Application of topoisomerase TOP1 in diagnosis, prognosis and treatment of head and neck cancer

Abstract

The invention discloses an application of a reagent for detecting biomarker topoisomerase TOP1 expression in preparation of a product for diagnosis or prognosis of a head and neck cancer object, an application of TOP1 as a target in screening of a medicine for treating head and neck cancer, and an application of a TOP1 expression inhibitor in preparation of a medicine for treating head and neck cancer. The invention provides a new marker and a therapeutic target TOP1 for diagnosis and prognosis of the head and neck cancer, and provides a new reference for a precise tumor treatment scheme; a certain reference value is provided for further subsequent exploration of the specific action mechanism of TOP1 for promoting HNSCC cell functions, and a new thought is provided for research of head and neck cancer pathogenesis and treatment strategies.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to the application of topoisomerase TOP1 in the diagnosis, prognosis and treatment of head and neck cancer. Background Art

[0002] Topoisomerase I (TOP1) plays an important biological role in regulating DNA replication, maintaining genome stability and transcription by acting on DNA breaks and reconnections, releasing the super-coiled and torsional tension generated during DNA replication or transcription. Animal experiments have found that knocking out TOP1 in excitatory synaptic cells in the cerebral cortex of mice can lead to early-onset neurological degeneration in mice. Recent clinical studies have shown that TOP1 is abnormally expressed or mutated in a variety of solid tumors such as cervical cancer and ovarian cancer. Its high expression is associated with poor prognosis in patients with cancers such as cervical cancer and ovarian cancer, and is significantly associated with a shorter overall survival in patients with serous ovarian cancer. Although TOP1-specific inhibitors topotecan (TPT) or camptothecin (CPT) have been approved by the US FDA for the treatment of human lung cancer, ovarian cancer and colon cancer, they still have high cytotoxicity and their mechanism of action is not very clear. At present, little is known about the function of TOP1 in head and neck squamous cell carcinoma (HNSCC).

[0003] HNSCC is the most common malignant tumor of the head and neck, mainly occurring on the mucosal surfaces of four anatomical sites: oral cavity, nasal cavity, pharynx and larynx. The main risk factors for HNSCC are smoking, drinking and human papillomavirus (HPV) infection. 64% of patients have already progressed to the advanced stage at the time of diagnosis, and the prognosis is very poor. The 5-year overall survival rate of patients with head and neck squamous cell carcinoma is less than 40%, and for patients with recurrence or metastasis, the 5-year survival rate is less than 5%. HNSCC has highly inflammatory characteristics and expresses a variety of cytokines and growth factors related to inflammation. Higher expression levels of interleukin 6 (IL-6), IL-8, IL-1β, vascular endothelial growth factor (VEGF) and tumor necrosis factor α (TNFα) were found in the serum of HNSCC patients. Brunotto et al. found that the polymorphic expression of inflammation-related genes (IRGs) is associated with the occurrence of nasopharyngeal squamous cell carcinoma and plays a vital role in the development of nasopharyngeal carcinoma. In addition, the level of interferon-gamma-induced protein 10 (IP-10, or CXCL10) in the plasma of patients with early oral squamous cell carcinoma (OSCC) is higher. However, whether the high inflammation of HNSCC is related to TOP1 and whether inflammatory factors play an important role in the occurrence and development of HNSCC need to be further understood.

[0004] As an important protein in the DNA damage response (DDR), the TOP1-DNA covalent complex (TOP1cc) is a short-lived catalytic intermediate under normal physiological conditions. However, if the catalytic activity of TOP1 is inactivated, TOP1 will be captured at the 3′-DNA end, resulting in protein-linked DNA single-strand breaks, which in turn cause DNA double-strand breaks, further leading to the activation of repair proteins that sense DNA damage, such as ATM, ATR, and PARP. However, the non-DDR function of TOP1 is unclear. Previous studies have shown that the DNA damage response and inflammation are closely linked and influence each other, and play an important role in the occurrence and development of cancer. Inflammation increases during aging, and chronic inflammation is often the basis for the development and progression of cancer. For example, in a progeroid animal model, it was observed that ATM activation caused by DNA damage repair signals is an important factor in triggering histone post-translational modification, leading to upregulation of proinflammatory cytokine transcription, increasing inflammatory cytokine secretion, and inducing inflammatory response. ATM can also achieve the generation of the senescence-associated secretory phenotype (SASP) by activating the NF-κB pathway. In HPV-positive cells, ATR activation inhibits gene expression in the immune response pathway, including many inflammatory genes and IFN-κ. PARP1 is usually activated by DNA damage, and one of the main functions of PARP1 is to regulate the inflammatory process as a transcriptional coactivator / co-repressor. For example, PARP1 can enhance the expression of CXCL1 by directly binding to its promoter region. In addition, PARP1 has a pro-inflammatory function in activated T cells. The interaction between nuclear factor of activated T cells (NFAT) and PARP1 promotes the transcription of IL-2. However, the specific mechanism of how TOP1 regulates the inflammatory response in HNSCC is still unknown. Summary of the invention

