Primer group, national standard duck gene residue detection method and application

Abstract

The invention discloses a primer group, a national standard duck gene residue detection method and application, and relates to a gene residue detection technology. The primer group comprises a primer pair and a DBQ double-quenching probe, wherein the primer group and the cytb gene conserved region of the national standard duck have specificity. The primer group provided by the invention realizes efficient, accurate and sensitive detection on the cytb gene of the national standard duck through specific design and optimization of the primer group, has a remarkable technical effect, and provides an effective technical means for detecting the residual gene of the national standard duck.

Description

Technical Field

[0001] The present invention relates to the technical field of gene residue detection, and in particular to a primer set, a method for detecting gene residues of national standard ducks, and applications thereof. Background Art

[0002] Genetic testing technology plays a vital role in modern biological science, especially in the detection of animal-derived ingredients in livestock and poultry. By analyzing the genetic information of organisms, genetic testing technology can identify and distinguish different biological species and their components. Common genetic testing methods include microscopy, DNA hybridization, gene chip technology, high-throughput sequencing technology, and quantitative PCR. These technologies each have their own advantages and disadvantages, but in the detection of animal-derived ingredients in livestock and poultry, quantitative PCR is widely used in actual production due to its high sensitivity, accuracy, and repeatability. Quantitative PCR combines specific primers and probes. During the PCR amplification process, the fluorescent signal is positively correlated with the amplification of the PCR product, thereby achieving accurate quantification of the target DNA.

[0003] Although quantitative PCR has great potential in the detection of animal-derived components in livestock and poultry, it still has some defects in practical application. First, the method has limitations in the selection of specific probes and primers. For example, the national standard duck Eclipse probe is easily interfered with by background signals during the detection process, resulting in reduced accuracy of the test results. In addition, the sensitivity of quantitative PCR is not satisfactory in some cases, especially when detecting low-abundance animal-derived components in livestock and poultry, which is prone to false negative results. These defects limit the application scope of quantitative PCR in complex samples and challenge its reliability in actual production.

[0004] Quantitative PCR faces similar challenges in genetic testing of national ducks. Due to the complexity of the duck genome, selecting appropriate primers and probes for specific detection is a daunting task. In practice, nonspecific amplification often occurs, resulting in inaccurate test results. Furthermore, the testing process requires rigorous sample handling and manipulation, and even the slightest inadvertent error can compromise the reliability of test results. These issues limit the application of quantitative PCR in genetic testing of national ducks, making it difficult to meet increasingly stringent testing standards and requirements.

[0005] In summary, although quantitative PCR offers certain advantages for the detection of animal-derived ingredients in livestock and poultry, it still suffers from numerous drawbacks, including the selection of specific probes and primers, background signal interference, insufficient sensitivity, and low accuracy. These issues not only limit the method's application in complex samples but also hinder its reliability and applicability in practical production. Addressing these issues is crucial for improving the overall level of livestock and poultry animal-derived ingredient detection technology and ensuring the quality and safety of biological products.

[0006] In view of this, the present invention is proposed. Summary of the Invention

[0007] The purpose of the present invention is to provide a primer set, a detection method and application of national standard duck gene residues. The primer set, through its specific design and optimization, realizes efficient, accurate and sensitive detection of the national standard duck cytb gene, has significant technical effects, and provides an effective technical means for the detection of national standard duck gene residues.

[0008] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are adopted:

[0009] In a first aspect, the present invention provides a primer set comprising: a primer pair and a DBQ double-quenching probe; wherein the primer set is specific to a conserved region of the national standard duck cytb gene.

[0010] In an optional embodiment, the nucleotide sequence of the DBQ double-quenched probe is shown in SEQ ID NO.1.

[0011] In an optional embodiment, the oligonucleotide sequence of the DBQ dual-quencher probe is provided with a fluorescent group at the 5' end and a dual-quencher group at the 3' end;

[0012] In an optional embodiment, the dual quencher group is DBQ1 or DBQ2;

[0013] In an optional embodiment, the dual quencher group is DBQ1;

[0014] In an optional embodiment, the fluorescent group is selected from at least one of FAM, HEX, VIC, JOE, TET, CY3, ROX, TexasRed and CY5.

[0015] In an optional embodiment, the primer pair includes a forward primer and a reverse primer;

[0016] The nucleotide sequence of the forward primer is shown in SEQ ID NO.2;

[0017] The nucleotide sequence of the reverse primer is shown in SEQ ID NO.3.

[0018] In a second aspect, the present invention provides a kit comprising the primer set according to any one of the aforementioned embodiments.

[0019] In a third aspect, the present invention provides a method for detecting national standard chicken gene residues based on the primer set as described in any one of the aforementioned embodiments, comprising:

[0020] S1, synthesizes single-stranded S1 molecules as target template DNA;

[0021] S2, using the primer pair in the primer set to amplify the target template DNA, and using the amplified product as a positive standard;

[0022] S3, performing absolute quantification on the positive standard, and constructing a standard curve based on the absolute quantification of the positive standard;

[0023] S4, collecting the sample to be tested, and using the primer pair in the primer set and the DBQ double-quenched probe to perform qPCR amplification reactions on the absolutely quantitative positive standard, the target template DNA, and the sample to be tested, respectively, to obtain fluorescence signals of the positive standard at different concentrations, as well as fluorescence signals corresponding to the sample to be tested;

[0024] S5, based on the standard curve and according to the fluorescence signal corresponding to the sample to be tested, obtaining the detection result of the sample to be tested.

