Application of genetic marker associated with body size character of chicken in genetic breeding

Abstract

The invention belongs to the technical field of biology, and discloses an application of a genetic marker associated with the body size character of a chicken in genetic breeding, and the molecular marker is an SNP1 site and an SNP3 site of a Hes5B gene; the SNP1 locus is g.1408791 Tgt, and the SNP1 locus is g.1408791 Tgt; the SNP3 site is a C site, and the SNP3 site is g.1409422Tgt; and a C site. According to the application, the three SNP loci of the Hes5B gene are analyzed, the relationship between the SNP1 locus and the SNP3 locus and the body size character of the chicken and the relationship between different loci, genotypes and haplotype combinations of the different loci and the sizes and shapes of cocks and hens are determined, and a guiding effect is provided for genetic breeding related to the body size character of the chicken. Meanwhile, the invention also provides a primer and a kit for realizing the application.

Description

Technical Field

[0001] The present application relates to the biological field, and specifically to the application of genetic markers associated with the body size traits of chickens in genetic breeding. Background Art

[0002] In the prior art, the relevant literature on genetic markers associated with chicken body size traits can be found as follows:

[0003] Publication No. CN116949190A, the subject of which is a patent application for a SNP molecular marker, detection primer, kit and breeding method related to chicken growth, body size and carcass traits, which discloses a SNP site rs53587188 on the first intron of the chicken FGF2 gene, with an A>G mutation, as a molecular marker of the patent application;

[0004] Publication No. CN115198022A, the subject of which is a patent application for an IGF2BP1 gene molecular marker associated with chicken body size traits, its application and breeding method, which discloses the correlation between the deletion mutation in the promoter region of the chicken IGF2BP1 gene and 23 chicken body size traits.

[0005] As we all know, in organisms, a SNP site mutation occurs almost every 300 bp, so for birds, their genome is huge and there are many SNP sites;

[0006] In the prior art, there are not many literatures on the research of SNP sites related to the body size and shape of chickens, which indicates that the research in this direction has just started.

[0007] The applicant conducted relevant research on the changes in the body size and shape of chickens and discovered some new phenomena, thus filing this case. Summary of the invention

[0008] The purpose of the present invention is to provide an application of a genetic marker associated with the body size trait of a chicken in genetic breeding. The application of the present invention analyzes three SNP sites of the Hes5B gene, and determines the relationship between the SNP1 site and the SNP3 site and the body size trait of the chicken, as well as the relationship between different sites, the genotypes and haplotype combinations of different sites and the size and shape of roosters and hens, thereby providing guidance for the genetic breeding related to the body size trait of the chicken.

[0009] At the same time, the invention also proposes primers and a kit for realizing the application.

[0010] To achieve the above objectives, the present application discloses an application of a genetic marker associated with the body size trait of chicken in genetic breeding, wherein the molecular marker is the SNP1 site and the SNP3 site of the Hes5B gene; the SNP1 site is the g.1408791T>C site, and the SNP3 site is the g.1409422T>C site.

[0011] Preferably, the chicken is Zhangjiajie White Feather Black Chicken. Zhangjiajie White Feather Black Chicken is produced in Wulingyuan District, Zhangjiajie City, Hunan Province, and is a local breed for both meat and eggs. This chicken is a new breed discovered during the third national genetic resource census in 2021. It is characterized by long shanks and relatively stable heredity. The new breed identification of Zhangjiajie White Feather Black Chicken can be found in the Announcement of the Ministry of Agriculture and Rural Affairs of the People's Republic of China, Announcement No. 846.

[0012] The Hes gene family is not only necessary for influencing the proliferation and differentiation of progenitor / stem cells and maintaining intestinal development and homeostasis, but also negatively regulates the occurrence of various secretory cells. In this experiment, the Hes 5B gene was selected as a candidate gene for the high shank length trait of chickens. Polymorphic sites were screened using sequencing technology, and association analysis was performed with some body size traits of chickens in order to obtain molecular markers related to the "high-legged" trait, providing basic data and technical support for the breeding of chicken characteristic traits and the protection, development and genetic improvement of Hunan local poultry breed genetic resources.

[0013] In the above application, the body size trait is one or more combinations of body oblique length, keel length and tibia length.

[0014] In the above application, the SNP1 locus is associated with the shin length and shin length index of roosters, and the SNP1 locus is associated with the keel length of hens;

[0015] The SNP3 locus is associated with the shank length index of roosters, and the SNP3 locus is associated with the body oblique length and shank length of hens.