[0005] The purpose of the present invention is to provide an application of topoisomerase TOP1 in the diagnosis, prognosis and treatment of head and neck cancer in view of the above problems.

[0006] In order to achieve its purpose, the present invention adopts the following technical solution:

[0007] A first aspect of the present invention provides a use of a reagent for detecting the expression of a biomarker topoisomerase TOP1 in the preparation of a product for diagnosing or prognosing a subject with head and neck cancer.

[0008] The diagnostic method comprises: obtaining a test sample from a subject suspected of having head and neck cancer, determining the expression level of TOP1 in the test sample, and if TOP1 is highly expressed compared with a normal control, indicating that the subject is a head and neck cancer patient.

[0009] The prognosis method comprises: obtaining a test sample from a subject suffering from head and neck cancer, determining the expression level of TOP1 in the test sample, and patients with high TOP1 expression have a poor prognosis and a significantly shorter overall survival period than patients with low TOP1 expression.

[0010] The second aspect of the present invention provides the use of topoisomerase TOP1 as a target in screening drugs for treating head and neck cancer.

[0011] The drug inhibits the expression of TOP1, thereby inhibiting the proliferation, proliferation and invasion ability of head and neck cancer cells, inhibiting the malignant tumor-forming ability of head and neck cancer cells, and thus slowing down or preventing the development of head and neck cancer.

[0012] In the above-mentioned application technology scheme, inhibiting the expression of TOP1 activates the DNA damage response in head and neck cancer cells, and TOP1 is involved in the inflammatory response in head and neck cancer.

[0013] The third aspect of the present invention provides the use of a topoisomerase TOP1 expression inhibitor in the preparation of a drug for treating head and neck cancer.

[0014] The expression inhibitor is selected from nucleic acid molecules, protein molecules or small molecule compounds.

[0015] The nucleic acid molecule includes shRNA, and the shRNA is shTOP1#1, shTOP1#2 or shTOP1#3. The nucleotide sequence of the shRNA is as follows:

[0016] shTOP1#1: GCTTCTCTAGTCCACCACAAA;

[0017] shTOP1#2: CAGAGTTGGATGGTCAGGAAT;

[0018] shTOP1#3: CGACCATGAATATACTACCAA.

[0019] In any of the above application technology solutions, the head and neck cancer is head and neck squamous cell carcinoma.

[0020] The beneficial effects of the present invention are:

[0021] The present invention shows that inhibiting the expression of TOP1 activates the DNA damage response in head and neck squamous cell carcinoma cells. TOP1 regulates the occurrence and development of HNSCC by promoting cancer-related inflammatory responses. The elucidation of this function and its mechanism will be a key to exploring the cause of HNSCC's highly inflammatory state. The present invention provides a new marker and therapeutic target - TOP1 for the diagnosis and prognosis of head and neck cancer, and provides a new reference for precise tumor treatment. It provides a certain reference value for further exploring the specific mechanism of action of TOP1 in promoting HNSCC cell function, and provides new ideas for studying the pathogenesis and treatment strategies of head and neck cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The results of analyzing the expression of TOP1 in head and neck squamous cell carcinoma and its clinical relevance using the CPTAC and GEPIA databases are shown.

[0023] Figure 2 The expression of TOP1 in head and neck squamous cell carcinoma cell lines is shown.

[0024] Figure 3 The results of TOP1 protein and mRNA level detection in the constructed head and neck squamous cell carcinoma cell line with stable TOP1 knockdown are shown.