[0025] In an optional embodiment, the nucleotide sequence of the single-chain S1 molecule is shown as SEQ ID NO.4.

[0026] In an optional embodiment, step S4, collecting a sample to be tested, and using the primer pair in the primer set and the DBQ double-quenched probe to perform qPCR amplification reactions on the absolutely quantitative positive standard, the target template DNA, and the sample to be tested, respectively, includes:

[0027] preparing a template-free qPCR reaction mixture to perform a template-free qPCR reaction; and preparing a qPCR amplification reaction system containing a DNA sample;

[0028] Amplifying the positive standard and the target template DNA based on the qPCR amplification reaction system to obtain a fluorescent signal result corresponding to the positive standard;

[0029] Amplifying the sample to be tested using the qPCR amplification reaction system to obtain a fluorescence signal result of the sample to be tested;

[0030] In an optional embodiment, the qPCR amplification reaction system comprises:

[0031] 2× qPCR Mix UDG, 12.5 μL;

[0032] The forward primer in the primer pair was 10 μM in concentration, 0.5 μL;

[0033] The reverse primer in the primer pair was 10 μM in concentration, 0.5 μL;

[0034] The DBQ double-quenching probe has a concentration of 10 μM and is used in 0.5 μL.

[0035] ddH2O, 9 μL;

[0036] DNA sample, 2 μL;

[0037] Wherein, the DNA sample includes the positive standard and the target template DNA;

[0038] In an optional embodiment, the template-free qPCR reaction mixture comprises:

[0039] 2× qPCR Mix UDG, 12.5 μL;

[0040] The forward primer in the primer pair was 10 μM in concentration, 0.5 μL;

[0041] The reverse primer in the primer pair was 10 μM in concentration, 0.5 μL;

[0042] The DBQ double-quenching probe has a concentration of 10 μM and is used in 0.5 μL.

[0043] ddH2O, 11 μL.

[0044] In an optional embodiment, the step S3, performing absolute quantification on the positive standard and constructing a standard curve based on the absolute quantification of the positive standard, comprises:

[0045] The positive standard was diluted in a gradient manner with a dilution factor of 10 1 ~10 8 times, respectively, to obtain the positive standard at different concentrations;

[0046] Take serial dilution 10 1 ~10 8 The positive standard after multiplication is subjected to qPCR detection, a standard curve is drawn, and the absolute quantitative result of the positive standard is obtained; wherein the standard curve is drawn with the logarithm of the copy number obtained based on the concentration of the positive standard as the abscissa and the CT value measured by the positive standard as the ordinate.

[0047] In a fourth aspect, the present invention provides a use of a primer set as described in any one of the aforementioned embodiments in preparing a detection product for national standard duck gene residues.

[0048] In a fifth aspect, the present invention provides an application of a primer set as described in any one of the aforementioned embodiments in the detection of national standard ducks.

[0049] Compared with the prior art, the present invention has the following beneficial effects:

[0050] The present invention provides a primer set, a detection method for national standard duck gene residues and applications. The primer set, which includes a primer pair and a DBQ double quenching probe, is specific to the conserved region of the national standard duck cytb gene and can significantly improve the specificity and sensitivity of the detection. The primer set effectively reduces the interference of nonspecific amplification and background signals by specifically identifying the target gene sequence, thereby improving the accuracy of the detection results. At the same time, the low background fluorescence value and high fluorescence increment characteristics of the DBQ double quenching probe make the detection of low-abundance national standard duck gene residues more sensitive, and can accurately detect trace gene residues. In addition, the design of the primer set also improves the detection efficiency and repeatability, making the experimental results more reliable, suitable for large-scale sample detection and quality control, simplifying the detection process, and reducing the difficulty and cost of operation. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0052] Figure 1 This is a schematic diagram of the standard curve results (standard curve) established using the national standard duck Eclipse modified probe for the comparative example group in the embodiment;

[0053] Figure 2 This is a schematic diagram of the standard curve results established using the national standard duck Eclipse modified probe for the comparative example group in the embodiment (enlarged curve diagram);

[0054] Figure 3 This is a schematic diagram of the standard curve results (multi-component curve diagram) established using the national standard duck Eclipse modified probe for the comparative example group in the embodiment;

[0055] Figure 4 This is a schematic diagram of the standard curve results (standard curve) established using the DBQ double-quenching probe in the example group of the examples;

[0056] Figure 5This is a schematic diagram of the standard curve results established using the DBQ double-quenching probe in the example group of the examples (enlarged curve diagram);

[0057] Figure 6 This is a schematic diagram of the standard curve results (multi-component curve diagram) established using the DBQ double-quenching probe in the example group of the examples;

