Instantaneous transformation method of Korean pine embryogenic callus

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to an instantaneous transformation method of Korean pine embryogenic callus. Soaking the Korean pine embryogenic callus in the infection solution for infection for 10-30 minutes to obtain an infected embryogenic callus; the infection liquid contains agrobacterium tumefaciens, the agrobacterium tumefaciens contains a recombinant vector, and the OD600 value of the infection liquid is 0.4-0.8; and co-culturing the infected embryogenic callus for 24-72 hours to realize the instantaneous transformation of the Korean pine embryogenic callus. According to the method, a simple, rapid, efficient and low-cost agrobacterium tumefaciens-mediated Korean pine embryonic callus instantaneous transformation system is successfully established, main factors of the system are optimized, and the obtained optimal transformation conditions are as follows: an infection solution OD600 is equal to 0.4, infection is performed for 10 minutes, co-culture is performed for 24 hours, and recovery culture is performed for 0 hour.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, in particular to an instantaneous transformation method of Korean pine embryonic callus. Background Art

[0002] Korean pine( Korean pine ) is an evergreen tree of the genus Pinus in the gymnosperm family Pinaceae. It is mainly distributed in the area from Xiaoxing'anling to Changbai Mountain in Northeast China. A few of them grow in southern Russia, Japan, and North Korea. Pinus koraiensis is listed as a national second-level key protected wild plant and has important economic and ecological value. The study of gene function of coniferous species is usually carried out by heterologous expression in Arabidopsis thaliana, but the differences between gymnosperms and angiosperms may change gene expression. Therefore, it is crucial to develop an efficient genetic transformation system for coniferous species. Stable genetic transformation systems have been established for some coniferous species such as Masson pine, Elliot pine, Norway spruce, and Loblolly pine. However, low transformation efficiency and long cycle are still problems for most coniferous species. At present, an Agrobacterium-mediated stable transformation system for Korean pine embryonic callus has been established, but it takes at least 60 days to go through three resistance screening processes, and different types of culture media need to be replaced. The operation is relatively complicated. These problems limit the study of Korean pine gene function. Therefore, establishing a reliable transient gene expression system is of great significance for the molecular biology research of Korean pine.

[0003] Reporter genes can be used to monitor the expression of specific genes and infer the expression level of target genes. Enhanced Green Fluorescent Protein (EGFP) is a red-shifted variant of Green Fluorescent Protein (GFP). Its maximum excitation peak is red-shifted to about 490 nm, which happens to be the wavelength commonly used by most confocal microscopes. The EGFP gene retains many advantages of GFP as a reporter gene and screening marker, but EGFP has two amino acid mutations. When excited by blue light, it emits 30-40 times brighter fluorescence than wild-type GFP. RUBY is a new, naked-eye visible, universal and convenient reporter gene for plants. It is based on the synthesis of betalain, a plant natural product synthesized by three enzymes (CYP76AD1, DODA, and GT) using tyrosine as a substrate, allowing non-destructive observation of plant genetic transformation and gene expression with the naked eye under visible light. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a method for transient transformation of Korean pine embryonic callus. The present invention is based on the stable transformation system of Korean pine embryonic callus mediated by Agrobacterium, uses pCambia1300-35s-RUBY vector for transient transformation, and screens efficient transient transformation conditions by analyzing the effects of infection solution concentration, infection time, co-culture time and recovery culture time on RUBY expression, providing technical support for studies such as Korean pine gene function verification and promoter activity analysis. Transient transformation technology will play an important role in the breeding of Korean pine varieties. It can not only improve the efficiency of genetic transformation, achieve significant genetic improvement, shorten the breeding cycle, but also improve culture conditions, promote improved variety selection, and provide tools for molecular basic research. These applications will help accelerate the genetic improvement process of Korean pine and improve the economic benefits and ecological value of Korean pine.

[0005] In order to achieve the above object, the present invention provides the following technical solutions: The present invention provides a method for instantaneous transformation of Korean pine embryonic callus, comprising the following steps: 1) Soak the Korean pine embryonic callus in the infection solution for 10 to 30 minutes to obtain infected embryonic callus; The infection solution contains Agrobacterium tumefaciens, which contains a recombinant vector. The OD 600 The value is 0.4~0.8; 2) co-culturing the infected embryonic callus obtained in step 1) for 24 to 72 hours to achieve transient transformation of the Korean pine embryonic callus.

[0006] Preferably, the infection time in step 1) is 20 minutes.

[0007] Preferably, in step 1) the OD of the infection solution is 600 The value is 0.5~0.7.

[0008] Preferably, in step 1) the OD of the infection solution is 600 The value is 0.6.

[0009] Preferably, the recombinant vector in step 1) includes pCambia1300-35s-RUBY vector, promoter PkDof5.6 -EGFP vector, promoter PkSHR -RUBY carrier, 35S- PkDof5.6 -EGFP vector, 35S- PkSHR -EGFP vector and 35S- PkSHR -One or more of the RUBY vectors.

[0010] Preferably, the co-cultivation time in step 2) is 48 hours.

[0011] Preferably, the infection time is 10 min, and the OD of the infection solution is 600 The value is 0.4, and the co-cultivation time is 24h.

