes. The present invention further studies the response pattern of the millet methyltransferase gene SiMTA1 under adversity and plant hormones, showing that salt, drought, auxin, cytokinin, etc. can induce SiMTA1 expression, especially under salt stress and auxin hormone treatment, its induced expression degree is high. Further analysis of the phenotype and biomass of SiMTA1 gene-edited plants can be predicted: the gene in the millet plant introduced with the SiMTA1 gene expression vector may show positive regulation in response to salt, drought, and low temperature, which can enhance the plant's salt resistance, drought resistance, and cold resistance.

[0017] The millet methyltransferase gene SiMTA1 of the present invention and its application not only contribute to a deep understanding of the molecular response mechanism of millet to adversity, but also provide a theoretical basis and candidate gene resources for the subsequent improvement of millet stress-resistant varieties and breeding of new varieties, and have important research and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the PCR gel electrophoresis diagram of SiMTA1 gene.

[0019] Figure 2 Prediction of SiMTA1 protein domains.

[0020] Figure 3 Prediction of the secondary structure of SiMTA1 protein.

[0021] Figure 4 Prediction of the tertiary structure of SiMTA1 protein.

[0022] Figure 5 Schematic diagram of the distribution of cis-acting elements in the positive chain of the promoter SiMTA1-P.

[0023] Figure 6 Relative expression levels of SiMTA1 under different abiotic stress treatments. A. Relative expression level of SiMTA1 under salt stress; B. Relative expression level of SiMTA1 under drought stress; C. Relative expression level of SiMTA1 under 4°C stress. Different lowercase letters indicate significant differences (P<0.05).

[0024] Figure 7Relative expression of SiMTA1 under different hormone treatments. A. Relative expression of SiMTA1 under IAA treatment; B. Relative expression of SiMTA1 under 6-BA treatment; C. Relative expression of SiMTA1 under GA3 treatment; D. Relative expression of SiMTA1 under ACC treatment; E. Relative expression of SiMTA1 under NAA treatment. Different lowercase letters indicate significant differences (P<0.05).

[0025] Figure 8 Identification of SiMTA1 edited plants. A. SiMTA1 gene-edited plants amplify Cas9; B. SiMTA1 gene-edited plants amplify hygromycin fragments; C. SiMTA1 gene-edited plants amplify fragments near the target site; D. Target site editing of gene-edited homozygotes. 1-10 are different gene-edited strains, WT is unedited Ci846, and GEP is a gene-edited homozygote. Specific implementation methods

[0027] Example 1. Acquisition and cloning of the sequence of millet RNA methyltransferase gene SiMTA1

[0028] 1.1 Materials and methods

[0029] According to the reported RNA methyltransferase protein sequence in Arabidopsis, the homologous protein sequence was retrieved in the foxtail millet genome database using gprofiler, Phytozome and other websites. It was further compared with the known methyltransferase sequences through the Arabidopsis TAIR website, and the sequence with the highest matching degree was selected as the gene target sequence of foxtail millet RNA methyltransferase SiMTA1, named SiMTA1.

[0030] Based on the above nucleotide sequence of SiMTA1, a pair of full-length primers were designed.

[0031] SiMTA1-F: GCAACACTAGCTCGATCCAAAACCC (SEQ ID NO.4);

[0032] SiMTA1-R: CAAATTTCCAACGGAAACAAATTACTGCCC (SEQ ID NO.5)

[0033] The target gene was amplified using DNA extracted from millet leaves as a template to obtain specific products of consistent size.

[0034] PCR reaction system (20 μL): SiMTA1-F (10 μM) 1 μL, SiMTA1-R (10 μM) 1 μL, DNA template (50 ng / ul) 1 μL, 2×SuperNova PCR Mix (Dye) 10 μL, Sterile Water 7 μL. PCR amplification conditions: first 98°C for 3 min; then 98°C for 15 s, 55°C for 15 s, 72°C for 4 min for 30 cycles; finally 72°C for 10 min.