[0058] Figure 7 Graphs showing the qPCR test results of the Example group and the Comparative Example group using two different probes when the standard concentration in the Example is 450 pg / μL (A is the amplification curve graph; B is the multi-component curve graph);

[0059] Figure 8 Graphs showing the qPCR test results of the Example group and the Comparative Example group using two different probes when the standard concentration in the Example is 45 pg / μL (A is the amplification curve graph; B is the multi-component curve graph);

[0060] Figure 9 qPCR test results of the Example group and the Comparative Example group using two different probes when the standard concentration in the Example is 4.5 pg / μL (A is the amplification curve; B is the multi-component curve);

[0061] Figure 10 qPCR test results of the Example group and the Comparative Example group using two different probes when the concentration of the standard in the Example is 450 fg / μL (A is the amplification curve; B is the multi-component curve);

[0062] Figure 11 qPCR test results of the Example group and the Comparative Example group using two different probes when the concentration of the standard in the Example is 45 fg / μL (A is the amplification curve; B is the multi-component curve);

[0063] Figure 12 qPCR test results of the Example group and the Comparative Example group using two different probes when the concentration of the standard in the Example is 4.5 fg / μL (A is the amplification curve; B is the multi-component curve);

[0064] Figure 13 Graphs showing the qPCR detection results of the example group and the comparative example group using two different probes when the concentration of the standard in the example is 0.45 fg / μL (A is the amplification curve graph; B is the multi-component curve graph). DETAILED DESCRIPTION

[0065] The embodiments of the present invention will be described in detail below with reference to the examples, but it will be understood by those skilled in the art that the following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the invention. Where specific conditions are not specified in the examples, the methods were performed according to conventional conditions or the conditions recommended by the manufacturer. Where the manufacturers of the reagents or instruments are not specified, they are all commercially available conventional products.

[0066] In an embodiment of the present application, a primer set is provided, comprising: a primer pair and a DBQ double-quenching probe; wherein the primer set is specific to the conserved region of the national standard duck cytb gene.

[0067] The DBQ dual-quencher probe is a type of probe used in fluorescent quantitative PCR (qPCR) that is designed to improve detection specificity and sensitivity. DBQ stands for "Dual-Quencher," meaning "double quencher." This probe structure can include a fluorescent group and two quencher groups, typically located at either end or in the middle of the probe.

[0068] In the initial stages of a qPCR reaction, when the probe is intact, the fluorophore and quencher are close together, and the fluorescent signal is absorbed by the quencher, resulting in low background fluorescence. During PCR amplification, the target DNA sequence is amplified, and the probe is cleaved by the exonuclease activity of the DNA polymerase. This separates the fluorophore and quencher, and the fluorescent signal is no longer quenched, releasing a fluorescent signal. By detecting this increase in fluorescent signal, the amplification of the target DNA can be quantitatively analyzed.

[0069] DBQ dual-quenched probes offer significant advantages in genetic testing. Their low background fluorescence is due to the presence of dual quenching groups, which lowers background fluorescence when the probe is not cleaved, thereby improving detection sensitivity and accuracy. Furthermore, DBQ probes are capable of detecting low-abundance target DNA, making them suitable for detecting trace amounts of residual genes or low-abundance gene expression, demonstrating their high sensitivity. Furthermore, by specifically binding to the target DNA sequence, DBQ probes reduce the impact of nonspecific amplification and enhance detection specificity.

[0070] The "national standard duck" mentioned above refers to the testing regulations and requirements for ducks in the national standard testing method, as referenced in "GB / T38164-2019 Common Livestock and Poultry Animal-Derived Components Detection Method - Real-Time Fluorescence PCR Method." The primer sets provided in this technology are specific to national standard ducks used in food production and processing. Their DNA is used to detect the presence of duck-derived ingredients in the sample.

[0071] The conserved regions of the cytb gene of the national standard duck refer to those regions of the cytochrome b (cytb) gene within ducks that maintain a high degree of similarity or consistency across different duck species or subspecies. These conserved regions exist because they have important biological functions during evolution and therefore remain relatively stable across species or populations, with little or no variation.

[0072] Nucleotide sequences in conserved regions remain highly similar or consistent across different duck species or subspecies, with minimal variation. Conserved regions typically correspond to protein active sites or structural domains. Their high degree of conservation stems from the key roles these regions play in protein function. In genetic testing and research, conserved regions are often used to design primers and probes because they can specifically recognize and bind to target gene sequences across different duck species or subspecies, enabling detection and analysis of target genes.

[0073] In some embodiments, the nucleotide sequence of the DBQ double-quenched probe is shown in SEQ ID NO.1.

[0074] The nucleotide sequence of the DBQ double quenching probe is as follows:

[0075] 5'-CCTACTGGCTATGCACTACACCGCAGAC-3' (SEQ ID NO. 1).

[0076] In some embodiments, the dual quencher group is DBQ1 or DBQ2;

[0077] In some preferred embodiments, the dual quencher group is DBQ1;

[0078] In some embodiments, the fluorescent group is selected from at least one of FAM, HEX, VIC, JOE, TET, CY3, ROX, Texas Red and CY5.

