Molecular marker primer and kit for identifying gender of brachymystax lenok tsinlingensis and application of molecular marker primer and kit

Abstract

The invention provides a molecular marker primer and a kit for identifying sex of brachymystax lenok tsinlingensis and application of the molecular marker primer and the kit, and belongs to the technical field of sex identification of salmonidae fishes. Through comparative analysis of genomes of male and female brachymystax lenok tsinlingensis individuals, it is found that the male brachymystax lenok tsinlingensis has two specific mutation sites, and then two pairs of primers are designed according to flanking areas of the two mutation sequences and are 617-F1 / R1 and 556-F1 / R1 respectively. Each primer can be used independently to identify the gender of brachymystax lenok tsinlingensis, and the primer has the advantages of stable, accurate and reliable result. The molecular marker primer disclosed by the invention can be used for identifying the gender of the brachymystax lenok tsinlingensis and has important significance on the development of genetic breeding work of the brachymystax lenok tsinlingensis.

Description

Technical Field

[0001] The invention relates to the technical field of sex identification of salmonid fish, and in particular to molecular marker primers, a kit and applications thereof for identifying the sex of Qinling smelt salmon. Background Art

[0002] Qinling Slender-scaled Salmon (Brachymystax tsinlingensis) belongs to the genus Brachymystax of the family Salmonidae in the order Salmoniformes. It is mainly distributed in mountain streams in the Qinling Mountains. Due to multiple factors such as habitat destruction, overfishing and climate change, its wild population has decreased sharply and is listed as a national second-class protected animal. In recent years, a series of conservation actions such as artificial breeding and wild release have been carried out to increase the number of wild populations. However, the population maintenance capacity of endangered animals is affected by various potential random factors, among which the sex ratio is one of the important potential random factors. In the process of artificial breeding, the sex ratio directly affects the reproductive efficiency and the subsequent recovery capacity of the population. Especially in small-scale populations, maintaining an appropriate sex ratio is of great significance to avoid inbreeding and maintain genetic diversity. However, due to the long sexual maturity time of Qinling Slender-scaled Salmon (3-5 years), the juveniles that meet the release standards do not show significant sexual dimorphism. Traditional morphological methods are difficult to use for sex identification, resulting in difficulties in sex ratio monitoring. Therefore, the development of stable, simple and low-cost sex molecular markers is of great significance for monitoring the sex ratio of released populations, and will make an important contribution to the sustainable development and stability of the wild population of Qinling salmon.

[0003] Molecular marker technology is a modern molecular biotechnology that is fast, efficient and accurate for identifying differences in genomic sequences, including SNP (single nucleotide polymorphism), SSR (microsatellite), AFLP (amplified fragment length polymorphism), InDel (insertion and deletion), etc. Among them, InDel has been successfully used for sex identification of various aquatic species due to its high stability and easy detection. However, due to the differences in genomic sequences between species, molecular markers are difficult to apply across species. Therefore, it is necessary to develop molecular markers for the sex of Qinling salmon and establish a set of efficient sex identification technologies, which are of great significance for optimizing its artificial breeding process and promoting population recovery.

[0004] The invention patent with the publication number of "CN 112646870 A" discloses a sex identification method for Brachymystaxlenok, a species of salmon. However, after analysis, it was found that B.lenok has been genetically differentiated from B.tsinlingensis for more than two million years, and has a large genomic difference. According to biological principles, genetic differences between species often lead to the inability to use molecular markers across species. Therefore, when molecular markers based on different species are applied, especially in sensitive areas such as sex identification, there are cases where inter-species markers are invalid or cannot be applied across species. However, there are no molecular markers and primers for sex identification of B.tsinlingensis in the prior art. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention provides two Qinling salmon-specific molecular markers and primers thereof. Each primer can be used independently to identify the sex of Qinling salmon, and has the advantages of stable, accurate and reliable results.

[0006] The sex of Qinling salmon is determined by homomorphic chromosomes, with males having heteromorphic chromosomes (XY) and females having homomorphic chromosomes (XX). They are very similar in structure and gene content and are difficult to distinguish. By comparing and analyzing the genomes of males and females, it was found that male Qinling salmon had two specific mutation sites. So far, there are no reports on multiple pairs of genetic sex molecular markers for Qinling salmon at home and abroad. Therefore, the development of multiple genetic sex molecular markers to accurately identify the sex of Qinling salmon has great production application value in sex identification and breeding.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The invention provides molecular marker primers for identifying the sex of Qinling smelt salmon, comprising a primer pair 617-F1 / R1, wherein the nucleotide sequence of the upstream primer 617-F1 is shown in SEQ ID NO:1, and the nucleotide sequence of the downstream primer 617-R1 is shown in SEQ ID NO:2.