[0035] After the PCR product is recovered and purified, it is connected to the cloning vector pEasy Blunt3, and then transformed into Trans 5α competent cells. The bacteria are spread on LB solid medium containing ampicillin (Amp) for culture. Single colonies are picked for PCR identification, positive colonies are sequenced and analyzed, and single colonies with correct sequencing results are selected and saved for later use.

[0036] 1.2 Results

[0037] Figure 1 The PCR gel electrophoresis of SiMTA1 gene showed that the present invention cloned a SiMTA1 gene related to methylation modification of foxtail millet. The sequencing results showed that the full length of the DNA nucleotide sequence of the gene was 4239 bp, and the sequence was shown in SEQ ID NO.1.

[0038] Example 2: Study on the basic characteristics of millet SiMTA1 gene

[0039] 2.1 Bioinformatics analysis of foxtail millet methyltransferase gene SiMTA1

[0040] The ExPASy website was used to obtain basic information such as the isoelectric point and instability coefficient of the SiMTA1 protein. The online website SMART was used to predict the structural region of the protein. The online tool SignalP-5.0 was used to analyze the protein signal peptide sequence. The transmembrane domain of the protein was analyzed using the TMHMM-2.0 website. The secondary structure of the protein was predicted using the SOPMA website, and the tertiary structure of the protein was predicted using the SWISS MODEL website.

[0041] The DNA sequence of the foxtail millet methyltransferase gene SiMTA1 is 4239 bp in length, including 7 exons, 6 introns, and a CDS length of 2121 bp. The CDS base sequence is shown in SEQ ID NO.2. Analysis of the SiMTA1 nucleotide sequence showed that the gene encodes 706 amino acids (the sequence is shown in SEQ ID NO.3), with an isoelectric point of 6.50, 83 positively charged residues (Arg+Lys), 87 negatively charged residues (Asp+Glu), and an instability coefficient of 54.64, indicating that it is an unstable protein. The protein domain encoded by the SiMTA1 gene was predicted, and the results showed that ( Figure 2 ), the protein sequence has 7 low-complexity regions, including an MT-A70 domain between amino acids 490 and 650, which can perform the function of a methyltransferase by binding to S-adenosylmethionine (SAM).

[0042] Analysis of the signal peptide and transmembrane structure of SiMTA1 protein showed that the probability of containing a signal peptide was 0.0008, indicating that the protein did not contain a signal peptide sequence; at the same time, the sequence did not contain a transmembrane domain, indicating that the protein was an intracellular protein. Analysis of the secondary structure of SiMTA1 protein showed that ( Figure 3 ), the protein is mainly composed of random coil (64.02%), alpha helix (29.89%) and extended strand (6.09%). Modeling of the three-dimensional structure of SiMTA1 protein ( Figure 4 ), also showed structural features similar to the predicted secondary structure, providing clues for the next step of analyzing protein stability and function.

[0043] 2.2 Analysis of cis-acting elements in the promoter of foxtail millet methyltransferase gene SiMTA1

[0044] According to the CDS sequence of foxtail millet methyltransferase SiMTA1, the sequence of about 2000bp upstream of the gene was obtained from websites such as Phytozome as the gene promoter region, named SiMTA1-P. The cis-acting elements contained in the promoter were searched using the Plant CARE database, and the data were analyzed and mapped using TBtools, Ai and other software.