[0016] In the above application, the AA genotype of the SNP1 site is correlated with tibia length and tibia length index; the AG genotype of the SNP1 site is correlated with keel length;

[0017] The AG genotype of the SNP3 site is associated with the shank length index of hens; and the GG genotype of the SNP3 site is associated with the shank length index of roosters.

[0018] In the above application, the rooster's haplotype combination H1H2 is related to the rooster's shank length and shank length index; the hen's haplotype combination H1H4 is related to the hen's body oblique length, and the hen's haplotype combination H2H4 is related to the hen's shank length index;

[0019] The haplotype combination H1H2 is a combination of haplotype H1 and haplotype H2; the haplotype combination H1H4 is a combination of haplotype H1 and haplotype H4; the haplotype combination H2H4 is a combination of haplotype H2 and haplotype H4;

[0020] The nucleotide combination of SNP1 and SNP3 of haplotype H1 is AA; the nucleotide combination of SNP1 and SNP3 of haplotype H2 is AG; the nucleotide combination of SNP1 and SNP3 of haplotype H4 is GG.

[0021] At the same time, the present invention also discloses primers for amplifying Hes5B gene-related molecular markers, the primers are used to achieve any of the above applications, the primers include a first primer pair for amplifying a first nucleotide sequence containing a SNP1 site and a second primer pair for amplifying a second nucleotide sequence containing a SNP3 site;

[0022] The nucleotide sequences of the upstream primer and the downstream primer of the first primer pair are shown as SEQ ID NO.1 and SEQ ID NO.2;

[0023] The nucleotide sequences of the upstream primer and the downstream primer of the second primer pair are shown in SEQ ID NO.3 and SEQ ID NO.4;

[0024] The first nucleotide sequence is shown as SEQ ID NO.5;

[0025] The second nucleotide sequence is shown as SEQ ID NO.6.

[0026] Finally, the present invention also discloses a kit comprising the primers as described above.

[0027] The beneficial effects of this application are:

[0028] 1. This experiment uses a combination of genome resequencing technology and growth performance data to deeply explore candidate genes that may affect rooster tibia length and analyze their mechanism of action in the regulation of chicken growth and development and the skeletal system.

[0029] 2. The present invention analyzes three SNP sites of the Hes5B gene, and determines the relationship between SNP1 and SNP3 sites and the body size traits of chickens, as well as the relationship between different sites, genotypes and haplotype combinations of different sites and the size and shape of roosters and hens, providing guidance for genetic breeding related to the body size traits of chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1A This is a comparison of the shank lengths of different sexes of Zhangjiajie white-feathered black-bone chickens;

[0031] Figure 1BThis is a comparison chart of the difference in shank length to body weight ratio between different sexes of Zhangjiajie white-feathered black-bone chicken;

[0032] Figure 1C This is a comparison chart of the shin length of different sexes between the high and low shin length groups of Zhangjiajie white-feathered black-bone chicken;

[0033] Figure 1D This is the agarose gel electrophoresis diagram of DNA from individual poultry blood samples;

[0034] Figure 1E This is the autosomal SNP density map of Zhangjiajie white-feathered black-breasted chicken population;

[0035] Figure 1F This is a statistical chart of the number of SNP variations in Zhangjiajie white-feathered black chicken;

[0036] Figure 1G This is the statistical graph of the SNP heterozygous ratio of Zhangjiajie white-feathered black chicken;

[0037] Figure 1H This is the result of principal component analysis;

[0038] Fig. 1I This is a group structure analysis diagram of Zhangjiajie white-feathered black-bone chicken;

[0039] Figure 1J This is the NJ tree diagram of Zhangjiajie white-feathered black-bone chicken;

[0040] Figure 2A This is a schematic diagram of the selection area for high and low shank length groups of Zhangjiajie white-feathered black-bone chicken;

[0041] Figure 2B This is the Venn diagram of the selected genes of Zhangjiajie White Feather Black Chicken;

[0042] Figure 2C This is the GO annotation map of candidate differentially expressed genes in Zhangjiajie white-feathered black-bone chicken;

[0043] Figure 2D This is a schematic diagram of the TOP20 representative KEGG pathways of Zhangjiajie white-feathered black chicken;

[0044] Figure 3A This is the result of PCR amplification of Hes5B gene;

[0045] Figure 3B Linkage disequilibrium analysis of SNP1 and SNP3 loci of Hes5B gene;

[0046] Figure 3C This is a comparison chart of Sanger sequencing of SNP1, SNP2, and SNP3 sites;

[0047] Figure 3DThis is the association analysis diagram between SNP1, SNP2, SNP3 loci and body size traits of Zhangjiajie white-feathered black-breasted chicken; DETAILED DESCRIPTION