[0079] For example, the nucleotide sequence of the DBQ dual-quencher probe can be:

[0080] 5'-FAM-CCTACTGGCTATGCACTACACCGCAGAC-DBQ1-3'.

[0081] The 5'-end fluorescent group is FAM (5-carboxyfluorescein), a commonly used fluorescent group with excellent fluorescence properties and stability, used in qPCR detection. The middle sequence is CCTACTGGCTATGCACTACACCGCAGAC, which is specific to the conserved region of the national standard duck cytb gene and can specifically bind to the target gene sequence for detection. The 3'-end dual quencher group is DBQ1, which can effectively quench the fluorescent group's fluorescence signal, reduce background fluorescence, and improve detection sensitivity and accuracy.

[0082] For another example, the nucleotide sequence of the DBQ double quenching probe can be:

[0083] 5'-HEX-GCTGACCTGAGGCTGAGGCTGAGGCT-DBQ1-3'.

[0084] The 5'-terminal fluorescent group is HEX (6-carboxy-2',4',7',7'-tetrachlorofluorescein), a fluorescent group with high fluorescence intensity and good photostability, suitable for a variety of fluorescence detection systems. The middle sequence is GCTGACCTGAGGCTGAGGCTGAGGCT, which is also specific for the conserved region of the national standard duck cytb gene, capable of specifically recognizing and binding to the target gene sequence for detection. The 3'-terminal dual quencher group is DBQ1.

[0085] In some embodiments, the primer pair includes a forward primer and a reverse primer;

[0086] Table 1. Primers and nucleotide sequences in primer pairs

[0087] SEQ ID NO. Primer pairs Nucleotide sequence 2 Forward primer F 5'-GGCCACACAAATCCTCACAG-3' 3 Reverse primer R 5'-TGTGTTGGCTACTGAGGAGAAA-3'

[0088] In some embodiments, the oligonucleotide sequence of the DBQ dual-quencher probe has a fluorescent group at the 5' end and a dual-quencher group at the 3' end;

[0089] In a second aspect, the present invention provides a kit comprising the primer set according to any one of the aforementioned embodiments.

[0090] The above-mentioned kit may include a primer pair in the primer set, namely a forward primer, whose nucleotide sequence is shown in SEQ ID NO. 2. The forward primer is a short nucleotide sequence designed to bind to the forward strand of the conserved region of the Chinese duck cytb gene and guide the synthesis of a complementary strand during PCR amplification; a reverse primer, whose nucleotide sequence is shown in SEQ ID NO. 3. The reverse primer is a short nucleotide sequence designed to bind to the reverse strand of the conserved region of the Chinese duck cytb gene and also guides the synthesis of a complementary strand during PCR amplification. Used in conjunction with the forward primer, it achieves specific amplification of the target gene fragment. And, the nucleotide sequence is shown in SEQ ID NO. 1. The probe is specific for the conserved region of the Chinese duck cytb gene and can bind to the target gene sequence during PCR amplification. The 5' end of the oligonucleotide sequence is provided with a fluorescent group (such as FAM, HEX, etc.) to release a fluorescent signal after the probe is cleaved; the 3' end is provided with a dual quencher group (such as DBQ1 or DBQ2) to quench the fluorescent signal when the probe is intact, reducing background fluorescence and improving detection sensitivity and accuracy.

[0091] In addition, it may include but is not limited to:

[0092] (1) qPCR reaction mixture: usually includes polymerase, dNTPs (deoxynucleotide triphosphates), MgCl2, reaction buffer, etc., which are used to support the smooth progress of PCR amplification reaction.

[0093] (2) Positive control: A control sample containing a known concentration of national standard duck DNA, used to establish a standard curve and verify the detection sensitivity and accuracy of the kit.

[0094] (3) Negative control: A control that does not contain target DNA, used to eliminate the effects of nonspecific amplification and contamination to ensure the reliability of the test results.

[0095] (4) Sample processing reagents: such as DNA extraction reagents, purification reagents, etc., used to extract and purify DNA from the sample to be tested for subsequent qPCR detection.

[0096] (5) Instructions and other materials: Detailed instructions on how to use the kit, test steps, precautions, etc., to guide users in using the kit correctly and obtaining accurate test results.

[0097] In summary, a kit can include a specific primer set, a DBQ double-quenching probe, a qPCR reaction mixture, a control substance, a sample processing reagent, and instructions, etc., to achieve efficient and accurate detection of the national standard duck cytb gene.

[0098] In an embodiment of the present application, a method for detecting national standard chicken gene residues based on the primer set as described in any one of the aforementioned embodiments is provided, comprising:

[0099] S1, synthesizes single-stranded S1 molecules as target template DNA.

[0100] In the above steps, a single-stranded DNA molecule of known sequence is prepared as the target template for the subsequent amplification reaction. In this step, a single-stranded S1 molecule with a specific nucleotide sequence is synthesized by chemical or biosynthesis. This sequence should be specific to the conserved region of the duck cytb gene in the national standard to ensure the accuracy of the subsequent amplification reaction. This yields a pure single-stranded S1 molecule, the sequence of which is shown in SEQ ID NO. 4, which serves as the target template DNA.