[0025] Figure 4 The results show that the EdU experiment was used to detect the effect of TOP1 on cell proliferation ability, the scratch experiment was used to detect the migration ability of head and neck squamous cell carcinoma cells, and the Transwell experiment was used to detect the migration and invasion ability of head and neck squamous cell carcinoma cells.

[0026] Figure 5 showed that inhibition of TOP1 expression activated the DNA damage response in head and neck squamous cell carcinoma cells.

[0027] Figure 6 RNA-seq sequencing analysis revealed that TOP1 may be involved in the inflammatory response in head and neck squamous cell carcinoma. DETAILED DESCRIPTION

[0028] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0029] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0030] Example 1

[0031] 1 Experimental Materials and Reagents

[0032] 1.1 Cells

[0033] Cells NOK, SCC15, and SCC47 were cultured in DMEM medium containing 10% FBS. Human embryonic kidney cells 293T were provided by the research group of Associate Professor Mu Dan from the School of Life Sciences of Chongqing Medical University and were cultured in high-glucose DMEM containing 10% FBS.

[0034] 1.2TOP1 shRNA sequence

[0035] shRNA Sequence (5'-3') SEQ ID NO sh-NC TTCTCCGAACGTGTCACGT SEQ ID NO.1 shTOP1#1 GCTTCTCTAGTCCACCACAAA SEQ ID NO.2 shTOP1#2 CAGAGTTGGATGGTCAGGAAT SEQ ID NO.3 shTOP1#3 CGACCATGAATATACTACCAA SEQ ID NO.4

[0036] 1.3 PCR primers

[0037]

[0038]

[0039] 1.4 Main reagents and consumables

[0040]

[0041]

[0042] 2 Experimental methods

[0043] 2.1 Analysis of public databases

[0044] Gene expression analysis was performed using the Kaplan-Meier Plotter database (https: / / kmplot.com / analysis / ). Select "compare normal and tumor", select "TN-plot:compare Tumor and Normal" in "Gene expression comparison", enter "TOP1" in "choose a gene", and click "Start Analysis" to obtain the box plot and violin plot of TOP1 expression in normal and head and neck cancer tissues.

[0045] Use the GEPIA database (http: / / gepia.cancer-pku.cn / index.html) to perform survival analysis, enter "TOP1", select "Survival plots" in "Survival", select "Overall Survival" in "Methods", select "Quartile" in "Group Cutoff", select "HNSC" in "Cancer name", and click "Plot" to obtain the survival difference analysis of TOP1 in normal and head and neck cancer tissues.

[0046] The Human Protein Atlas database (https: / / www.proteinatlas.org / ) was used to analyze the expression of TOP1 in normal and cancer tissue sections of patients with head and neck squamous cell carcinoma. Enter "TOP1", click "Search", click "TOP1", select "Cancer", and select "HEAD AND NECK CANCER" in the list on the left. Scroll down to "HEAD AND NECK CANCER-Protein expression", click on the tissue section to enter, and download the tissue section staining images of TOP1 in "Normal tissue" and "Squamous cell carcinoma".

[0047] 2.2 Cell culture: conventional methods.

[0048] 2.3qPCR

[0049] Cellular RNA was extracted, reverse transcribed into cDNA, and then subjected to qPCR.

[0050] (1) Using β-actin as the internal reference and the cDNA obtained by reverse transcription as the template for the reaction, set up three replicate wells for each group of samples and prepare the reaction system on ice according to the components listed in the following table.

[0051]

[0052] (2) The qPCR program was set as follows:

[0053]

[0054] (3) Result processing:

[0055] The Ct value of the target gene and the Ct value of β-actin were obtained according to the qPCR reaction, and the relative mRNA expression of the target gene in each group of cells was calculated using the 2-ΔΔCt calculation method.

[0056] 2.4 Western blot

[0057] 2.4.1 Collecting cell pellets

[0058] Remove the culture dish and observe under the microscope. When the cell confluence reaches 80% or above, discard the culture medium, wash once with PBS and discard. Add trypsin and digest in the cell culture incubator for 4 minutes, then add 2 times the volume of culture medium of trypsin to terminate the digestion, collect the cell suspension in a 15mL centrifuge tube, centrifuge at 850rpm for 4 minutes. Discard the supernatant, resuspend the precipitate with 1mL PBS, collect in a 1.5mL EP tube, centrifuge at 4℃, 3000rpm for 5 minutes, and discard the supernatant.