[0045] The promoter region of the gene (SiMTA1-P) was predicted and analyzed. The prediction results of the cis-acting elements contained in the positive strand of the promoter SiMTA1-P are as follows: Figure 5, containing a total of 15 elements, most of which are located in the first half of the sense strand. Analysis of the cis-acting elements of the forward and antisense strands of the promoter SiMTA1-P showed (Table 1) that it contains a variety of classic stress response and hormone regulatory elements, which are specific nucleotide sequences in the DNA sequence. Among them, ABRE, DRE and LTR are typical stress response elements. Genes containing the ABRE motif are usually expressed under the regulation of ABA, thereby participating in the process of plant adaptation to adversity; DRE is related to the drought, low temperature and high salt stress responses of plants; LTR is related to the low temperature response of genes. In addition, there are other important functional elements in the promoter, such as AS-1, which is involved in regulating the expression of auxin response genes and affecting the development process of plants; MYC and CCGTCC-box and other elements play a key role in plant response to adversity and hormone signaling. Therefore, it is speculated that the diversity of cis-acting elements is closely related to the biological functions of the downstream genes regulated by them, which have the functions of adversity adaptation and hormone signaling.

[0046] Table 1 Some cis-acting elements in the promoter SiMTA1-P

[0047]

[0048]

[0049] Example 3: Analysis of expression patterns of methyltransferase gene SiMTA1 under different treatments

[0050] 3.1 Material culture and processing

[0051] Select plump millet seeds (variety An04, AN04) and germinate them in a planting tray covered with gauze. Culture them to the three-leaf stage, select seedlings with good growth, wrap the roots with a sponge and transfer them to a 25mL beaker. Put 6 plants in a beaker and add 25mL distilled water. After one day of seedling acclimatization, they are treated with salt (Nacl), drought (PEG), low temperature (4℃), auxin (IAA), cytokinin (6-BA), gibberellin (GA3), ethylene (ACC) and auxin hormone (NAA). Each treatment has three replicates, and samples are taken at 0h, 3h, 6h, 12h, 24h, and 48h after treatment. The samples are stored at -80℃ for later use.

[0052] The specific treatment method is: sodium chloride is prepared to a concentration of 200mmol L -1 The solution was treated with salt; 15 g PEG6000 was added to 85 mL of distilled water and the volume was adjusted to 100 mL to prepare 15% PEG-6000 (w / v) to simulate drought stress; 4°C low temperature storage box was used to simulate low temperature treatment; IAA treatment: 8.76 mL of the solution was taken to obtain a concentration of 1 mg mL -1 IAA mother solution was added to distilled water to make up to 1 L, and 50 μmol L-1 Working concentration: 6-BA treatment: take 11.26mL of 1mg mL -1 The 6-BA mother solution was diluted to 1 L with distilled water to prepare 50 μmol L -1 Working concentration; GA3 treatment: take 17.32mL for a concentration of 1mg mL -1 GA3 mother solution was added with distilled water to make up to 1 L, and 50 μmol L -1 Working concentration; ACC treatment: 1000 μmol L -1 ACC mother solution and distilled water were mixed at a ratio of 1:19 to prepare 50 μmol L -1 Working concentration; NAA treatment: take 9.31mL of 1mg mL -1 Add distilled water to 1 L of NAA mother solution to prepare 50 μmol L -1 Working concentration. All of the above treatments were carried out by root immersion.

[0053] 3.2 RNA extraction and reverse transcription

[0054] Millet tissue RNA was extracted according to the instructions of the RNA extraction kit, the concentration of the extracted RNA was measured, and the qualified RNA was reverse transcribed and converted into the first-strand cDNA.

[0055] 3.3qRT-PCR detection of SiMTA1 expression pattern under different treatments

[0056] According to the CDS sequence of millet methyltransferase gene SiMTA1, the following specific primers were designed through the NCBI database:

[0057] Primer Q-SiMTA1-F1: TGGCTGACGATGAAATGAGG (SEQ ID NO. 6);

[0058] Primer Q-SiMTA1-R1: GCCAGTTCGGATGATACGTT (SEQ ID NO. 7).