[0009] The invention provides molecular marker primers for identifying the sex of Qinling salmon, including primer pair 556-F1 / R1, the nucleotide sequence of the upstream primer 556-F1 is shown in SEQ ID NO:3, and the nucleotide sequence of the downstream primer 556-R1 is shown in SEQ ID NO:4.

[0010] The present invention also provides the use of the molecular marker primer in at least one of the following:

[0011] (1) Application in sex identification or screening of Qinling salmon;

[0012] (2) Application in Qinling salmon breeding;

[0013] (3) Application in the preparation of products for sex identification of Qinling salmon.

[0014] The invention also provides a kit for identifying the sex of Qinling salmon, comprising molecular marker primers 617-F1 / R1 or 556-F1 / R1.

[0015] The present invention also provides a method for identifying the sex of Qinling salmon, comprising the following steps:

[0016] S1. extracting genomic DNA of the tested Qinling salmon;

[0017] S2. Using the genomic DNA of the Qinling salmon to be tested as a template, PCR amplification was performed using molecular marker primers 617-F1 / R1 or 556-F1 / R1;

[0018] S3. After the amplification reaction is completed, electrophoresis detection is performed. If only one band appears, it is determined to be a female sample; if two bands appear, it is determined to be a male sample.

[0019] Preferably, the reaction system for PCR amplification is 10 μL, including 0.3 μL of Qinling salmon genomic DNA, 0.3 μL of upstream primer, 0.3 μL of downstream primer, 5 μL of RapidTaqMasterMix, and 4.1 μL of ddH2O.

[0020] Preferably, the reaction procedure of the PCR amplification is: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 40 s; annealing at 54°C for 30 s; extension at 72°C for 45 s; and extension at 72°C for 5 min after 35 cycles.

[0021] Preferably, when primer pair 617-F1 / R1 is used for amplification, two amplified bands with lengths of 245 bp and 122 bp appear in male samples; and only one amplified band with a length of 122 bp appears in female samples.

[0022] Preferably, when primer pair 556-F1 / R1 is used for amplification, two amplified bands appear in male samples, with lengths of 123 bp and 94 bp respectively; and only one band appears in female samples, with a length of 94 bp.

[0023] By adopting the above technical solution, the present invention has the following beneficial effects:

[0024] (1) Based on the whole genome resequencing data of male and female Qinling salmon, the present invention accurately and quickly screened out two male-specific molecular markers of Qinling salmon based on sequence alignment and mutation site identification, and designed and provided two pairs of male-specific primers, which can quickly and reliably identify the sex of Qinling salmon.

[0025] (2) The method for sex identification using male-specific primers for Qinling salmon established by the present invention only requires one PCR reaction to identify the sex of Qinling salmon; two pairs of primers can be used independently to identify the sex, which is time-saving, efficient and reliable. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Agarose gel electrophoresis diagram of sex differentiation of 68 female and 66 male Qinling salmon using primer pair 617-F1 / R1 and primer pair 556-F1 / R1.

[0027] Figure 2 The similarity analysis between the primer sequences used in the present invention and the primer sequences in the existing patents was performed.

[0028] Figure 3 The agarose gel electrophoresis diagrams of 7 pairs of primers that cannot effectively distinguish between sexes during the experiment of the present invention are shown. DETAILED DESCRIPTION

[0029] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0030] Example 1. Development of Molecular Marker Primers for the Male and Female Sex of Qinling Smelt Salmon

[0031] The present invention provides two pairs of molecular marker primers capable of identifying the sex of Qinling saury salmon. Each primer can identify the sex of Qinling saury salmon when used independently. The molecular marker primers for identifying the sex of Qinling saury salmon are obtained by the following method, which comprises the following steps:

[0032] 1. Sequencing library construction and resequencing

[0033] 1. DNA extraction of Qinling salmon

[0034] Use the ammonium acetate method to extract DNA. Cut a very small amount of fin rays, chop them up and lyse them, add Proteinase K and water bath until there is no residue. After cooling, add ammonium acetate, mix well and centrifuge, take the supernatant and add isopropanol to precipitate DNA. After centrifugation, wash with ethanol several times to remove impurities. Finally, dissolve the DNA, test the quality and concentration, and store it at -20℃ after dilution for later use.

[0035] 2. Using the whole genome resequencing data of 5 males and 5 females of Qinling salmon, based on sequence alignment and mutation site identification, the male-specific mutation sites of Qinling salmon were screened out, as shown in SEQ ID NO: 5 (123 bp) and SEQ ID NO: 6 (29 bp), respectively.