[0059] 2.4.2 Cell lysis and protein extraction

[0060] 2.4.3 BCA protein quantification

[0061] 2.4.4 According to the calculated protein concentration and its volume, adjust the sample concentration to the minimum concentration and dilute with RIPA lysis buffer to make each sample of equal concentration.

[0062] 2.4.5 Preparation of electrophoresis fluid

[0063] (1) Prepare the running buffer (1x, 1L) as shown in the following table:

[0064] Components Mass / Volume Tris 3.03g Glycine 14.4g SDS 1g <![CDATA[ddH2O]]> Make up to 1L

[0065] (2) Prepare transfer buffer (1x, 1L) as shown in the following table:

[0066] Components Mass / Volume Tris 3.03g Glycine 14.4g Methanol 200mL <![CDATA[ddH2O]]> Make up to 1L

[0067] (3) Prepare TBST (1x, 1 L) according to the following table:

[0068] Components Mass / Volume Tris 2.42g NaCl 8.8g hydrochloric acid 1.5mL Twain 1mL <![CDATA[ddH2O]]> Make up to 1L

[0069] (4) Prepare the blocking solution according to the following table:

[0070] Components Mass / Volume Skim milk powder 2.5g <![CDATA[ddH2O]]> 50mL

[0071] 2.4.6 Preparation of separation gel and concentrated gel

[0072] (1) Take equal volumes of lower gel solution and lower gel buffer, 2.0 / 2.7 / 4.0 mL respectively, and mix well;

[0073] (2) Add 40 / 60 / 80 μL of the improved coagulant to the mixed solution of step 1 and mix well;

[0074] (3) Pour the mixed solution from step 2 into the glass plate for making glue, so that the distance between the liquid surface and the upper edge of the short glass plate is 0.5 cm longer than the comb teeth (note: this solution is excessive, do not inject all of it, and leave a little in the glue cup to judge the solidification status of the glue), add appropriate amount of water or alcohol (such as isopropyl alcohol, n-butanol, etc.) to cover the lower layer of glue;

[0075] (4) After the lower layer of gel solidifies (about 5 to 10 minutes), pour off the upper layer of water or alcohol;

[0076] Note: When there is a refraction line between water (alcohol) and glue, it means the glue has solidified.

[0077] (5) Take equal volumes of upper gel solution and colored upper gel buffer, 0.5 / 0.75 / 1.0 mL respectively, and mix well; Note:

[0078] Due to the special physical and chemical properties of the dye, please shake well before use.

[0079] (6) Add 10 / 15 / 20 μL of the improved coagulant to the mixed solution in step 5 and mix well;

[0080] (7) injecting the mixed solution of step 6 into the glass plate and inserting the comb teeth;

[0081] (8) After the upper layer of gel solidifies (about 10 to 15 minutes), remove the comb teeth and use it for electrophoresis.

[0082] 2.4.7 Electrophoresis

[0083] Assemble the prepared SDS-PAGE gel in the Bio-Rad electrophoresis system, add the prepared electrophoresis solution, load 20-30ug protein and 2-3μL marker in each lane, adjust the voltage to 80V for 30min; 120V, start electrophoresis for 60min. When the protein loading and marker reach the bottom of the lower gel, end the electrophoresis.

[0084] 2.4.8 Transfer

[0085] Prepare a transfer tray, pour in pre-cooled transfer solution, carefully cut the separation gel and immerse it in the transfer solution, pre-soak the PVDF membrane in methanol for 1 minute for activation, and then transfer it to the transfer solution. At the same time, prepare sponges and filter paper, and place the white plate anode - sponge - filter paper - PVDF membrane - separation gel - filter paper - sponge - black plate cathode in the "sandwich" order, assemble it into the wet transfer system, add an ice box, fill it with pre-cooled transfer solution, adjust the voltage to 100V, and start the transfer after 100 minutes.

[0086] 2.4.9 Closure

[0087] After the transfer was completed, the PVDF membrane was taken out and soaked in TBST to remove the transfer solution on the surface, and then placed in 5% skim milk (5.0 g skim milk powder + 100 mL TBST mixed), and placed on a shaker for blocking at room temperature for 60 minutes.