[0012] Preferably, the culture medium for co-cultivation in step 2) is: 2mg / L 2,4-D, 0.5mg / L 6-BA, 950mg / L KNO3, 825mg / L NH4NO3, 170mg / L KH2PO4, 925mg / L MgSO4·7H2O, 11mg / L CaCl2·2H2O, 31mg / L H3BO3, 43mg / L ZnSO4·7H2O, 21mg / L MnSO4·H2O, 12.5mg / L Na2MoO4·2H2O, 4.15mg / L KI, 0.5mg / L CuSO4·5H2O, 0.13mg / L CoCl2·6H2O, 100mg / L inositol, 0.5mg / L nicotinic acid, 28mg / L FeSO4·7H2O, 37mg / L Na2·EDTA, 0.1mg / L Vitamin B1, 0.1mg / L Vitamin B6, 30g / L sucrose, 0.5g / L glutamine, 0.5g / L acid hydrolyzed casein, 4g / L gellan gum and 100µmol / L acetosyringone, pH 5.2.

[0013] Preferably, in step 1) resuspending Agrobacterium tumefaciens in an acetosyringone solution to obtain an infection solution; The concentration of the acetosyringone solution is 100 µmol / L.

[0014] Preferably, the co-cultivation conditions in step 2) include: dark culturing at a temperature of 23-27°C.

[0015] Beneficial effects of the present invention: The present invention successfully established a simple, rapid, efficient and low-cost Agrobacterium tumefaciens-mediated transient transformation system of Korean pine embryonic callus, and optimized the main factors of the system to obtain the optimal transformation conditions: the infection solution OD 600 =0.4, infection 10min, total culture 24h, recovery culture 0h. PkDof5.6 -EGFP, promoter PkSHR -RUBY、35S- PkDof5.6 -EGFP, 35S- PkSHR -EGFP, 35S- PkSHR-RUBY Agrobacterium infection of Korean pine embryonic callus under the above transformation conditions successfully verified the efficiency and stability of the transformation system. This system can initially and quickly verify gene function and identify related phenotypes, and at the same time provides a new method for studies such as promoter activity, avoiding abnormal phenotypes caused by gene expression in heterologous systems. This is of great significance for molecular breeding of Korean pine, especially for large-scale gene function analysis, and provides a reference for the establishment of transient transformation systems for other gymnosperms. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0017] Figure 1 This is the pCambia1300-35s-RUBY plasmid map; Figure 2 It is the molecular copy number diagram of transient transformation in each treatment; Figure 3 For promoter PkDof5.6 -EGFP, promoter PkSHR - Semi-quantitative results of RUBY instantaneous conversion; Figure 4 35S- PkDof5.6 -EGFP, 35S- PkSHR -GFP, 35S- PkSHR - RUBY instantaneous conversion quantitative results diagram; Figure 5 35S- PkDof5.6 -EGFP, 35S- PkSHR -EGFP, promoter PkDof5.6 -EGFP fluorescence localization map of EGFP transformed materials; Figure 6 For promoter PkDof5.6 -EGFP, 35S- PkDof5.6 -EGFP, 35S- PkSHR -EGFP vector map, note: 35S- PkDof5.6 -EGFP, 35S- PkSHR -EGFP vector is PkDof5.6 , PkSHR Inserted after 35S and before EGFP, promoter PkDof5.6 -EGFP vector replaces 35S with promoter PkDof5.6 ; Figure 7 For promoter PkSHR -RUBY、35S- PkSHR -RUBY carrier map, note: 35S-PkSHR -RUBY vector is PkSHR Insert it after 35S and before RUBY, promoter PkSHR -RUBY carrier is to replace 35S with promoter PkSHR ; Figure 8 is the standard curve diagram, Note: a is the standard curve of the first plate, b is the standard curve of the second plate, and c is the standard curve of the third plate; Figure 9 It is the layout information diagram, Note: (A) is the layout information of the first board, (B) is the layout information of the second board, (C) is the layout information of the third board, S is the standard product, and T is the treatment group; Figure 10 This is a heat map of sample molecular copy numbers. Note: The values ​​in the figure are log2SQ copies / 100ng; Figure 11 This is the map of the pTOPO TA / Blunt vector and the sequence map of the multiple cloning site region; Figure 12 This is the electrophoresis diagram of cloned RUBY fragment; Figure 13 This is the result diagram of the amplification curve of the RUBY gradient dilution sample of the absolute quantitative target gene; Figure 14 This is the melting curve result of RUBY gradient dilution sample for absolute quantitative target gene; Figure 15 This is the standard curve result of the RUBY gradient dilution sample of the absolute quantitative target gene. DETAILED DESCRIPTION

[0018] The present invention provides a method for instantaneous transformation of Korean pine embryonic callus, comprising the following steps: 1) Soak the Korean pine embryonic callus in the infection solution for 10 to 30 minutes to obtain infected embryonic callus; The infection solution contains Agrobacterium tumefaciens, which contains a recombinant vector. The OD 600 The value is 0.4~0.8; 2) co-culturing the infected embryonic callus obtained in step 1) for 24 to 72 hours to achieve transient transformation of the Korean pine embryonic callus.

[0019] The invention soaks Korean pine embryonic callus in an infection solution and infects it for 10 to 30 minutes to obtain infected embryonic callus; the infection solution contains Agrobacterium tumefaciens, the Agrobacterium tumefaciens contains a recombinant vector, and the OD value of the infection solution is 600 The value is 0.4~0.8.