[0101] The synthetic single-chain S1 molecule is used as a template to provide a known and stable detection standard, which facilitates the subsequent establishment of a standard curve and accurate quantification of gene residues in the sample to be tested.

[0102] Specifically, a single-stranded S1 molecule can be obtained by chemical synthesis using a DNA synthesizer, or by biosynthesis methods such as PCR amplification.

[0103] S2, using the primer pair in the primer set to amplify the target template DNA, and using the amplified product as a positive standard.

[0104] Using the forward and reverse primers in the primer set, the single-stranded S1 molecule synthesized in step S1 is PCR amplified to produce a large number of amplified products that are consistent with the target template DNA sequence, which serve as positive standards for subsequent testing. Using the single-stranded S1 molecule as a template, the primer pair, dNTPs, polymerase, and reaction buffer are added to conduct a PCR amplification reaction. Through multiple cycles of denaturation, annealing, and extension, the target DNA fragment is exponentially amplified, resulting in a large number of amplified products that are consistent with the target template DNA sequence, namely the positive standards.

[0105] The positive standard obtained by amplification has high purity and concentration, and can be used for subsequent absolute quantification and establishment of standard curves to improve the accuracy and reliability of detection.

[0106] Conventional PCR amplification methods can be used, such as using a PCR instrument to perform amplification reactions. According to the characteristics of the primer set and the characteristics of the target template, the amplification conditions (such as annealing temperature, number of cycles, etc.) are optimized to obtain the best amplification effect.

[0107] S3, performing absolute quantification on the positive standard, and constructing a standard curve based on the absolute quantification of the positive standard.

[0108] In this step, by accurately measuring the concentration or copy number of the positive standard, a standard curve is established for subsequent quantitative analysis of the test samples. Positive standards can be absolutely quantified using methods such as fluorescent quantitative PCR (qPCR). By using standards of known concentrations, a relationship curve is established between the fluorescence signal and the target DNA concentration, thereby obtaining absolute quantification results for the positive standard and constructing a standard curve.

[0109] The establishment of the standard curve provides an accurate reference for the quantitative analysis of the samples to be tested, making the test results comparable and traceable.

[0110] In the qPCR experiment, the positive standard can be diluted in a gradient manner, and amplification reactions can be performed separately. The fluorescence signals (such as CT values) at different concentrations can be recorded, and a standard curve can be drawn with the standard concentration as the horizontal axis and the fluorescence signal as the vertical axis.

[0111] S4. Collect the sample to be tested, and use the primer pair and DBQ double quenching probe in the primer set to perform qPCR amplification reactions on the absolutely quantitative positive standard, the target template DNA, and the sample to be tested, respectively, to obtain the fluorescence signals of the positive standard at different concentrations, as well as the fluorescence signals corresponding to the sample to be tested.

[0112] In this step, the test sample is combined with the primer pair and DBQ double-quenched probe from the primer set to perform a qPCR amplification reaction. Simultaneously, the positive standard and target template DNA are amplified to obtain fluorescence signal data for each sample. The test sample, positive standard, and target template DNA are each added to a qPCR reaction system, which includes the primer pair, DBQ double-quenched probe, and qPCR reaction mixture. The amplification reaction is performed in a qPCR instrument, and changes in the fluorescence signal are monitored in real time. This yields fluorescence signal data for the positive standard at different concentrations, as well as for the test sample.

[0113] Through qPCR amplification reaction, specific detection and quantitative analysis of target genes can be achieved. The use of DBQ double-quenching probes improves the sensitivity and specificity of detection.

[0114] In a qPCR experiment, you can set up multiple reaction wells and add the test sample, positive standard, and target template DNA to perform amplification reactions. The fluorescence signal changes in each reaction well are recorded to obtain data such as the CT value.

[0115] S5, based on the standard curve and according to the fluorescence signal corresponding to the sample to be tested, obtaining the detection result of the sample to be tested.

[0116] Using the standard curve established in step S3, the fluorescence signal of the sample to be tested is converted to the corresponding gene concentration or copy number, thereby obtaining the test result of the sample to be tested. The fluorescence signal data of the sample to be tested is substituted into the standard curve, and the concentration or copy number of the target gene in the sample to be tested is calculated through mathematical calculation or software analysis, thereby obtaining the test result of the sample to be tested, including information such as the concentration or copy number of the target gene and whether the gene is residual.

[0117] Through quantitative analysis of the standard curve, the gene residues in the sample to be tested can be accurately and sensitively detected with high detection accuracy and reliability.

[0118] Specifically, qPCR data analysis software can be used to input the fluorescence signal data of the sample to be tested, and quantitative analysis can be performed according to the standard curve to obtain the test results.

[0119] In some embodiments, the nucleotide sequence of the single-stranded S1 molecule is shown as SEQ ID NO.4.

[0120] Above, the nucleotide sequence of the single-chain S1 molecule is:

[0121] GGCCACACAAATCCTCACAGGCCTCCTACTGGCTATGCACTACACCGCAGACACATCCCTTGCTTTCTCCTCAGTAGCCAACACA (SEQ ID NO. 4).