[0048] The present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. In the description of the present invention, it should be noted that, if no specific conditions are specified in the embodiments, the conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0049] Part I Materials and Methods

[0050] 1.1 Sample Information

[0051] The samples collected twice in this experiment were provided by the Animal Husbandry and Fisheries Affairs Center of Wulingyuan District. The tibia length, body oblique length and keel length of 251 (117 males and 134 females) 300-day-old Zhangjiajie white-feathered black-bone chickens were measured using a vernier caliper, and 5 mL of blood was collected from the subwing vein. The blood was collected in an EDTA anticoagulant tube and transferred to a cryotube after mixing. DNA was extracted using the phenol-chloroform extraction method, and the concentration and quality of DNA were detected using a nucleic acid quantitative analyzer and 1.5% agarose gel electrophoresis.

[0052] 1.2 Quality control and variation detection of resequencing data

[0053] The whole genome resequencing work was entrusted to Guangzhou Kidio Biotechnology Co., Ltd. The genomic DNA that passed the quality inspection was randomly interrupted into small fragments ranging from 300-400bp by Covaris fragmentation, and the DNA fragments were repaired at the end, 3' end ploy A tail was added, sequencing adapters were connected, fragment screening and PCR amplification were performed to complete the entire library preparation, and finally the constructed library was subjected to 10× whole genome resequencing by Illumina HiSeq.

[0054] Clean reads were aligned to the chicken genome (GCF_016699485.2) using the Burrows-Wheeler Aligner (v0.7.17) software, the alignment results were sorted using the samtools software, and the coverage statistics were performed using the bedtools software. The Genome Analysis Toolkit (GATK) software was used to identify and call all single nucleotide polymorphisms (SNPs) and insertions / deletions (INDELs) in the entire genome of each individual sample. The detected variants were filtered using VariantFiltration with the filtering parameters of -Window. 4, -filter "QD<4.0||FS>60.0||MQ<40.0", -G_filter "GQ<20", means that the sites with a variation quality (Quality) / coverage depth (Depth) ratio less than 4.0, a value converted from the Fisher test P-value greater than 60, a read alignment quality value root mean square less than 40, and a genotype quality less than 20 will be filtered out, and finally high-quality SNPs will be obtained for annotation analysis using ANNOVAR software.

[0055] 1.3 Population structure and linkage disequilibrium analysis

[0056] Using gcta software, principal component analysis (PCA) was performed based on the SNP markers obtained after screening to obtain the variance explanation rate of each principal component and the score matrix of the sample in each principal component, and the result data was presented using a scatter plot to explore the population structure and genetic differences. Population structure analysis was performed using Admixture and pophelper. Among them, Admixture inferred the population structure, and pophelper plotted the genetic composition of each sample in each subpopulation into a bar graph. Then, based on all SNP information of the two sets of data, MEGA-X software was used to construct a phylogenetic tree using the Neighbor-Joining (NJ) method, in which the bootstrap value of the phylogenetic tree was obtained after up to 1000 calculations.

[0057] 1.4 Select signal analysis

[0058] For the filtered SNP data set, PopGenome software was used to slide the window according to the physical length, with 100kb as the window and 10kb as the step length to calculate the genetic differentiation index (Fst) and nucleotide diversity (πratio) of the high and low groups to find the severely differentiated areas. For Fst, the Fst value was standardized to the ZFst value of the normal distribution according to the formula: "ZFst per window = (Fst per window - average Fst of all windows) / standard deviation of Fst of all windows". For the π value, the H group was used as the experimental group and the L group as the control group, and the ratio was taken according to the "log2(πratio(πL / πH)". The Manhattan plot can be used to intuitively see the distribution between the two groups. The top 5% values ​​of the ZFst and πratio methods were taken as the threshold, and the windows were selected as the selected regions. The GO enrichment classification and KEGG pathway were used to perform functional enrichment analysis on the differential genes in the candidate regions.

[0059] 1.5 PCR amplification and DNA sequencing of candidate gene polymorphic sites

[0060] According to the previous resequencing analysis, the difference analysis of different shank length groups in the same population was explored, and the candidate genes and variant sites related to the shank length trait were screened for PCR amplification and DNA sequencing. According to the gene sequence information provided by the NCBI website, the primers were designed using Primer5.0 software. The total PCR reaction system was 25ul: 2×Taq PCR Mix 12.5ul, upstream and downstream primers (10μM) 1ul, DNA template (500ng / ul) 1ul, double distilled water 9.5ul; reaction procedure: 95℃5min, 95℃30s, TM30s, 72℃1min20s, 34 cycles, 72℃5min; PCR products were detected by 1.5% agarose gel electrophoresis. All primers and sequencing were performed by Beijing Qingke Biotechnology Co., Ltd. Finally, the sequencing peaks were analyzed using SnapGene software.