[0020] In the present invention, the infection time is preferably 20 min. In the present invention, the OD of the infection solution is 600 The value is preferably 0.5 to 0.7. In the present invention, the OD of the infection solution 600 The value is preferably 0.6. In the present invention, Agrobacterium tumefaciens is preferably resuspended in an acetosyringone solution to obtain an infection solution; the concentration of the acetosyringone solution is preferably 100 µmol / L.

[0021] In the present invention, the recombinant vector preferably includes pCambia1300-35s-RUBY vector, promoter PkDof5.6 -EGFP vector, promoter PkSHR -RUBY carrier, 35S- PkDof5.6 -EGFP vector, 35S- PkSHR -EGFP vector and 35S- PkSHR -One or more of the RUBY vectors.

[0022] The present invention co-cultivates the obtained infected embryonic callus for 24 to 72 hours to achieve instantaneous transformation of the Korean pine embryonic callus.

[0023] In the present invention, the co-cultivation time is preferably 48 hours.

[0024] In the present invention, the co-culture medium is preferably: 2mg / L 2,4-D, 0.5mg / L 6-BA, 950mg / LKNO3, 825mg / L NH4NO3, 170mg / L KH2PO4, 925mg / L MgSO4·7H2O, 11mg / L CaCl2·2H2O, 31mg / LH3BO3, 43mg / L ZnSO4·7H2O, 21mg / L MnSO4·H2O, 12.5mg / L Na2MoO4·2H2O, 4.15mg / L KI, 0.5mg / L CuSO4·5H2O, 0.13mg / L CoCl2·6H2O, 100mg / L inositol, 0.5mg / L niacin, 28mg / L FeSO4·7H2O, 37mg / L Na2·EDTA, 0.1mg / L Vitamin B1, 0.1mg / L Vitamin B6, 30g / L sucrose, 0.5g / L glutamine, 0.5g / L acid hydrolyzed casein, 4g / L gellan gum and 100µmol / L acetosyringone, pH 5.2.

[0025] In the present invention, the co-cultivation conditions preferably include: dark cultivation at a temperature of 23-27°C.

[0026] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0027] Example 1 1 Materials and methods 1.1.1 Plant materials and culture conditions Immature cones of Korean pine were collected and stored at 4°C for one month. The cones were disinfected with 75% (V / V) ethanol for 1 h, and then the seed scales and outer seed coats were peeled off under sterile conditions and placed on the induction medium supplemented with hormones (Table 1). After 2 months of dark culture, the embryonic callus was transferred to the proliferation medium (Table 1), and subcultured every 14 days on the solid proliferation medium. The proliferation culture was carried out in a dark environment (25 ± 2°C). The obtained embryonic callus was used as the transformation object for transformation.

[0028] Table 1 Composition of different culture media in the experiment 1.1.2 Agrobacterium strains The vector strain pCambia1300-35s-RUBY used in the present invention carries the RUBY reporter gene. The original plasmid was provided by Professor He Yubing. Figure 1 , Figure 1 This is the plasmid map of pCambia1300-35s-RUBY.