[0059] The single-stranded cDNA obtained by reverse transcription was used as a template, and the foxtail millet housekeeping gene SiActin (NCBI accession number: XM-004978702) was used as an internal reference. The above-mentioned specific primers were used to amplify the target fragment on a fluorescent quantitative PCR instrument. The amplification system was (20 μL): including: Q-SiMTA1-F1 0.4 μL, Q-SiMTA1-R1 0.4 μL, 1 μL of 5-fold diluted cDNA template, 10 μL of 2xChamQ Universal SYBR qPCR Master Mix, and 8.2 μL of ddH2O. Amplification conditions: 95°C for 30 s; then 95°C for 10 s, 60°C for 30 s, and 40 cycles; then 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s. Relative quantitative 2 –ΔΔCt The relative expression of SiMTA1 gene under different treatments was calculated by the method, and the data were analyzed and graphed using Excel, Origin and other software.

[0060] 3.4 Salt, drought and low temperature stress can induce SiMTA1 expression

[0061] At 200 mmol L -1 Under the treatment of NaCl and 15% PEG-6000 simulating drought, the gene expression showed a trend of first increasing, then decreasing, and then increasing. After 48h of salt stress, the gene expression level was about 6.5 times that of the control ( Figure 6 A); SiMTA1 has a faster response pattern to drought treatment. The gene expression level reaches a peak at 3h after drought treatment, and its expression level is 12 times that of the control. Then the expression level decreases slightly, then increases and then decreases ( Figure 6 B); Under 4℃ low temperature treatment, the expression of SiMTA1 showed a trend of slowly increasing at first, and then decreasing after 12h of treatment ( Figure 6 C). In summary, the response of genes to salt damage and drought was quite obvious, showing a dynamic response pattern of first increasing and then decreasing.

[0062] 3.5 Under different hormone treatments, the gene SiMTA1 also showed different response patterns

[0063] Under the treatment of auxin (IAA), cytokinin (6-BA) and auxin hormone (NAA), gene expression showed a trend of first increasing, then decreasing and then increasing again, and the increase in gene expression was relatively high ( Figure 7 A, B, E); under the treatment of gibberellin (GA3) and ethylene (ACC), the expression of SiMTA1 also showed a dynamic trend of first increasing and then decreasing, but the overall expression increase and decrease was not large ( Figure 7C, D). In summary, it was shown that the gene SiMTA1 responded significantly to auxin hormones and cytokinins, and the gene had a more obvious expression pattern change with the extension of treatment time, which suggested that the gene may play a role in regulating plant growth and development.

[0064] Example 4: Gene editing of the SiMTA1 gene and obtaining gene-edited plants

[0065] According to the gene sequence of millet SiMTA1, two target sites were selected before the PAM sequence (AGG). The sticky end linker GGCA of Aar I restriction endonuclease was added to the 5' end of the two target sites respectively, and the two selected target sequences were reversely complemented and the sticky end linker AAAC of Aar I restriction endonuclease was also added to their 5' ends. After the two pairs of sequences with linkers were synthesized by Biotechnology Co., Ltd., they were connected with sgRNA after Aar I digestion using T4 DNA ligase. After transforming DH5α, the positive plasmid and Cas9 final vector were selected to construct the pC1300-UBI:Cas9-SiMTA1 expression vector, and finally the positive plasmid was transformed into Agrobacterium LBA4404. The millet variety Ci846 was transformed by Agrobacterium to obtain gene-edited plants.

[0066] Whole genome DNA was extracted from the SiMTA1 gene-edited plants obtained above, and primers were designed according to the target site of SiMTA1 to amplify the target fragment. First, positive transformed plants were identified, and the transformation effect was identified by amplifying the target sequence hygromycin and Cas9.