[0061] 1.6 Data Analysis

[0062] All data were statistically analyzed using SPSS 27.0, and variance analysis and significance analysis were performed using one-way ANOVA and t-test, respectively, and all were expressed as "mean ± standard error". P < 0.05 indicated a significant difference, P < 0.01 indicated an extremely significant difference, and P > 0.05 indicated an insignificant difference.

[0063] SHEsis online software was used to perform genotype analysis, linkage disequilibrium analysis, and haplotype analysis on gene SNP loci. When the haplotype frequency was less than 0.03, it was considered that there was no haplotype. The Hardy-Weinberg expectation value was judged by the χ2 test, and the population polymorphism information content (PIC) was calculated.

[0064] Part II Results and Analysis

[0065] 2.1 Analysis of the difference in shank length between high and low shank of Zhangjiajie white-feathered black-bone chicken

[0066] After measuring the shin length of 30 roosters and 30 hens, the six with the longest shin length were selected from different sexes as the high shin group (HT), and the six with the shortest shin length were selected as the low shin group (LT) for difference significance analysis. The results showed that the shin length of roosters and hens in the HT group was significantly higher than that in the LT group, and the difference reached an extremely significant level (P<0.001) ( Figure 1A ). The shin length to body weight ratio can be used as an indicator to evaluate growth rate and body shape development. The shin length to body weight ratio of roosters was significantly different (P<0.05), but the difference in hens was not significant (P>0.05) ( Figure 1B ). The results highlighted significant differences in the shank length index of males. Of particular note, in the HT group, the minimum shank length of males was significantly greater than the maximum shank length of females, and the difference also reached a highly significant level (P<0.001) ( Figure 1C ). This shows that the tibia length of roosters is not only significantly longer than that of hens in cross-group comparisons, but also has significant differences in the same group comparisons. Comprehensive analysis leads to the following conclusions: In Zhangjiajie white-feathered black-bone chickens, the tibia length of roosters is significantly longer than that of hens, indicating that the difference in tibia length of roosters may have a genetic basis.

[0067] Figure 1A This is a comparison of the shank lengths of different sexes of Zhangjiajie white-feathered black-bone chickens;

[0068] Figure 1B This is a comparison chart of the difference in shank length to body weight ratio between different sexes of Zhangjiajie white-feathered black-bone chicken;

[0069] Figure 1C This is a comparison chart of the shin length of different sexes in the high and low shin length groups of Zhangjiajie white-feathered black-chicken.

[0070] 2.2 Data quality control and variation detection

[0071] To ensure that the extracted DNA samples meet the requirements for subsequent library construction, this example uses 1.5% agarose gel electrophoresis to detect the purity and integrity of the DNA samples. Figure 1D It can be seen that the DNA bands are clear and have no tailing phenomenon, and the OD260 / 280 values ​​of each sample are between 1.8 and 2.0. This indicates that the DNA samples have not been degraded and meet the requirements for sequencing library construction.

[0072] After filtering the WGS data, the average data volume for each individual was 14.22Gb (clean base), the average alignment rate to the chicken reference genome was 98.59%, the Q20 average was 98.19%, the Q30 average was 94.79%, the GC content was between 42.97% and 44.94%, the Q20 and Q30 content ratios were relatively high, and the GC content results had no obvious bias. The average coverage depth of the genome was 11.49%, and the average coverage of 1X was 97.83% (Table 1-1, Table 1-2).

[0073] After filtering the population quality control data of Zhangjiajie white-feathered black chicken, a total of 12,467,759 high-quality SNPs were identified. Among the 41 autosomes, SNPs were mostly distributed in chromosomes 1, 2, 3 and Z. The distribution of SNPs on chromosomes can be seen in Figure 2. Figure 1E .