[0029] The nucleotide sequence of pCambia1300-35s-RUBY is shown in SEQ ID No.5, and is as follows: GGATCC TCTAGA ctcgagTGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATAACATGGTGGAGCACGACACTCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGAGTCGAC atggatcatgcgaccctcgccatgatcctcgcgatctggttcatcagcttccacttcatcaagctgctgttctc ccagcagaccaccaagctgcttccgccaggaccaaagccgcttccgatcatcggcaacatccttgaggtgggcaag aagccgcatcggtccttcgccaacctcgccaagattcacggcccactcatttccctcagactcggctctgtgacca ccatcgttgtgtcctctgccgacgtggccaaagagatgttcctcaagaaggatcacccgctctccaaccgcacgat cccgaatagtgttacagccggcgaccaccacaagctcaccatgtcttggctcccggtgtctccgaagtggcgcaac ttccgcaagattaccgccgtgcatctgctctccccacagagactcgatgcctgccagacattcaggcacgccaagg tgcagcagctctacgagtacgttcaagagtgcgcccagaaaggccaggccgtggatattggcaaggccgcctttac gaccagcctcaacctcctcagcaagctgttcttcagcgtcgagctggcgcaccacaagtcccataccagccaagag ttcaaagagctgatctggaacatcatggaagatataggcaagccgaactacgccgactacttcccgattctcggct gcgttgacccatctggcattagaagaaggctcgcctgctccttcgacaagctgatcgccgtgttccagggcatcat ctgcgagagactcgccccagattcctccaccacaactaccaccaccaccgacgacgtgctcgatgtgctcctccag ctgttcaagcagaacgagctgacgatgggcgagatcaaccacctcctcgtggacatcttcgacgccggcaccgata ccacatcctccacattcgagtgggtgatgaccgagctgatccgcaatccagagatgatggaaaaggcccaagagga aatcaagcaggtcctcggcaaggacaagcagatccaagagtccgacatcatcaacctgccgtacctccaggcgatc atcaaagagacactccgcctccatccgccgaccgtgttcttgctcccaagaaaggccgacaccgatgtcgagctgt acggctacatcgtgccgaaggatgcccagatcctcgtgaacctctgggccattggcagggacccaaacgcctggca gaacgccgatattttcagcccagagcgcttcatcggctgcgagatcgatgttaagggccgcgatttcggcctcctt ccatttggcgctggccgcagaatttgcccaggcatgaatctcgccatcaggatgctcaccctcatgctcgccacac tcctccagttcttcaactggaagctcgaaggcgacatctccccgaaggacctcgacatggacgagaagttcggcat tgcgctccaaaagaccaagccgctcaagctcatcccgattccgcgctaccaattgttgaattttgatttgttgaag ttggctggagatgttgaatctaatcctggacctaagatgatgaacggcgaggacgccaacgaccagatgatcaaag agtccttcttcatcacccacggcaacccgatcctcaccgtcgaggatacacatccgctcaggccgttcttcgagac atggcgcgagaagattttctccaagaagccgaaggccatcctcatcatctccggccactgggagacagtgaagcca accgtgaacgccgtgcacatcaacgacaccatccacgacttcgacgactacccagccgccatgtaccagttcaagt acccagctccaggcgagccagagcttgcgagaaaggtggaagagatcctcaagaagtccgggttcgagacagccga gacagaccaaaagaggggccttgatcacggcgcctgggttccactcatgctcatgtatccagaggcggacatcccg gtgtgccagctctcagttcagccacatctcgacggcacctaccactacaatctcggcagagccctcgcgccgctca agaatgatggcgtgctcattattggctccggcagcgccacacatccactcgatgagacaccgcactacttcgatgg tgttgccccttgggccgctgccttcgattcttggcttaggaaggccctcatcaacggccgcttcgaggaagtgaac atctacgagagcaaggccccgaactggaagctcgcccatccatttccagagcacttctacccgctccacgttgtgc tcggcgctgctggtgaaaagtggaaggccgagctgatccactcctcctgggatcatggcacactttgccacggctc ctacaagttcacctccgcccaattgttgaattttgatttgttgaagttggctggagatgttgaatctaatcctgga cctaccgccatcaagatgaacaccaacggcgagggcgagacacagcacatcctcatgatcccgttcatggcgcagg gccacctcaggccatttctcgaactcgccatgttcctctacaagcgctcccacgtgatcatcaccctgctcacaac tccgctcaacgccggcttcctcaggcacctccttcaccaccattcctactcctccagcggcatcaggatcgtcgag ctgccattcaactccaccaaccacggactcccaccgggcatcgagaacaccgataagctcacactcccgctcgtgg tgtccctcttccattccaccatcagcctcgatccgcacctccgcgattacatctccaggcatttcagcccagccag gccaccactctgcgtgatccatgatgtgttcctcggctgggttgaccaggtggccaaggatgtgggctctacaggc gtggtgttcacaacaggcggcgcttatggcacatccgcctacgtgtccatctggaacgatctcccgcaccagaact actccgacgaccaagagttcccgctgccaggcttcccagagaaccataagttccgcaggtcccagctccatcggtt cctcagatatgccgacggctccgacgattggtccaagtatttccagccgcagctccgccagtccatgaagtctttt ggctggctctgcaactccgtggaagagatcgagacactcggcttctccatcctccgcaactacaccaagctgccga tctggggcatcggcccacttattgcttccccagtgcagcactcctcctccgacaacaattcaacaggcgccgagtt cgtgcagtggctcagcctcaaagagccggactccgtcctctacatctccttcggctcccagaacacgatcagcccg acgcagatgatggaactcgctgctggccttgagtcctccgagaagccattcctctgggtgatcagagccccgttcg gcttcgacatcaacgaagagatgcgcccagagtggctgccagagggctttgaggaacgcatgaaggtgaagaaaca gggcaagctcgtgtacaagctcggcccgcagcttgagatcctcaaccatgaatccatcggcggctttctcacccac tgcggatggaacagcatccttgagtctcttcgcgagggcgttccgatgcttggatggccacttgctgccgagcagg cctacaacctcaagtacctcgaagatgagatgggcgtcgcggttgagcttgctagaggcctcgaaggcgagatctc caaagagaaggtcaagcgcatcgtcgagatgatccttgagcgcaacgagggctccaaaggctgggagatgaagaat cgcgccgtggaaatgggcaaaaagctcaaggacgccgtgaacgaggaaaaagagctgaagggctcctccgtgaagg cgatcgacgatttcctcgacgccgtcatgcaggccaaacttgagccaagcctccagtgatagtga

[0030] 1.1.3 Orthogonal experimental design In order to analyze the effects of infection solution concentration, infection time, co-culture time and recovery culture time on the expression of RUBY and screen the efficient transient transformation conditions of Korean pine embryonic callus, an orthogonal experiment was designed (see Table 2).

[0031] Table 2 Orthogonal experimental design for transient transformation of Korean pine embryonic callus 1.2 Experimental methods 1.2.1 Cloning of genes and promoters and vector construction Embryonic callus of Pinus koraiensis on solid proliferation medium was selected, and total RNA was extracted using RNA extraction kit (R6827-01, OMEGA BIO-TEK), and total DNA was extracted using DNA extraction kit (D5511-01, OMEGA BIO-TEK). The specific operation was carried out according to the instructions. PkDof5.6 , PcqI 、promoter PkDof5.6 、 promoter PkSHR pTOPO TA / Blunt (EZ-TA / Blunt Zero pTOPO II Cloning Kit purchased from GenStar of Beijing Kangrun Chengye Biotechnology Co., Ltd.) was used. Fig.11 pTOPO TA / Blunt vector map and multiple cloning site sequence map) ligated the target fragment and transformed into DH5 Among the competent cells, positive single colonies were screened and the gene and promoter were successfully obtained.