[0088] 2.4.10 Incubation with primary antibody

[0089] Take out the blocked PVDF membrane, rinse it in TBST, cut the membrane according to the marker, add the primary antibody and incubate it on a shaker at 4°C overnight: TOP1 (Bethy, 1:2000, rabbit source), β-Actin (Proteintech, 1:5000, mouse source) or GAPDH (Proteintech, 1:5000, mouse source). The next day, after recovering the primary antibody, wash the membrane three times with TBST at room temperature (10 min / time).

[0090] 2.4.11 Incubation with secondary antibody

[0091] The membrane was incubated on a shaker at room temperature for 60 min with goat anti-rabbit (KPL, 1:5000) goat anti-mouse (KPL, 1:2000) horseradish peroxidase (HRP) labeled secondary antibody and washed three times with TBST at room temperature (10 min / time).

[0092] 2.4.12 Development

[0093] Add the prepared ultra-sensitive ECL chemiluminescent solution to the target strip and detect the chemiluminescent signal on the Image Quant TM LAS 50 instrument.

[0094] 2.5 Lentiviral packaging

[0095] (1) Cell plating: Digest HEK 293T cells in the logarithmic growth phase with trypsin digestion solution, add culture medium to resuspend, take 1 / 5 of the total volume of the suspension and plating it in a 6 cm culture dish, and add complete culture medium.

[0096] (2) After culturing for about 24 hours, lentiviral packaging was performed according to the following system.

[0097] Reagent A Dosage pMD2.G 0.5 μg psPAX2 2.25 μg Empty plasmid / target plasmid 2.25 μg No FBSDMEM 250μL

[0098] Reagent B Dosage PEI 15μL No FBSDMEM 250μL

[0099] After preparing the above two reagents respectively, let them stand at room temperature for 5 minutes.

[0100] (3) Mix the prepared reagents A and B together, pipette and pump for more than 15 times to mix them thoroughly. Let stand at room temperature for 15 minutes to allow the PEI transfection reagent and the added plasmid to fully combine.

[0101] (4) Add 500 μl of the above mixture to the culture dish containing HEK 293T cells, cross-mix in a biosafety cabinet, and place in a 37°C incubator for culture. Replace with new culture medium after 6-8 hours.

[0102] (5) 48h and 72h after transfection, transfer all the cell supernatant into a 15mL centrifuge tube, centrifuge at 4℃ and 1000rpm for 5 minutes, retain the supernatant, and filter it with a 0.22uM filter. Then divide the virus supernatant into sterile 1.5mL EP tubes and store them in a -80℃ refrigerator.

[0103] 2.6 Lentiviral infection and construction of stable cell lines

[0104] (1) Cell plating: Digest SCC15 and SCC47 cells in the logarithmic growth phase, add culture medium to make a cell suspension, and plate approximately 1.25 × 106 cells in a 6 cm culture dish.

[0105] (2) Infection with lentivirus: After 24 hours, when the cell density is about 40-50%, place the virus supernatant on ice to melt, aspirate the original culture medium, and then add 2.75 mL of new complete culture medium and 1.25 mL of virus supernatant to the cell culture dish, and add 5 μl of 1 mg / mL polybrene. Cross-mix and place in a 37°C cell culture incubator for continued culture. Replace with new culture medium after 6-8 hours.

[0106] (3) Resistance screening: 48 hours after the cells were infected with the lentivirus, the culture medium was replaced with complete culture medium containing puromycin (SCC15: 1 μg / μL and SCC47: 40 μg / μL). The cells were screened for resistance using puromycin. The screening lasted for about a week. When no cells continued to die, a stable cell line was obtained and could be used for subsequent experiments.

[0107] 2.7 Transwell cell migration and invasion assay

[0108] 2.8 Scratch test

[0109] 2.9 Comet assay (single cell gel electrophoresis)

[0110] (1) Use the comet assay kit (Trevigen, 4250-050-K). Before the experiment, you need to prepare: PBS (without Ca 2+ and Mg 2+ ), lysis buffer (pre-cooled at 4°C for at least 0.5h), low melting point agarose LMA (heated in a water bath until melted and then kept warm at 37°C), Gold staining solution (diluted with DMSO and stored at 4°C away from light).

[0111] (2) Preparation of cell samples: PBS containing 1x 105 / ml cells and pre-melted low-melting-point agarose LMA were mixed at 37°C in a volume ratio of 1:10. Then 50 μL of LMA containing cells was dripped onto the frosted surface of a preheated slide and placed at 4°C for 30 min-45 min to solidify.