[0074] Figure 1D This is the agarose gel electrophoresis diagram of DNA from individual poultry blood samples;

[0075] Figure 1E This is the autosomal SNP density map of Zhangjiajie white-feathered black-breasted chicken population;

[0076] Table 1-1 Sequencing data quality statistics

[0077]

[0078]

[0079] Table 1-2 Genome alignment results and sequencing depth statistics

[0080]

[0081] 2.2 Analysis of the population structure of high and low shank length of Zhangjiajie white-feathered black-breasted chicken

[0082] 2.2.1 SNP detection results of high and low shank length groups of Zhangjiajie white-feathered black-bone chicken

[0083] The number of SNPs and heterozygosity rates detected in the whole genome of the HT and LT groups of roosters were statistically analyzed. The number of SNPs in each individual is as follows: Figure 1F As shown, an average of 5620173 SNPs were detected in the HT group, and the number of individual SNPs was distributed between 5428694 and 5761518; an average of 5627736 SNPs were detected in the LT group, and the number of individual SNPs was distributed between 5486561 and 5745243. The average number of SNPs detected in the LT group was slightly higher than that in the HT group. The SNP heterozygosity rate is the ratio of the number of heterozygous SNPs to the size of the genome. The SNP heterozygosity rate of each individual is shown in Figure 1GAs shown in the figure, the average SNP heterozygosity of the HT and LT groups was 0.62%. The above data show that the genetic variability and stability of the roosters in the HT and LT groups are both high at the genome level, which is manifested by the similar number of SNPs and the consistent heterozygosity rate.

[0084] 2.2.2 Analysis of the population structure of high and low shank length of Zhangjiajie white-feathered black-breasted chicken

[0085] To explore the genetic relationship between different tibia length groups in the same population of Zhangjiajie white-feathered black-breasted chicken, the autosomal variation of 12,467,759 high-quality SNPs was analyzed for population genetic diversity. PCA analysis showed that PC1 (explaining 10.71% of the total variation) and PC2 (explaining 10.2% of the total variation) could reflect the genetic relationship between different tibia length groups. At the PC1 and PC2 levels, there was a clear separation between different tibia length groups, but the two groups of individuals failed to form a completely independent population ( Figure 1H The results of population structure analysis showed that when K = 2 (assuming the number of ancestral populations is 2), Zhangjiajie white-feathered black-bone chickens could not be divided into two completely independent populations ( Fig. 1I ). The NJ phylogenetic tree results showed that the HT group and the LT group could be clearly distinguished, but the individuals L-2-a and L-4-a in the LT group had a closer genetic relationship with the individuals in the H group ( Figure 1J ).

[0086] The above results showed that there was a certain degree of genetic differentiation between the HT group and LT group (i.e., different tibia length groups) of Zhangjiajie white-feathered black-chicken, but the degree of differentiation was low, and some individuals shared a similar genetic background.

[0087] Figure 1F This is a statistical chart of the number of SNP variations in Zhangjiajie white-feathered black chicken;

[0088] Figure 1G This is the statistical graph of the SNP heterozygous ratio of Zhangjiajie white-feathered black chicken;

[0089] Figure 1H This is the principal component analysis result of Zhangjiajie white-feathered black-bone chicken;

[0090] Fig. 1I This is a group structure analysis diagram of Zhangjiajie white-feathered black-bone chicken;

[0091] Figure 1J This is the NJ tree diagram of Zhangjiajie White-feathered Black Chicken.

[0092] 2.3 Genome-wide selective scanning and enrichment analysis

[0093] Using the sliding window technique, the Fst value and πratio of each window were calculated, and the top 5% of the highest score windows (Fst>0.06, Log2(πratio)>1.2) were selected as candidate regions affected by selection. Combining the results of the two selective scans, we annotated 931 selected regions in the genome, of which the most abundant selected regions were on chromosome Z, reaching 222, followed by chromosome 1 (128) and chromosome 2 (125) ( Figure 2A ). Compared with the L group, the H group, as a domesticated population that was selected and eliminated, identified 1825 genes by the Fst method and 1690 genes by the πratio method. The intersection of the two methods identified 415 key genes ( Figure 2B ).

[0094] To further explore the key genes affecting tibia length, we performed GO enrichment analysis on the candidate differentially expressed genes ( Figure 2C ). The results showed that there were 109 regions with significant differences, among which the GO entries classified as biological processes mainly involved ion transmembrane transport, chromosome organization, protein synthesis and modification, cell adhesion and migration, signal transduction, multicellular biological development, etc. These processes are closely related to molecular functions such as material metabolism, ion balance, potential regulation, cell proliferation and transport, and growth and development regulation. The genes involved include FGF10, Hes5, TGFBR2, SMAD2, CTNNA2, Homer1, ATP5F1A, PLCH2, SLC15A4, PANK4, HSD17B4, Pex10, Skp2, CDH13, ADGR12, NIPBL, etc. (Table 2-1).

[0095] KEGG enrichment analysis revealed that a total of 51 pathways were enriched, and the regions with significant differences were mainly enriched in glyoxylate and dicarboxylic acid metabolism, glycine, serine and threonine metabolic pathways, Noth signaling pathway, ECM-receptor interaction-related pathways, FOXO signaling pathway, TH17 cell differentiation and energy metabolism, etc. ( Figure 2D ,Table 2-1).