[0032] PkDof5.6 The nucleotide sequence of the gene is shown in SEQ ID No. 1, and is as follows:

[0033] PcqI The nucleotide sequence of the gene is shown in SEQ ID No. 2, and is as follows:

[0034] The nucleotide sequence of promoterPkDof5.6 (promoter) is shown in SEQ ID No.3, and is as follows:

[0035] The nucleotide sequence of promoterPkSHR (promoter) is shown in SEQ ID No.4, and is as follows:

[0036] Building a promoter PkDof5.6 -EGFP, promoter PkSHR -RUBY、35S- PkDof5.6 -EGFP, 35S- PcqI -EGFP, 35S- PcqI -RUBY vector ( Figure 6 and Figure 7 ), Figure 6 For promoter PkDof5.6 -EGFP, 35S- PkDof5.6 -EGFP, 35S- PcqI -EGFP vector map, note: 35S- PkDof5.6 -EGFP, 35S- PcqI -EGFP vector is PkDof5.6 , PcqI Inserted after 35S and before EGFP, promoter PkDof5.6 -EGFP vector replaces 35S with promoter PkDof5.6 ， Figure 7 For promoter PkSHR -RUBY、35S- PcqI -RUBY carrier map, note: 35S- PcqI -RUBY vector is PcqI Insert it to the front of RUBY after 35S, promoter PkSHR -RUBY carrier is to replace 35S with promoter PkSHR . And transformed into GV3101 competent cells, screened out positive single colonies, obtained Agrobacterium and stored in a -80 ℃ refrigerator.

[0037] The pCambia1300-35s-RUBY vector carrying RUBY ( Figure 1 The pCambia1300-35s-RUBY plasmid was transformed into Agrobacterium tumefaciens GV3101 competent cells, and the obtained Agrobacterium was stored in a -80 ℃ refrigerator.

[0038] 1.2.2 Instant Conversion Take the pCambia1300-35s-RUBY Agrobacterium solution stored at -80℃ and apply it to the solution containing 50 mg·L −1 Kanamycin and 20 mg·L −1 Rifampicin was cultured on solid Luria-Bertani (LB) medium at 28 °C for 2 days. A single colony was picked and plated on a plate containing 50 mg·L −1 Kanamycin and 20 mg·L−1 Rifampicin was cultured in liquid LB medium at 28°C with shaking at 200 rpm until OD 600 The bacterial solution was centrifuged at 4°C and 4,000 rpm for 10 min, and the supernatant was discarded to collect the bacterial cells. The bacterial cells were resuspended in a liquid proliferation medium containing 100 µM acetosyringone to a concentration of 0.4 to 0.8. 600 The values ​​of 0.4, 0.5, 0.6, 0.7 and 0.8 were respectively (Table 2), and the solution obtained at this time was the infection solution. After 10 days of liquid proliferation culture of embryonic callus, 0.2 g of callus was placed in 50 mL of infection solution for infection, and the infection time was 10, 20 and 30 min respectively (Table 2). After infection, the mixture was drained using a suction filtration sterilization device, and then the callus was transferred to a solid co-culture medium containing 100 µM acetosyringone (Table 1), and co-cultured at 25 ± 2 ℃ in the dark for 24, 48 and 72 h respectively (Table 2), and recovered for 0 d, 1 d, 2 d, and 3 d (Table 2), and then the materials were collected and stored in a - 80 ℃ refrigerator.

[0039] 1.2.3 RNA extraction and reverse transcription The transiently transformed embryonic callus was used as the material, and the liquid nitrogen was ground and the total RNA was extracted using an RNA extraction kit (R6827-01, OMEGA BIO-TEK). The specific operation was carried out according to the instructions. The RNA concentration and purity were tested using a nucleic acid detector and agarose gel electrophoresis. The qualified RNA (RR092A, TaKaRa) was reverse transcribed into cDNA using a reverse transcription kit, and its concentration was measured and stored in a -20°C refrigerator for subsequent quantitative detection.

[0040] 1.2.4 Preparation of standard curve Primers were designed (Primer Premier 5.0 software), and a 185 bp fragment of the reporter gene RUBY was cloned and ligated into the intermediate vector (pMD ® 18-T Vector), transformed into E. coli, picked a single clone and extracted the plasmid. The constructed plasmid was sequenced and confirmed to be correct. The plasmid OD was measured with a micro-spectrophotometer. 260 The value was converted into copy number (copies / µL) using the formula.

[0041] Table 3 Plasmid concentration and copy number The highest copy number of the standard curve was 2.41E+07 copies / µL. The plasmid was diluted 1000 times and then 10 times in a gradient dilution. Five concentrations were selected for the preparation of the standard curve ( Figure 8 , Figure 8is the standard curve diagram, Note: a is the standard curve of the first plate, b is the standard curve of the second plate, and c is the standard curve of the third plate).