[0122] In some embodiments, step S4, collecting a sample to be tested, and using the primer pair in the primer set and the DBQ double-quenched probe to perform qPCR amplification reactions on the absolutely quantitative positive standard, the target template DNA, and the sample to be tested, respectively, comprises:

[0123] Step S41 , preparing a template-free qPCR reaction mixture to perform a template-free qPCR reaction; and preparing a qPCR amplification reaction system containing a DNA sample.

[0124] As mentioned above, before performing the qPCR amplification reaction, a qPCR reaction mixture without template DNA is prepared and then subjected to the template-free qPCR reaction. The template-free qPCR reaction mixture is prepared according to the formula in Table 2:

[0125] Table 2. Template-free qPCR reaction mixture

[0126] NO. name Addition volume μL 1 2×qPCR Mix UDG 12.5 2 Forward primer 10 μM concentration 0.5 3 Reverse primer 10 μM concentration 0.5 4 DBQ dual-quencher probe 10 μM concentration 0.5 5 <![CDATA[ddH2O]]> 11

[0127] Template-free qPCR reactions can be used to detect nonspecific amplification or contamination in the reaction system, thereby verifying the specificity and reliability of the reaction system. Template-free qPCR reactions help eliminate the effects of nonspecific amplification and contamination, ensuring the accuracy of subsequent test results. In qPCR experiments, a template-free control well can be set up, and the prepared template-free qPCR reaction mixture can be added to perform the qPCR amplification reaction. Changes in the fluorescence signal can be monitored to observe whether nonspecific amplification exists.

[0128] As described above, according to the requirements of the sample to be tested and the positive standard, a qPCR amplification reaction system containing a DNA sample is prepared for subsequent qPCR amplification reaction. The qPCR amplification reaction system containing a DNA sample is prepared according to the formula in Table 3:

[0129] Table 3. qPCR amplification reaction system

[0130] NO. name Addition volume μL 1 2×qPCR Mix UDG 12.5 2 Forward primer 10 μM concentration 0.5 3 Reverse primer 10 μM concentration 0.5 4 DBQ dual-quencher probe 10 μM concentration 0.5 5 <![CDATA[ddH2O]]> 9 6 DNA samples (positive standard and target template DNA) 2

[0131] As mentioned above, 2 μL of DNA sample (DNA sample includes positive standard and target template DNA) is mixed evenly to obtain a qPCR amplification reaction system containing the DNA sample.

[0132] This complete reaction system for qPCR amplification, containing the DNA of the test sample and positive standard, is prepared. This system supports specific amplification and provides the necessary conditions for subsequent detection. The reaction system can be precisely prepared based on the DNA concentration and volume of the test sample and positive standard, ensuring that the concentrations and ratios of each component meet experimental requirements.

[0133] Step S42: amplifying the positive standard and the target template DNA based on the qPCR amplification reaction system to obtain a fluorescence signal result corresponding to the positive standard.

[0134] As described above, a qPCR amplification reaction is performed on the positive standard and target template DNA using the prepared qPCR amplification reaction system to obtain fluorescence signal data of the positive standard at different concentrations. The positive standard and target template DNA are added to the qPCR amplification reaction system, and the amplification reaction is carried out in a qPCR instrument. By monitoring the changes in the fluorescence signal in real time and recording the fluorescence signal results of the positive standard at different concentrations, the fluorescence signal data of the positive standard at different concentrations are obtained, providing a basis for the subsequent establishment of a standard curve.

[0135] By amplifying the positive standard, an accurate relationship between the fluorescence signal and the concentration can be obtained, providing a reliable reference for the quantitative analysis of the sample to be tested.

[0136] Specifically, in the qPCR experiment, the positive standard can be diluted in a gradient manner and added to the reaction system for amplification. The fluorescence signal at each concentration can be recorded to draw a standard curve.

[0137] Step S43: amplify the sample to be tested using the qPCR amplification reaction system to obtain a fluorescence signal result of the sample to be tested.

[0138] Using a prepared qPCR amplification system, perform a qPCR amplification reaction on the collected sample to obtain fluorescence signal data. DNA from the sample is added to the qPCR amplification system and amplified in a qPCR instrument. Fluorescence signal changes are monitored in real time and recorded. The resulting fluorescence signal data provides a basis for subsequent quantitative analysis.

[0139] The qPCR amplification reaction can specifically detect the target gene in the sample to be tested and obtain accurate fluorescence signal data.

[0140] Specifically, in a qPCR experiment, the DNA of the sample to be tested is added to the reaction system, an amplification reaction is performed, changes in the fluorescence signal are monitored, and the fluorescence signal data of the sample to be tested is recorded.

[0141] In this embodiment, the above steps together constitute the core process of the national standard chicken gene residue detection method based on the primer set. Through the steps of template-free control, positive standard amplification and test sample amplification, efficient and accurate detection of gene residues is achieved.

[0142] In some embodiments, the step S3, performing absolute quantification on the positive standard and constructing a standard curve based on the absolute quantification of the positive standard, comprises:

[0143] Step S31, the positive standard is diluted in a gradient manner, with a dilution factor of 10 1 ~10 8 times, and obtain the positive standard at different concentrations.