[0096] In view of the relatively small sample size of this study, the Hes5 gene will be selected for verification in the Zhangjiajie white-feathered black-chicken population in the future to clarify the correlation between the polymorphism of the candidate gene and the high or low shank length phenotype, and provide corresponding reference for the selection and breeding of high-shank individuals in actual production.

[0097] Figure 2A This is a schematic diagram of the selection area for high and low shank length groups of Zhangjiajie white-feathered black-bone chicken;

[0098] Figure 2B This is the Venn diagram of the selected genes of Zhangjiajie White Feather Black Chicken;

[0099] Figure 2C This is the GO annotation map of candidate differentially expressed genes in Zhangjiajie white-feathered black-bone chicken;

[0100] Figure 2D This is a schematic diagram of the TOP20 representative KEGG pathways of Zhangjiajie white-feathered black chicken.

[0101] Table 2-1 Items and genes related to the regulation of tibia length by selected genes (P<0.05)

[0102]

[0103]

[0104] 2.4 Analysis of SNPs in candidate gene fragments

[0105] According to the previous resequencing analysis, the Hes 5B gene was selected as a candidate gene affecting the tibia length trait of white-feathered black-bone chicken roosters. According to the Hes 5B gene sequence information provided by the NCBI website, specific primers were designed for the mutation sites on its exons and PCR amplification was performed (Table 3-1). PCR amplification was performed using the genomic DNA of Zhangjiajie white-feathered black-bone chicken as a template. The results showed that the amplified fragment was consistent with the target fragment in size and had good specificity, and could be directly sequenced ( Figure 3A ).

[0106] SnapGene software was used to compare the PCR product sequencing results with the gene reference sequence. Figure 3C In the genomic sequence of the Hes5B gene, the following single nucleotide polymorphisms (SNPs) exist: at position 1408791, SNP1 represents a substitution of thymine (T) to cytosine (C); at position 1409392, SNP2 represents a substitution of thymine (T) to adenine (A); and at position 1409422, SNP3 represents a substitution of thymine (T) to cytosine (C).

[0107] Table 3-1 PCR amplification primer information for Hes 5 gene mutation site of Zhangjiajie white-feathered black-bone chicken

[0108]

[0109] The target sequence amplified by primers SEQ ID NO.1 and SEQ ID NO.2 is:

[0110] agagggctattctcggtgtttgcaagaagctttccatttcctctctcttcacaaagtccgaactgaaactcagaccaaactccta

[0111] agtcacttccagaagagccaatcagctgctccagaggtttccttttctcccagcaagcccactaccctgaagcaagcatcac

[0112] caaaagacactggtactctctggaggccctggtagtcagggaagctctcacttagtgaacctttgccttttagagtccagaggaagaatctgactgcatctgatagtccagctctga(SEQ ID NO.5);

[0113] The target sequence amplified by primers SEQ ID NO.3 and SEQ ID NO.4 is:

[0114] tctgctattgtgctgcctatctctctgattggccatagagtgtgggaaactccgccaagctacagacccacagactctcagga

[0115] aggctgcacagtataaatacagggccgaggcagcttccagcaacacatttctcctggacttccactccgagacagtccttcc

[0116] cctctttggacagatggctcccagcattgttttcatggagcccgacaacctgctgacaccaaaggagaaaaacaaagtaagt

[0117] ccagacacagtaaggcagcttggagccatgctctcagctgttctcatagcagtttccaaaagctgagaaactggtccacgttgcttaggagcagtgtgaaatggcagagagga(SEQ ID NO.6);

[0118] The target sequence amplified by primers SEQ ID NO.7 and SEQ ID NO.8 is:

[0119] tgctattgtgctgcctatctctctgattggccatagagtgtgggaaactccgccaagctacagacccacagactctcaggaa

[0120] ggctgcacagtataaatacagggccgaggcagcttccagcaacacatttctcctggacttccactccgagacagtccttccc

[0121] ctctttggacagatggctcccagcattgttttcatggagcccgacaacctgctgacaccaaaggagaaaaacaaagtaagtc

[0122] cagacacagtaaggcagcttggagccatgctctcagctgttctcatagcagtttccaaaagctgagaaactggtccacgttgcttaggagcagtgtgaaatggcagagaggatctaatagtgagtctctttccctttgctttttacag (SEQ ID NO. 9);

[0123] Figure 3A This is a diagram showing the PCR amplification results of the Hes5B gene, wherein wells 1-3, wells 4-6, and wells 7-9 are PCR amplification product 1, PCR amplification product 2, and PCR amplification product 3 of the Hes5B gene, respectively;

[0124] Figure 3C for Figure 3B This is a comparison chart of Sanger sequencing of SNP1, SNP2, and SNP3 sites.