[0042] Table 4 Standard curve Supplementary standard curve: (The following is the detailed process of the standard curve) 1.2.4.1 Primer sequences (designed by Primer Premier 5.0 software) >Ruby 185bp (SEQ ID No.6): tgcgagaaaggtggaagagatcctcaagaagtccgggttcgagacagccgagacagaccaaaagaggggccttgatcacggcgcctgggttccactcatgctcatgtatccagaggcggacatcccggtgtgccagctctcagttcagccacatctcgacggcacctaccactacaatctcggca Ruby-F (SEQ ID No.7): 5' TGCGAGAAAGGTGGAAGAGAT 3'; Ruby-R (SEQ ID No. 8) 5' TGCCGAGATTGTAGTGGTAGGT 3'; 1.2.4.2 Preparation of Standards 1.2.4.2.1 PCR reaction system Table 5 Reaction system 1.2.4.2.2 PCR reaction conditions Table 6 Reaction conditions 1.2.4.2.3 PCR electrophoresis 1.5% agarose gel, 1×TAE, 150 V, 100 mA, 20 min electrophoresis observation (see electrophoresis Fig.12 , Fig.12 (Figure 2 is the electrophoresis diagram of cloned RUBY fragment).

[0043] 1.2.4.2.4 PCR recovery The target band was cut out with a scalpel and recovered using the Bio-Tech SanPrep column-based DNA gel recovery kit.

[0044] 1.2.4.2.5 Cloning and sequencing 1) Reaction 16°C for 1 hour Table 7 System 2) Transformation of ligation products Using the Bio-Tech One-Step Rapid Competent Cell Preparation Kit (Product No. B529307), the transformation steps are as follows: a) Place 100 µl competent cells on ice and gently suspend the cells evenly after they are completely thawed.

[0045] b) Add 10 µl of Ligation Buffer, mix gently, and place on ice for 30 minutes.

[0046] c) Heat shock in a 42°C water bath for 45 seconds. Place on ice for 15-20 minutes.

[0047] d) Add 600 µl SOC medium and incubate at 37°C with shaking at 200-250 rpm for 1 hour.

[0048] e) Centrifuge at 4000 rpm for 5 minutes at room temperature, remove 400 µl of the supernatant with a pipette, and resuspend the cells with the remaining culture medium.

[0049] f) Spread the bacteria onto ampicillin plates pre-coated with 20 µl 100 mM IPTG and 100 µl 20 mg / ml X-gal.

[0050] g) The plates were placed upright at 37°C for 1 hour to absorb excess liquid and then incubated inverted overnight.

[0051] 3) Plasmid extraction The plasmid was extracted using the SanPrep plasmid DNA extraction kit B518191.

[0052] 4) Quantitative plasmid information Plasmid M13+ / - sequencing, see Fig.11 , Fig.11 This is the map of the pTOPO TA / Blunt vector and the sequence map of the multiple cloning site region.

[0053] After the constructed plasmid was sequenced and confirmed to be correct, the OD260 value of the plasmid was measured with a micro-spectrophotometer and converted into the copy number (copies / µl) using the formula.

[0054] 5) Preparation of standard curve samples Each constructed plasmid was diluted 10-fold, 90 µl dilution solution + 10 µl plasmid, and 5 concentrations were selected for preparing the standard curve.

[0055] 1.2.4.3 Fluorescence quantitative PCR detection 1.2.4.3.1 Experimental samples Plasmid was diluted 1000-fold, followed by 10-fold serial dilutions.

[0056] 1.2.4.3.2 Real-time quantitative PCR test materials and instruments Quantitative PCR reagents: 2X SG Fast qPCR Master Mix (B639271, BBI, Roche).

[0057] Quantitative PCR instrument: LightCycler 480 II fluorescent quantitative PCR instrument (Roche, Rotkreuz, Switzerland).

[0058] 1.2.4.3.3 PCR reaction steps 1) Prepare the reaction mixture Table 8 Mixture Note: Add 1µl template for every 10µl system.

[0059] 2) PCR cycling conditions Table 9 Conditions 3) Instrument operation After completing the above steps, the 96 / 384-well plate with the added samples was placed in the LightCycler480 II (Roche) for reaction.

[0060] 1.2.4.4 Absolute quantification standard curve results 1) Target gene Ruby gradient dilution sample amplification curve ( Fig.13 , Fig.13 This is the result of the amplification curve of the RUBY gradient dilution sample for absolute quantification of the target gene).

[0061] 2) Fusion curve of target gene Ruby gradient dilution sample ( Fig.14 , Fig.14 (Figure 2) is the melting curve result of RUBY gradient dilution sample for absolute quantification of target gene.

[0062] 3) Target gene Ruby gradient dilution sample standard curve ( Fig.15 , Fig.15 This is the result of the standard curve of the RUBY gradient dilution sample for absolute quantification of the target gene).

[0063] Fig.15The vertical axis is the CT value; the horizontal axis is LogCO, which refers to the Log copy number, that is, the logarithm of the copy number.

[0064] Slope: Slope = -3.123 Amplification efficiency: E=10 -1 / 斜率 -1=109.0% Correlation coefficient: R 2 =0.9988 YIntercept: 34.06 Error: 0.0630.

[0065] 1.2.5 Expression level detection 1.2.5.1 Screening of transient conversion conditions The cDNA of transient transformation materials from two replicates of each treatment was used as template for absolute quantitative detection ( Fig. 9 and Fig.10 , Fig. 9 It is the layout information diagram, Note: (A) is the layout information of the first board, (B) is the layout information of the second board, (C) is the layout information of the third board, S is the standard product, and T is the treatment group; Fig.10 The heat map of sample molecular copy number (note: the value in the figure is log2SQcopies / 100ng). Each sample was tested 3 times to obtain C T The copy number of each molecule was calculated using the standard curve of the same plate, and the final expression level was expressed as log2SQ value (copies / 100ng). The results were expressed as mean ± standard deviation (Mean ± SD).