[0112] (3) Immerse the slides in 4°C pre-cooled cell lysis buffer and incubate overnight.

[0113] (4) DNA unwinding: After cell lysis, remove the slide and rinse twice with PBS to remove the high concentration of salt on the slide surface. Then place the slide in neutral electrophoresis buffer for 0.5 h to allow the DNA to unwind and form single-stranded DNA, which is easy to migrate in the electrophoresis field.

[0114] (5) Single cell electrophoresis: Prepare Comet ES device, add 850mL of freshly prepared 4℃ pre-cooled electrophoresis buffer to the electrophoresis tank, ensuring that the liquid surface covers the slide by 0.5cm. Set the electrophoresis condition at 21V and 4℃ for 45min.

[0115] (6) DNA precipitation: After electrophoresis, the electrophoresis buffer remaining on the outside of the slide is absorbed with filter paper, and the slide is immersed in the DNA precipitation solution for 0.5 h.

[0116] (7) Gold staining: Immerse the slides in 70% ethanol and incubate at room temperature for 0.5 h. Dry the slides at 37°C for 10-15 min. Then drop 100 μL of the diluted Gold staining solution was used for staining at room temperature in the dark for 0.5 h. The SYRB staining solution on the edge of the sample was washed off with distilled water, and the slides were placed in a 37°C incubator to dry.

[0117] (8) Observation of experimental results and data processing: The slides were observed and images were collected under an upright fluorescence microscope. The CASP comet analysis software was used to analyze the comet tail DNA percentage, tail length, comet length, tail moment, and Olive tail moment to evaluate the cellular comet formation rate.

[0118] 2.10 Cell Immunofluorescence

[0119] (1) Cell preparation: Prepare monolayer cells SCC15 and SCC47 in the logarithmic growth phase, digest them with 0.25% trypsin to make a single cell suspension, count the cells, take 2×105 / ml and plate them in a confocal chamber, and return them to a 37°C incubator with 5% CO2 and incubate overnight.

[0120] (2) Cell fixation: When cells are completely attached and the cell confluence reaches about 50%, discard the culture medium, rinse with PBS 1-2 times, add 1 mL of 4% paraformaldehyde (PFA) and incubate the cells at room temperature for 10-15 minutes. Wash the cells 3 times with ice PBS (3 minutes / time).

[0121] (3) Cell permeabilization: Add 0.3% Triton X-1000 (diluted with PBS) to permeabilize the cells for 10-15 min. Then wash the cells 3 times with PBS (3 min / time).

[0122] (4) Blocking and immunostaining: Add immunostaining blocking solution to the cells and incubate the cells at room temperature for 0.5 h to block the nonspecific binding of the antibody.

[0123] (5) Primary antibody incubation: Refer to the antibody instructions, select heterologous (mouse, rabbit) double-labeled) dilutions of the above two antibodies, add them dropwise on the cell surface and incubate at 4°C overnight.

[0124] (6) On the next day, the primary antibody was recovered and the cells were washed three times with PBS (3 min / time).

[0125] (7) Secondary antibody incubation: Incubate the cells with secondary antibodies from the same source as the primary antibodies (goat anti-mouse 488 1:2000, goat anti-rabbit 1:500) at room temperature in the dark for 1 h.

[0126] (8) Discard the secondary antibody and wash the cells three times (3 min / time) with PBS in the dark.

[0127] (9) DAPI nuclear staining and sealing: DAPI was added to the cells for nuclear staining, and anti-quenching agent was added for sealing. The cells were stored at 4°C in the dark.

[0128] (10) Image acquisition and analysis of experimental results: The confocal dish was placed under a laser confocal microscope for observation. The images were acquired using Nikon NIS-Elements Viewer software. When quantitative analysis was performed using Image J software, the DAPI (blue) + (red or green) fluorescence single channel was segmented and the original color image format was converted, that is, the fluorescence intensity was converted to grayscale. Under a certain segmentation threshold, the Area and Mean gray value indicators were measured.

[0129] 2.11Edu proliferation experiment (APEXBIO, K1075).