[0125] 2.5 Population genetic parameter analysis of Hes5 gene in Zhangjiajie white-feathered black-bone chicken

[0126] The sequencing results of the three SNPs mutation sites of the Hes5B gene in 188 Zhangjiajie white-feathered black-chicken individuals were statistically analyzed, and the genotypes, genotype frequencies and population genetic parameters were analyzed (Table 4-1). The chi-square fitness test showed that the genotype frequency and allele frequency of the Hes5B gene polymorphism site in the rooster population were in Hardy-Weinberg equilibrium (P>0.05).

[0127] For the SNP1, SNP2, and SNP3 loci of the Hes5B gene, the dominant genotypes are AG, AA, and AG, with occurrence frequencies of 51.20%, 92.9%, and 58.30% (male); 46.20%, 74.00%, and 53.80% (female), respectively. The polymorphic information contents of the SNP1 and SNP3 loci are 0.348 and 0.356 (male); 0.361 and 0.374 (female), respectively, both showing moderate polymorphism (0.25 < PIC < 0.5); the polymorphic information content of the SNP2 locus is only 0.087 (male); 0.211 (female), showing low polymorphism (PIC < 0.25).

[0128] Table 4-1 Analysis of population genetic parameters of Hes5 gene polymorphism in Zhangjiajie white - feather chickens

[0129]

[0130]

[0131] 2.6 Effects of SNP loci of the Hes5 gene on some body size traits of Zhangjiajie white - feather chickens

[0132] The three body size traits of 188 Zhangjiajie white - feather chickens were respectively analyzed for association with the genotypes of the SNP loci of the Hes5B gene. As Figure 3C shown, the SNP1 locus of the Hes5B gene showed significant correlations with the shank length and shank length index of roosters, and the keel length of hens (P < 0.05). Specifically, at the SNP1 locus, individuals with the AA genotype were significantly higher than those with the AG genotype in shank length and shank length index (P < 0.05), while in terms of keel length, the average value of individuals with the AG genotype was significantly higher than that of the GG genotype (P < 0.05). On the contrary, no significant correlations were observed between the SNP2 locus and the body slant length, shank length, keel length, and shank length index of roosters and hens (P > 0.05). For the SNP3 locus, this locus showed significant correlations with the shank length index of roosters and the body slant length and shank length of hens (P < 0.05). In hens, the AG genotype was significantly higher than the GG genotype in body slant length and shank length (P < 0.05), while in roosters, the shank length index of the AG genotype was significantly lower than that of the GG genotype.

[0133] Figure 3D Figure for the association analysis of SNP1, SNP2, and SNP3 loci with the body size traits of Zhangjiajie white - feather chickens

[0134] 2.7 Linkage disequilibrium and haplotype association analysis of the Hes5 gene

[0135] The linkage disequilibrium analysis and haplotype analysis of the SNP1 and SNP3 loci of the Hes5B gene were respectively carried out using the SHEsis software. As Figure 3B As shown, there is a strong linkage disequilibrium between the two loci in the Hes5B gene (D′=0.80, r 2 ′<0.449), and a total of 4 haplotypes (AA, AG, GA, GG) were detected, named H1, H2, H3, and H4 respectively. The frequency of haplotype H4 in roosters was 0.255, and that in hens was 0.387 (P<0.05) (Table 5-1).

[0136] The results showed that the D' between SNP1 and SNP3 of Hes5B gene was close to 1, indicating that there was a strong complete linkage disequilibrium between the two loci, that is, they almost always appeared in a specific combination in the population. 2 The values ​​are relatively low, indicating that there is some degree of linkage disequilibrium between the two loci, but the association is of limited effectiveness in predicting the status of the other locus.

[0137] Figure 3B Linkage disequilibrium analysis of SNP1 and SNP3 loci of Hes5B gene;

[0138] Table 5-1 Hes5B gene haplotype analysis

[0139]

[0140] 2.8 Effects of Hes5 gene SNP haplotype combination on some body size traits of Zhangjiajie white-feathered black-bone chicken

[0141] In order to evaluate the multiple effects between SNP sites, the haplotype combinations generated by H1 to H4 of the Hes5B gene were analyzed, and a variety of haplotype combinations were screened out. Among them, the number of haplotype combination samples was less than 3, and no association analysis was performed, as shown in Table 6-1 and Table 6-2.