[0144] The above steps are to obtain a series of positive standards with known concentrations by gradient dilution of the positive standard so as to be used for subsequent standard curve establishment. First, gradient dilution can be performed based on the initial concentration of the positive standard. For example, the positive standard can be diluted 10-fold in series, starting from 10 1 Dilute to 10 8 times to obtain standard solutions of different concentrations, thereby obtaining a series of positive standards of different concentrations, covering the range from high concentration to low concentration, providing a basis for subsequent qPCR detection.

[0145] By gradient dilution, the standard curve can be ensured to cover the dynamic range of the test, thereby improving the sensitivity and accuracy of the test.

[0146] For example, the preparation can be performed by the following serial dilution method:

[0147] (1) Prepare tube 1, where the dilution ratio is 10 μL of the quantified positive standard and 90 μL of DNA diluent, with a final concentration of 450 pg / μL;

[0148] (2) Prepare tubes 2 to 10 in sequence according to tube 1, including:

[0149] A. Prepare tube 2 based on tube 1. The dilution ratio is 10 μL of tube 1 plus 90 μL of DNA diluent, for a final concentration of 45 pg / μL.

[0150] B. Prepare tube 3 based on tube 2. The dilution ratio is 10 μL of tube 2 plus 90 μL of DNA diluent, for a final concentration of 4.5 pg / μL.

[0151] C. Prepare tube 4 based on tube 3. The dilution ratio is 10 μL of tube 3 plus 90 μL of DNA diluent, for a final concentration of 450 fg / μL.

[0152] D. Prepare tube 5 based on tube 4 by adding 90 μL of DNA diluent to 10 μL of tube 4, for a final concentration of 45 fg / μL.

[0153] E. Prepare tube 6 based on tube 5. The dilution ratio is 10 μL of tube 5 plus 90 μL of DNA diluent, for a final concentration of 4.5 fg / μL.

[0154] F. Prepare tube 7 based on tube 6 by adding 90 μL of DNA diluent to 10 μL of tube 6, for a final concentration of 0.45 fg / μL.

[0155] In the above-mentioned serial dilution process, the final concentration was set as 450 pg / μL-0.45 fg / μL as the target concentration.

[0156] As mentioned above, firstly, the required amount needs to be calculated, which can be calculated based on the carrier for the reaction. In the embodiment of the present application, a micro-reaction plate is used as the reaction carrier, such as a 96-well plate.

[0157] The total amount of Mix required is calculated based on the number of reaction wells. The calculation method can be:

[0158] Mix = (number of wells + 3) × (10 + 0.4 + 0.4 + 0.2 + 1) μL; where number of wells + 3 represents the loss from three wells. Three replicates were performed for each sample. For specific concentrations in each tube during the serial dilution process, refer to Table 4.

[0159] Table 4. Serial dilution of positive standards

[0160] Dilution tube Dilution ratio Final concentration Tube 1 10 μL positive standard + 90 μL DNA dilution solution 450 pg / μL Tube 2 10 μL tube 1 + 90 μL DNA dilution buffer 45 pg / μL Tube 3 10 μL tube 2 + 90 μL DNA dilution buffer 4.5 pg / μL Tube 4 10 μL tube 3 + 90 μL DNA dilution buffer 450 fg / μL Tube 5 10 μL tube 4 + 90 μL DNA dilution buffer 45 fg / μL Tube 6 10 μL tube 5 + 90 μL DNA dilution buffer 4.5 fg / μL Tube 7 10 μL tube 6 + 90 μL DNA dilution buffer 0.45 fg / μL

[0161] Step S32, take gradient dilution 10 1 ~10 8 The positive standard after multiplication is subjected to qPCR detection, a standard curve is drawn, and the absolute quantitative result of the positive standard is obtained; wherein the standard curve is drawn with the logarithm of the copy number obtained based on the concentration of the positive standard as the abscissa and the CT value measured by the positive standard as the ordinate.

[0162] Using qPCR detection technology, the positive standard after gradient dilution is tested, and the fluorescence signal (such as CT value) at different concentrations is recorded. Based on this data, a standard curve is drawn to obtain the absolute quantitative results of the positive standard. The positive standard after gradient dilution is added to the qPCR reaction system respectively, and the qPCR amplification reaction is carried out. During the reaction process, the changes in the fluorescence signal are monitored in real time, and the CT value (cycle threshold) at each concentration is recorded to obtain the CT value data of the positive standard at different concentrations. A standard curve is drawn with the logarithm of the copy number as the horizontal axis and the CT value as the vertical axis, and the absolute quantitative results of the positive standard are calculated.

[0163] The calculation formula for the copy number is:

[0164]

[0165] The standard curve formula can be: y=mx+b; wherein y is the CT value, x is the logarithmic value of the copy number, m is the slope, and b is the intercept.

[0166] Through qPCR detection and the establishment of a standard curve, accurate quantification of positive standards can be achieved, providing a reliable reference for the quantitative analysis of the samples to be tested.