[0067] Among them, the primers and sequences corresponding to the two targets are as follows:

[0068] MTA-F1: CTGAAGTCCGTGAGACTAGCAG (SEQ ID NO.8)

[0069] MTA-R1: GCCTTGTACCTTGCTCTCAACC (SEQ ID NO.9)

[0070] MTA-F2: CAAGCAGATGATGATGGTCTGG (SEQ ID NO.10)

[0071] MTA-R2: CTTCTTGTTCAGCAGCAGCTC (SEQ ID NO.11)

[0072] Hygromycin-validated primers used:

[0073] Hyg-FL: CTATTTCTTTGCCCTCGGACG (SEQ ID NO.12)

[0074] Hyg-RL: GAAAAAGCCTGAACTCACCGC (SEQ ID NO.13)

[0075] Cas9 validation primers used:

[0076] Cas9-TF1:ATGCAACCCTTATCCACCAATCGA(SEQ ID NO.14)

[0077] Cas9-TR1:GGGCGATCGGTGCGGGCCTCTTC (SEQ ID NO.15)

[0078] Gene-edited plants were screened by amplifying sequences near the target site. The SiMTA1 gene target site and its adjacent sequences were amplified, and the PCR products containing the target site were sequenced. The mutation type of the millet plant was determined by comparing it with the Ci846 sequence. Plants with both strands edited were homozygous for gene editing, and the sequencing results showed base deletions or changes; plants with single strands edited were heterozygous, and the sequencing results showed double peaks; plants with unchanged sequences were negative for non-editing. The edited heterozygous plants were further propagated and separated, and then further identified until edited homozygous plants were obtained.

[0079] The results are as follows Figure 8 Identification of SiMTA1-edited plants is shown. Figure 8 A is the result of Cas9 amplification in SiMTA1 gene-edited plants; Figure 8 B is the result of amplifying the hygromycin fragment in the SiMTA1 gene-edited plant; Figure 8 C is the result of amplifying the fragment near the target site of the SiMTA1 gene-edited plant; Figure 8 D. Target site editing of gene-edited homozygotes. 1-10 in the figure are different gene-edited strains, WT is Ci846 without editing, and GEP is a gene-edited homozygote.

[0080] The phenotype and biomass of SiMTA1 gene-edited plants can be further analyzed subsequently, and it can be predicted that the gene in millet plants introduced with the SiMTA1 gene expression vector may show positive regulation in response to salt, drought, and low temperature, and can enhance the plant's salt tolerance, drought resistance, and cold resistance.

Claims

1. A millet methyltransferase gene SiMTA1, characterized in that: The nucleotide sequence of the millet methyltransferase gene SiMTA1 is shown in SEQ ID NO.

1.

2. The protein encoded by the millet methyltransferase gene SiMTA1 according to claim 1, characterized in that: The amino acid sequence of the encoded protein is shown in SEQ ID NO.

3.

3. A gene editing vector containing the millet methyltransferase gene SiMTA1 as claimed in claim 1, characterized in that: The gene editing vector is a pC1300-UBI:Cas9-SiMTA1 expression vector.

4. The method for constructing a gene editing vector according to claim 3, characterized in that: The construction method is as follows: according to the gene sequence of foxtail millet SiMTA1, two target sites are selected before the PAM sequence AGG, and the sticky end linker GGCA of the AarI restriction endonuclease is added before the 5' end of the two target sites respectively, and the two selected target sequences are reversely complemented and the sticky end linker AAAC of the Aar I restriction endonuclease is also added to the 5' end; after the two pairs of sequences with the linker are synthesized, they are connected with the sgRNA after being digested by Aar I using T4 DNA ligase, and after transforming DH5α, the positive plasmid and the Cas9 final vector are selected to construct the pC1300-UBI:Cas9-SiMTA1 expression vector.

5. Use of the millet methyltransferase gene SiMTA1 as claimed in claim 1 in millet salt tolerance and / or drought tolerance.

6. Use of the millet methyltransferase gene SiMTA1 as claimed in claim 1 in creating salt-tolerant and / or drought-tolerant millet.

7. Use of the gene editing vector as claimed in claim 3 in salt tolerance and / or drought tolerance of millet.

8. Use of the gene editing vector as claimed in claim 3 in creating salt-tolerant millet and / or drought-tolerant millet.

Images