[0142] In the Hes5B gene, the H1H2 haplotype combination of roosters had a higher tibia length and tibia length index than the H1H4 and H3H3 combinations (P<0.05). The body oblique length of the H1H4 haplotype combination of hens was significantly higher than that of the H2H4 haplotype combination (P<0.01), while the tibia length index of the H2H4 haplotype combination was significantly higher than that of the other three haplotype combinations (P<0.01).

[0143] In the Zhangjiajie white-feathered black-chicken population, the H1H2 haplotype of the Hes5B gene (P<0.05) was extremely significantly or significantly correlated with the tibia length trait.

[0144] Table 6-1 Association analysis of Hes5B gene haplotype combinations and some body size traits of roosters

[0145]

[0146] Table 6-2 Association analysis between Hes5B gene haplotype combinations and some body size traits of hens

[0147]

[0148]

[0149] In summary, through the above experimental analysis, we can see that:

[0150] 1. SNP1 locus is associated with shin length and shin length index of roosters, and SNP1 locus is associated with keel length of hens;

[0151] The SNP3 locus is associated with the shank length index of roosters, and the SNP3 locus is associated with the body oblique length and shank length of hens.

[0152] 2. The AA genotype of SNP1 is associated with tibia length and tibia length index; the AG genotype of SNP1 is associated with keel length;

[0153] The AG genotype of SNP3 was associated with the shank length index of hens; the GG genotype of SNP3 was associated with the shank length index of roosters.

[0154] 3. The haplotype combination H1H2 of roosters is correlated with tibia length and tibia length index of roosters; the haplotype combination H1H4 of hens is correlated with body oblique length of hens, and the haplotype combination H2H4 of hens is correlated with tibia length index of hens.

[0155] The above results determined the relationship between SNP1 and SNP3 loci and the body size traits of Zhangjiajie White Feather Black Chicken, as well as the relationship between different loci, genotypes and haplotype combinations at different loci and the size and shape of roosters and hens, providing guidance for genetic breeding related to body size traits of Zhangjiajie White Feather Black Chicken.

Claims

1. An application of a genetic marker associated with the body size trait of chicken in genetic breeding, characterized in that: The molecular markers are the SNP1 site and the SNP3 site of the Hes5B gene; the SNP1 site is the g.1408791T>C site, and the SNP3 site is the g.1409422T>C site.

2. The use according to claim 1, characterized in that: The body size trait is one or more combinations of body oblique length, keel length and tibia length.

3. The use according to claim 1, characterized in that: The SNP1 locus is associated with the shin length and shin length index of roosters, and the SNP1 locus is associated with the keel length of hens; The SNP3 locus is associated with the shank length index of roosters, and the SNP3 locus is associated with the body oblique length and shank length of hens.

4. The use according to claim 3, characterized in that: The AA genotype of the SNP1 site is correlated with tibia length and tibia length index; the AG genotype of the SNP1 site is correlated with keel length; The AG genotype of the SNP3 site is associated with the shank length index of hens; and the GG genotype of the SNP3 site is associated with the shank length index of roosters.

5. The use according to claim 1, characterized in that: The haplotype combination H1H2 of the rooster is related to the shin length and shin length index of the rooster; the haplotype combination H1H4 of the hen is related to the body oblique length of the hen, and the haplotype combination H2H4 of the hen is related to the shin length index of the hen; The haplotype combination H1H2 is a combination of haplotype H1 and haplotype H2; the haplotype combination H1H4 is a combination of haplotype H1 and haplotype H4; the haplotype combination H2H4 is a combination of haplotype H2 and haplotype H4; The nucleotide combination of SNP1 and SNP3 of haplotype H1 is AA; the nucleotide combination of SNP1 and SNP3 of haplotype H2 is AG; the nucleotide combination of SNP1 and SNP3 of haplotype H4 is GG.

6. Primers for amplifying Hes5B gene-related molecular markers, characterized in that: The primers are used to implement the use according to any one of claims 1 to 5, and the primers include a first primer pair for amplifying a first nucleotide sequence containing a SNP1 site and a second primer pair for amplifying a second nucleotide sequence containing a SNP3 site; The nucleotide sequences of the upstream primer and the downstream primer of the first primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2; The nucleotide sequences of the upstream primer and the downstream primer of the second primer pair are shown in SEQ ID NO.3 and SEQ ID NO.4; The first nucleotide sequence is shown as SEQ ID NO.5; The second nucleotide sequence is shown as SEQ ID NO.

6.

7. A kit, characterized in that: Containing the primer as claimed in claim 6.

Images