[0036] SEQ ID NO:5:

[0037] ACCGCTGTCACGTCCAGGCCTGAGAAGACAGGCTGGAGTGTTTA GTTTGTTTTAGGTGTAGGGGTTTTCTGTTCTAGGTTTTATATTTCTATGT TGGTCTGTCCCTATAGAAGATCGTGACA.

[0038] Primers were designed in the flanking regions of the mutant sequence, and the sequence information is as follows:

[0039] 617-F1: GTGGCACGCAGTGTAAAAAGGGTCT (SEQ ID NO: 1);

[0040] 617-R1: ATCAAACTAAAATGTCAACAGGCAG (SEQ ID NO: 2).

[0041] Another mutant sequence is:

[0042] TGCACATCTGGCATTTTGTTTTATACTAA (SEQ ID NO: 6).

[0043] Primers were designed in the flanking regions of the mutant sequence, and the sequence information is as follows:

[0044] 556-F1: CCTTTTCTTGTAGCAGTGGA (SEQ ID NO: 3);

[0045] 556-R1: ATGCTTTGTTTTGGTGATTT (SEQ ID NO: 4).

[0046] Example 2. Sex Identification of Qinling Salmon Using Molecular Marker Primers

[0047] This example uses the Qinling slender-scaled salmon sex molecular marker primers in Example 1 to identify the sex of Qinling slender-scaled salmon, and the steps are as follows:

[0048] (1) The above-mentioned Qinling salmon sex molecular marker primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0049] (2) The samples were collected from the Qinling Slimy Salmon domestication and breeding farm in Baiyunxia. The sex was determined based on the sperm or eggs produced by sexually mature parents used for artificial breeding. Finally, 68 female and 66 male Qinling Slimy Salmon were obtained. A very small amount of fin rays were cut from each, and DNA samples were prepared using the same ammonium acetate method.

[0050] (3) PCR amplification verification:

[0051] The DNA samples of 68 female Qinling salmon and 66 male Qinling salmon were verified by PCR using primer pair 617-F1 / R1 and primer pair 556-F1 / R1 respectively.

[0052] The total PCR amplification reaction system is 10 μL, including the following reagents:

[0053] Qinling salmon genomic DNA: 0.3 μL (15 ng);

[0054] Upstream primer: 0.3 μL (150 ng);

[0055] Downstream primer: 0.3 μL (150 ng);

[0056] 2×Rapid Taq MasterMix: 5μL;

[0057] ddH2O: 4.1 μL.

[0058] Rapid Taq MasterMix includes Taq DNA polymerase, dNTPs and reaction buffer, which were purchased from Shanghai Sangon Biotechnology Co., Ltd. After the reaction system was configured, a vortex oscillator was used to mix it thoroughly, and then a centrifuge was used to centrifuge the residual system on the tube wall into the solution at the bottom of the tube.

[0059] The PCR reaction program was as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 40 s; annealing at 54°C for 30 s; extension at 72°C for 45 s; and extension at 72°C for 5 min after 35 cycles.

[0060] After the PCR reaction is completed, agarose gel electrophoresis is performed. The gel electrophoresis detection is divided into 3 steps:

[0061] 1) Prepare 3% agarose gel, add 2 μL nucleic acid dye, and solidify at room temperature for 40 minutes;

[0062] 2) 5 μL of PCR product was spotted by wet method, followed by electrophoresis at 120 V for 50-80 min;

[0063] 3) When the DNA bands are clearly separated, image them using an electrophoresis gel imaging system, and analyze the male and female sex composition of the sample based on the imaging results.

[0064] The results are as follows Figure 1 As shown, the results show that both primer pairs produce two bands in male individuals and only one band in females. One band in males is the same length as that in females, and the other band is a male-specific band.

[0065] When the primer pair 617-F1 / R1 was used for amplification, the amplification products of the male sample were 245 bp and 122 bp, as shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively. The female sample only had one amplification band of 122 bp in length.

[0066] SEQ ID NO:7:GTGGCAGCAGTGTAAAAAGGGTCTTCCTAAAATC CCAAAATCTATAAAGATTATATTCTAATTTCACCGCTGTCACGTCCAGGCCTGAGAAGACAGGCTGGAGTGTTTAGTTTTGTTTTAGGTGTAGGGGTTTTCTGTTCTAGGTTTTATATTTCTATGTTGGTCTGTCCCTATAGAAGATCGTGACAACCGCTCATTTCTTGGCTGCACCCATGTGGACTGCCTGTTGACATTTTAGTTTGAT.

[0067] SEQ ID NO:8: GTGGCACGCAGTGTAAAAAGGGTCTTCCTAAAATCC CAAAATCTATAAAGATTATATTCTAATTTAACCGCTCATTTCTTGGCTGC ACCCATGTGGACTGCCTGTTGACATTTTAGTTTGAT.