[0066] Table 10 Effects of infection solution concentration, infection time, co-culture time and recovery time on RUBY expression 1.2.5.2 Promoter semi-quantification and gene quantification results under optimal conditions for transient transformation According to the optimal conditions for instantaneous conversion, the promoter PkDof5.6 -EGFP, promoter PkSHR -RUBY、35S- PkDof5.6 -EGFP, 35S- PcqI -EGFP, 35S- PcqI -RUBY Agrobacterium was used to infect Korean pine embryonic callus to obtain transformed material. RNA was extracted and reversely transcribed into cDNA for semi-quantitative and quantitative experimental verification.

[0067] 1.3 Data processing and analysis The quantitative results were analyzed by SPSS software. The molecular copy number of transient transformation and the number of transient transformation materials under each treatment were PkDof5.6 or PcqI The relative expression levels were plotted using GraphPad Prism software.

[0068] 2 Results and Analysis 2.1 Effects of infection fluid concentration, infection time, co-culture time, and recovery culture time on RUBY expression According to different infection solution concentrations, infection time, co-culture time and recovery culture time, 25 treatment groups were designed and transiently transformed using the vector 35S-RUBY. The qRT-PCR results showed that RUBY could be expressed under different conditions, but the expression levels were significantly different (Table 10). 600 =0.4, infection for 10 min, co-culture for 24 h, recovery culture at 0 h, the expression level of RUBY was very high, log2SQ was 19.2235; 600 =0.8, infection for 20 min, co-culture for 72 h, and recovery culture for 72 h, the expression level of RUBY was the lowest, with a log2SQ of 10.7428. RUBY was expressed in all treatment groups, but its magnitude was different under different conditions ( Figure 2 , Figure 2 (Figure 2A is a graph of the molecular copy number of each treatment).

[0069] 2.2 Verification of transient expression in Korean pine embryonic callus Use recombinant vector promoter PkDof5.6 -EGFP, promoter PkSHR -RUBY、35S- PkDof5.6 -EGFP, 35S- PcqI -EGFP, 35S- PcqI -RUBY to OD 600 = 0.4 infection solution for 10 min and cultured for 24 h for transient transformation.

[0070] promoter PkDof5.6 -EGFP, promoter PkSHR -The semi-quantitative RT-PCR results of RUBY showed that the amplified fragments of GFP or RUBY could be detected in the transformed materials, but not in the untransformed wild-type materials ( Figure 3 , Figure 3 For promoter PkDof5.6 -EGFP, promoter PkSHR -Semi-quantitative results of RUBY transient conversion (Figure 3).

[0071] 35S- PkDof5.6 -EGFP, 35S- PcqI-EGFP, 35S- PcqI -RUBY results show that in the transformed material PkDof5.6 or PcqI The relative expression level of Figure 4 , Figure 4 35S- PkDof5.6 -EGFP, 35S- PcqI -GFP, 35S- PcqI -RUBY instantaneous conversion quantitative results).

[0072] The wild-type material was mixed with 35S- PkDof5.6 -EGFP, 35S- PcqI -EGFP, promoter PkDof5.6 -EGFP transformed materials were observed using confocal microscopy for EGFP fluorescence ( Figure 5 , Figure 5 35S- PkDof5.6 -EGFP, 35S- PcqI -EGFP, promoter PkDof5.6 -EGFP transformed material EGFP fluorescence localization map), no fluorescence was observed in the wild-type material, while green fluorescence was observed in the transformed material.

[0073] The above results show that OD 600 = 0.4 infection solution for 10 min and co-culture for 24 h as transient transformation conditions. Both vectors 35S-EGFP and 35S-RUBY can be introduced into Korean pine embryonic callus cells, and the 35S promoter can drive the expression of EGFP and RUBY.

[0074] 3 Discussion Transgenic technology is an important way to conduct basic research on plants and improve crop varieties. The stable transformation system introduces foreign genes into organisms to study gene expression and function, thereby revealing the mechanism of gene action. However, the stable genetic transformation cycle is long and the efficiency is low, which cannot meet the needs of rapid identification of gene functions and understanding of unknown metabolic pathways. As an efficient and convenient means, transient transformation technology is increasingly used in plant molecular biology.

[0075] Transient transformation is simple to operate, has a short cycle, high expression efficiency, and is widely used. Methods of transient transformation include Agrobacterium-mediated transformation, gene gun transformation, vacuum infiltration, etc. Common receptor materials for transient transformation include callus, plant leaves, protoplasts, suspension cell cultures, stem segments, etc. Among them, callus has a high transformation efficiency and can proliferate in large quantities. A somatic embryo maturation culture system that stably utilizes embryonic callus has been established for Korean pine. Therefore, the transient transformation system using Korean pine embryonic callus as the receptor material is of great value in plant gene function research and biotechnology applications. However, various culture conditions during transient transformation will affect the transformation efficiency, such as the concentration of Agrobacterium solution, infection time, co-culture time, and recovery culture time. Therefore, screening various transformation conditions is crucial to establishing a transformation system and improving transformation efficiency.