[0130] 3 Experimental results

[0131] 3.1 Expression of TOP1 in head and neck squamous cell carcinoma and its clinical relevance

[0132] In the previous research, we found through the CPTAC database that TOP1 is highly expressed in various cancer data ( Figure 1 A). In order to explore the role of TOP1 in head and neck squamous cell carcinoma, the expression level of TOP1 in normal group and head and neck squamous cell carcinoma was first analyzed by Kaplan-Meier plotter. The results showed that the expression of TOP1 in cancer group was significantly higher than that in normal tissue ( Figure 1 B, C). GEPIA was used to analyze the survival prognosis of 129 patients with head and neck squamous cell carcinoma with low TOP1 expression and 130 patients with head and neck squamous cell carcinoma with high TOP1 expression. The results showed that the overall survival of patients with head and neck squamous cell carcinoma with high TOP1 expression was significantly shorter than that of patients with low TOP1 expression, indicating that high expression of TOP1 is positively correlated with poor prognosis of patients with head and neck squamous cell carcinoma ( Figure 1 D). The Human Protein Atlas website was used to analyze the protein expression levels of TOP1 in normal tissues and cancer tissues of the same head and neck squamous cell carcinoma patient. The results showed that the expression level of TOP1 in cancer tissues was significantly higher than that in normal tissues ( Figure 1 E). The above results indicate that TOP1 is highly expressed in head and neck squamous cell carcinoma and is positively correlated with the poor prognosis of patients with head and neck squamous cell carcinoma.

[0133] 3.2 Expression of TOP1 in head and neck squamous cell carcinoma cell lines

[0134] The mRNA levels of TOP1 in NOK (normal human squamous epithelial cells) and SCC15 and SCC47 were detected by q-PCR. The results showed that the mRNA levels of TOP1 in head and neck squamous cell carcinoma cell lines SCC15 and SCC47 were significantly higher than those in control cells NOK ( Figure 2 A). Western Blot was used to detect the protein level of TOP1 in NOK (normal human squamous epithelial cells) and SCC15 and SCC47. The results showed that the protein level of TOP1 in head and neck squamous cell carcinoma cell lines SCC15 and SCC47 was higher than that in control cells NOK ( Figure 2 B). The above results showed that compared with NOK cells, TOP1 mRNA and protein levels were highly expressed in head and neck squamous cell carcinoma cell lines.

[0135] 3.3 Construction of head and neck squamous cell carcinoma cell line with stable knockdown of TOP1 by lentiviral infection

[0136] Western Blot was used to detect the protein level of TOP1 in the head and neck squamous cell carcinoma cell line with stable knockdown of TOP1. The results showed that compared with the negative control group cells, the TOP1 protein level in the knockdown cell group was significantly reduced ( Figure 3 A); q-PCR was used to detect the mRNA level of TOP1 in the head and neck squamous cell carcinoma cell line with stable knockdown of TOP1. The results showed that compared with the negative control group cells, the TOP1 mRNA level in the knockdown cell group was significantly reduced ( Figure 3 B). The above results indicate that a head and neck squamous cell carcinoma cell line with stable knockdown of TOP1 was successfully constructed.

[0137] 3.4 Knockdown of TOP1 inhibits the malignant tumorigenicity of head and neck squamous cell carcinoma cells

[0138] The effect of TOP1 on cell proliferation was detected by EdU experiment. The results showed that compared with the control group, the red fluorescence of Cy3, which represents DNA replication ability, was significantly weakened in the TOP1 knockdown cell group, indicating that knockdown of TOP1 significantly inhibited the proliferation ability of head and neck squamous cell carcinoma cell lines ( Figure 4 A). The scratch test showed that the relative migration area of ​​the TOP1 knockdown cell group was significantly larger than that of the control group, indicating that knockdown of TOP1 inhibited the migration ability of head and neck squamous cell carcinoma cells ( Figure 4 B). Transwell experiments showed that the number of cells in the TOP1 knockdown group that passed through the upper chamber to the lower chamber was significantly less than that in the control group, indicating that knockdown of TOP1 inhibited the migration and invasion ability of head and neck squamous cell carcinoma cells ( Figure 4 C). The above results indicate that knocking down TOP1 inhibits the malignant tumorigenicity of head and neck squamous cell carcinoma cells.