[0068] When the primer pair 556-F1 / R was used for amplification, the amplification products of the male sample were 123 bp and 94 bp, respectively shown in SEQ ID NO: 9 and SEQ ID NO: 10. The female sample only had one amplification band of 94 bp in length.

[0069] SEQ ID NO:9: CCTTTTCTTGTAGCAGTGGAGCCACTGCACATCTGG CATTTTGTTTTATACTAAAAGTCTTGCAGAGTGAACAACTGAAACAAAT TTATGATATGACAAAAATAAATCACCAAAACAAAGCAT.

[0070] SEQ ID NO:10: CCTTTTCTTGTAGCAGTGGAGCCACAAGTCTTGCA GAGTGAACAACTGAAACAAATTTATGATATGACAAAAATAAATCACCA AAACAAAGCAT.

[0071] Example 3. Primer sequence difference analysis

[0072] The primer sequences of the present invention are significantly different from the primer sequences in the existing patent (CN 112646870A). Through ClustalW comparative analysis in MEGAX, it was found that the primer sequences used in the present invention have no significant similarity with the primer sequences in the existing patent at the sequence level ( Figure 2 ). Specifically, the selected primers had very low homology with known primers, indicating that the two sets of primers target significantly different gene regions and their specificity and cannot be used interchangeably. This sequence difference further proves the independence of the two at the molecular level.

[0073] Example 4

[0074] In the process of developing the molecular marker primers of the present invention, a total of 9 pairs of candidate primers were designed for systematic screening, and the two pairs of primers with the best effects (617-F1 / R1; 556-F1 / R1) were selected for sex marker identification ( Figure 1 ). These two pairs of primers showed good specificity and stability in the experiment and were able to achieve efficient gender differentiation. In contrast, the remaining 7 pairs of primers failed to achieve the expected results, showing poor sensitivity or stability and failing to effectively achieve the gender differentiation function ( Figure 3 ). By comparing with the preferred primers, it can be clearly seen that the primers used in the present invention have obvious advantages and can more efficiently meet the needs of gender identification.

[0075] It can be seen from the above embodiments that the present invention provides a molecular marker primer, a kit and an application thereof for identifying the sex of Qinling smelt salmon, which can achieve accurate sex distinction of Qinling smelt salmon.

[0076] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A molecular marker primer for identifying the sex of Qinling salmon, characterized in that: It includes a primer pair 617-F1 / R1, the nucleotide sequence of the upstream primer 617-F1 is shown as SEQ ID NO:1, and the nucleotide sequence of the downstream primer 617-R1 is shown as SEQ ID NO:

2.

2. Molecular marker primers for identifying the sex of Qinling salmon, characterized in that: It includes a primer pair 556-F1 / R1, the nucleotide sequence of the upstream primer 556-F1 is shown in SEQ ID NO:3, and the nucleotide sequence of the downstream primer 556-R1 is shown in SEQ ID NO:

4.

3. Use of the molecular marker primer according to claim 1 or 2 in at least one of the following: (1) Application in sex identification or screening of Qinling salmon; (2) Application in Qinling salmon breeding; (3) Application in the preparation of products for sex identification of Qinling salmon.

4. A kit for identifying the sex of Qinling salmon, characterized in that: Comprising the molecular marker primer according to claim 1 or 2.

5. A method for identifying the sex of Qinling salmon, characterized in that: The following steps are involved: S1. extracting genomic DNA of the tested Qinling salmon; S2. Using the genomic DNA of Qinling salmon to be tested as a template, PCR amplification was performed using the molecular marker primers according to claim 1 or 2; S3. After the amplification reaction is completed, electrophoresis detection is performed. If only one band appears, it is determined to be a female sample; if two bands appear, it is determined to be a male sample.

6. The method according to claim 5, characterized in that The reaction system of the PCR amplification is 10 μL, including 0.3 μL of Qinling salmon genomic DNA, 0.3 μL of upstream primer, 0.3 μL of downstream primer, 5 μL of Rapid Taq MasterMix, and 4.1 μL of ddH2O.

7. The method according to claim 5, characterized in that The reaction procedure of the PCR amplification is: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 40 s; annealing at 54°C for 30 s; extension at 72°C for 45 s; and extension at 72°C for 5 min after 35 cycles.

8. The method according to claim 5, characterized in that If primer pair 617-F1 / R1 is used for amplification, two amplified bands with lengths of 245 bp and 122 bp appear in male samples; only one amplified band with a length of 122 bp appears in female samples.

9. The method according to claim 5, characterized in that If primer pair 556-F1 / R1 is used for amplification, two amplified bands will appear in male samples, with lengths of 123bp and 94bp respectively; only one band will appear in female samples, with a length of 94bp.

Images