[0076] In the study of the transient transformation system of multiple species mediated by Agrobacterium, researchers have explored a number of factors that affect transformation efficiency. Chang Jing et al. believe that the concentration of bacterial solution has a significant effect on the genetic transformation, infection time and co-culture time, and is an important factor in transformation efficiency. In the conifer genetic transformation system, the concentration of bacterial solution is usually adjusted from OD 600 The absorbance ranged from 0.3 to 0.8, and the infection time ranged from 10 minutes to 40 minutes. During the transformation process, if the concentration is too low, the infection time or co-culture time is too short, the adhesion of Agrobacterium to the plant material will be poor, thereby reducing the transformation efficiency; if the bacterial solution concentration is too high, the infection time or co-culture time is too long, it may cause excessive proliferation of Agrobacterium, which will adhere to the callus and cause its death, which is not conducive to transformation. In this study, Korean pine embryonic callus was used as the receptor material to explore the effects of infection solution concentration, infection time, co-culture time and recovery culture time on the transformation efficiency in the Agrobacterium-mediated transient transformation system.

[0077] Improvements in somatic embryo maturation have been achieved in many coniferous tree species, but the difficulty of callus induction and somatic embryogenesis varies among species. Korean pine has the problem of decreased embryogenic capacity of callus tissue, resulting in loss of somatic embryogenesis potential. Somatic embryo maturation is difficult, and few mature somatic embryos are obtained. Transgenic technology can be used to study gene function and systematically study the mechanism of somatic embryogenesis in Korean pine, thereby accelerating the selection of Korean pine varieties and rapid large-scale propagation.

[0078] The present invention successfully established a simple, rapid, efficient and low-cost Agrobacterium tumefaciens-mediated transient transformation system of Korean pine embryonic callus, and optimized the main factors of the system to obtain the optimal transformation conditions: the infection solution OD 600 =0.4, infection 10min, total culture 24h, recovery culture 0h. PkDof5.6 -EGFP, promoter PkSHR-RUBY、35S- PkDof5.6 -EGFP, 35S- PcqI -EGFP, 35S- PcqI -RUBY Agrobacterium infection of Korean pine embryonic callus under the above transformation conditions successfully verified the efficiency and stability of the transformation system. This system can initially and quickly verify gene function and identify related phenotypes, and at the same time provides a new method for studies such as promoter activity, avoiding abnormal phenotypes caused by gene expression in heterologous systems. This is of great significance for molecular breeding of Korean pine, especially for large-scale gene function analysis, and provides a reference for the establishment of transient transformation systems for other gymnosperms.

[0079] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for instantaneous transformation of Korean pine embryonic callus, characterized in that: The following steps are involved: 1) Soak the Korean pine embryonic callus in the infection solution for 10 to 30 minutes to obtain infected embryonic callus; The infection solution contains Agrobacterium tumefaciens, which contains a recombinant vector. The OD 600 The value is 0.4~0.8; 2) co-culturing the infected embryonic callus obtained in step 1) for 24 to 72 hours to achieve transient transformation of the Korean pine embryonic callus.

2. The instantaneous conversion method according to claim 1, characterized in that: The infection time of step 1) is 20 minutes.

3. The instantaneous conversion method according to claim 1, characterized in that: Step 1) The OD of the infection solution 600 The value is 0.5~0.

7.

4. The instantaneous conversion method according to claim 1, characterized in that: Step 1) The OD of the infection solution 600 The value is 0.

6.

5. The instantaneous conversion method according to claim 1, characterized in that: The recombinant vector in step 1) includes pCambia1300-35s-RUBY vector, promoter PkDof5.6 -EGFP vector, promoter PkSHR -RUBY carrier, 35S- PkDof5.6 -EGFP vector, 35S- PcqI -EGFP vector and 35S- PcqI -One or more of the RUBY vectors.

6. The instantaneous conversion method according to claim 1, characterized in that: The co-cultivation time in step 2) is 48 hours.

7. The instantaneous conversion method according to claim 1, characterized in that: The infection time was 10 min, and the OD of the infection solution was 600 The value is 0.4, and the co-cultivation time is 24h.

8. The instantaneous conversion method according to claim 1, characterized in that: The culture medium for co-culture in step 2) is: 2mg / L 2,4-D, 0.5mg / L 6-BA, 950mg / L KNO3, 825mg / L NH4NO3, 170mg / L KH2PO4, 925mg / LMgSO4·7H2O, 11mg / L CaCl2·2H2O, 31mg / L H3BO3, 43mg / L ZnSO4·7H2O, 21mg / L MnSO4·H2O, 12.5mg / L Na2MoO4·2H2O, 4.15mg / L KI, 0.5mg / L CuSO4·5H2O, 0.13mg / L CoCl2·6H2O, 100mg / L inositol, 0.5mg / L nicotinic acid, 28mg / L FeSO4·7H2O, 37mg / L Na2·EDTA, 0.1mg / L Vitamin B1, 0.1mg / L Vitamin B6, 30g / L sucrose, 0.5g / L glutamine, 0.5g / L acid hydrolyzed casein, 4g / L gellan gum and 100µmol / L acetosyringone, pH 5.

2.

9. The instantaneous conversion method according to claim 1, characterized in that: The step 1) resuspending Agrobacterium tumefaciens in an acetosyringone solution to obtain an infection solution; The concentration of the acetosyringone solution is 100 µmol / L.

10. The instantaneous conversion method according to claim 1, characterized in that: The co-cultivation conditions in step 2) include: dark cultivation at a temperature of 23-27°C.

Images