[0139] 3.5 Inhibition of TOP1 expression activates DNA damage response in head and neck squamous cell carcinoma cells

[0140] Western Blot was used to detect whether the two classic DDR pathways, ATR and ATM, were activated in SCC15 and SCC47 cells with TOP1 knockdown. The results showed that in SCC15 cells, knockdown of TOP1 activated the ATR pathway; in SCC47 cells, knockdown of TOP1 activated the ATM pathway ( Figure 5 A). γ-H2AX is a classic indicator of DNA damage. The protein level of γ-H2AX in head and neck squamous cell carcinoma cells with TOP1 knockdown was detected by Western blot. The results showed that the protein level of γ-H2AX increased after TOP1 knockdown in SCC15 cells; on the contrary, the protein level of γ-H2AX decreased after TOP1 knockdown in SCC47 cells ( Figure 5 B). Neutral comet assay was used to detect DNA damage in head and neck squamous cell carcinoma cells with TOP1 knockdown. The results showed that compared with the control group, the DNA migration distance in SCC15 cells with TOP1 knockdown was longer and DNA damage increased; on the contrary, compared with the control group, the DNA migration distance in SCC47 cells with TOP1 knockdown was shorter and DNA damage was reduced ( Figure 5 C). Finally, immunofluorescence staining was used to verify the γ-H2AX fluorescence in SCC15 and SCC47 cells with TOP1 knockdown. The results were consistent with the results of western blot and neutral comet assay ( Figure 5D). The above results indicate that inhibiting the expression of TOP1 in SCC15 and SCC47 cells activated the DNA damage response through different pathways, and the underlying mechanism needs to be further explored.

[0141] 3.6 RNA-seq sequencing analysis revealed that TOP1 may be involved in the inflammatory response in head and neck squamous cell carcinoma

[0142] RNA sequencing was performed on head and neck squamous cell carcinoma cells with TOP1 knockdown ( Figure 6 A), the sequencing results were analyzed, and GO pathway enrichment analysis was performed on the differentially expressed genes after knockdown of TOP1 in SCC15 and SCC47 cells. It was found that some pathways of cytokines related to inflammation were activated ( Figure 6 B). The volcano plot was used to mark the inflammatory factors that were positively regulated after TOP1 knockdown in SCC15 and SCC47 cells ( Figure 6 C). The mRNA levels of some inflammatory factors were verified by q-PCR ( Figure 6 D), the results showed that the mRNA levels of some inflammatory factors were downregulated, indicating that they were positively regulated by TOP1.

Claims

1. Use of a reagent for detecting the expression of the biomarker topoisomerase TOP1 in the preparation of a product for diagnosing or prognosing a subject with head and neck cancer.

2. The use according to claim 1, characterized in that: The diagnostic method comprises: obtaining a test sample from a subject suspected of having head and neck cancer, determining the expression level of TOP1 in the test sample, and if TOP1 is highly expressed compared with a normal control, indicating that the subject is a head and neck cancer patient.

3. The use according to claim 1, characterized in that: The prognosis method comprises: obtaining a test sample from a subject suffering from head and neck cancer, determining the expression level of TOP1 in the test sample, and patients with high TOP1 expression have a poor prognosis and a significantly shorter overall survival period than patients with low TOP1 expression.

4. Application of topoisomerase TOP1 as a target in screening drugs for the treatment of head and neck cancer.

5. The use according to claim 4, characterized in that: The drug inhibits the expression of TOP1, thereby inhibiting the proliferation, proliferation and invasion ability of head and neck cancer cells, inhibiting the malignant tumor-forming ability of head and neck cancer cells, and thus slowing down or preventing the development of head and neck cancer.

6. The use according to claim 5, characterized in that: Inhibition of TOP1 expression activates the DNA damage response in head and neck cancer cells, and TOP1 is involved in the inflammatory response in head and neck cancer.

7. Application of topoisomerase TOP1 expression inhibitor in the preparation of drugs for the treatment of head and neck cancer.

8. The use according to claim 7, characterized in that: The expression inhibitor is selected from nucleic acid molecules, protein molecules or small molecule compounds.

9. The use according to claim 8, characterized in that: The nucleic acid molecule includes shRNA, and the shRNA is shTOP1#1, shTOP1#2 or shTOP1#3. The nucleotide sequence of the shRNA is as follows: shTOP1#1: GCTTCTCTAGTCCACCACAAA; shTOP1#2: CAGAGTTGGATGGTCAGGAAT; shTOP1#3: CGACCATGAATATACTACCAA.

10. The use according to any one of claims 1 to 9, characterized in that: The head and neck cancer is head and neck squamous cell carcinoma.

Images