[0167] In a qPCR experiment, multiple reaction wells are set up and different concentrations of positive standards are added to each well for amplification. Using qPCR data analysis software, a standard curve is plotted based on the recorded C values ​​and known concentrations, and the absolute quantitative results of the positive standard are calculated.

[0168] In the examples of the present application, there is also provided an application of the primer set as described in any one of the aforementioned embodiments in preparing a detection product for national standard duck gene residues.

[0169] "Testing products" can be a variety of commercial test kits or testing tools used to detect national standard duck gene residues, including qPCR kits, PCR detection kits, gene chips, genetic testing instruments and genetic testing service packages.

[0170] In the examples of the present application, there is also provided an application of the primer set as described in any of the aforementioned embodiments in the detection of national standard duck.

[0171] The present invention is further described below by way of specific examples. However, it should be understood that these examples are merely provided for more detailed description and are not to be construed as limiting the present invention in any form.

[0172] Example 1: Preparation of national standard duck detection template

[0173] In this example, template DNA was prepared

[0174] Experimental methods:

[0175] (1) Using the synthesized single strand as a template for PCR amplification;

[0176] (2) Primers F / R were used as amplification primers and the target fragment was obtained using a PCR Mix kit. The reaction system and reaction procedure are shown in Tables 5 and 6.

[0177] Table 5. Target gene amplification reaction system

[0178] Components Volume (μL) 2×PCR Mix 25 F1 2 R1 2 template 1 ddH2O 20

[0179] Table 6. Target gene amplification reaction procedure

[0180]

[0181] (3) After PCR amplification, 1% agarose gel was used to detect whether the target band existed and whether the target band was single. The target band was recovered using a gel recovery kit. The concentration of the template DNA was measured using a NanoDrop UV spectrophotometer and stored at -20°C for future use.

[0182] Example 2: Establishment of standard curve

[0183] In this example, a standard curve was established.

[0184] Experimental methods:

[0185] 1. Experimental group settings:

[0186] In this example, the technology in this application was compared with the conventional method, and different primer sets were used to set up different experimental groups (example group and comparative example group).

[0187] In the embodiment group, that is, the technology of the embodiment of this application, the primer group in the reaction system used is:

[0188] (1) DBQ dual quenching probe:

[0189] 5'-FAM-CCTACTGGCTATGCACTACACCGCAGAC-DBQ1-3';

[0190] (2) Forward primer (detection primer-F): 5'-GGCCACACAAATCCTCACAG-3'

[0191] (3) Reverse primer (detection primer-R): 5'-TGTGTTGGCTACTGAGGAGAAA-3'.

[0192] The primer set used in the comparative example group is:

[0193] (1) National Standard Duck Eclipse Probe:

[0194] 5'-FAM-CCTACTGGCTATGCACTACACCGCAGAC-Eclipse-3';

[0195] (2) Forward primer (detection primer-F): 5′-GGCCACACAAATCCTCACAG-3′;

[0196] (3) Reverse primer (detection primer-R): 5'-TGTGTTGGCTACTGAGGAGAAA-3'.

[0197] It should be noted that the following experiments were conducted for the example group and the comparative example group, including the preparation of the reaction system, and the reaction and detection under specific procedures to obtain the results.

[0198] 2. Prepare the reaction system:

[0199] 1) Prepare a template-free qPCR reaction mix (see Table 7). Mix thoroughly and dispense 25 μL / well into a 96-well plate.

[0200] Table 7. qPCR Mix Reaction System

[0201] Components Volume (μL) 2×qPCR Mix (UDG) 12.5 Detection primer-F (10 μM) 0.5 Detection primer-R (10 μM) 0.5 DBQ dual quenching probe (10 μM) 0.5 <![CDATA[ddH2O]]> 11

[0202] 2) The template DNA obtained in Example 1 was also prepared using the reaction system in Table 6 and dispensed into 96-well plates.

[0203] 3) Then, the positive template was diluted with DNA diluent in a gradient manner. The template dilution is shown in Table 4.

[0204] The diluted samples with concentrations ranging from 450 pg / μL to 0.45 fg / μL were added to the qPCR Mix in a 96-well plate, with 1 μL added to each well. 3 replicates were performed for each concentration.

[0205] The total amount of Mix required is calculated based on the number of reaction wells: Mix = (number of reaction wells + 3) × (10 + 0.4 + 0.4 + 0.2 + 8) μL, where the number of reaction wells + 3 represents the loss from three wells. Three replicates are performed for each test sample.

[0206] 2. Program settings:

[0207] 1) Create a detection probe, select "FAM" as the reporter group, "None" as the quencher group, and "None" as the reference fluorescence.

[0208] 2) In the "Assign target(s) to the selected wells" panel, set the "Task" column of the standard curve wells to "Standard" and assign values ​​of 450,000, 45,000, 4,500, 450, 450, 45, 2.5, and 0.45 in the "Quantity" column (meaning the DNA concentration in each well, unit: fg / μL). Name the corresponding "Sample name" column according to the corresponding concentration.

[0209] 3) Set the amplification program, see Table 8: reaction volume 20 μL, and start the run after setting.

[0210] Table 8. Amplification Procedure

[0211]

[0212] 3. Result analysis: Compare the experimental data of the embodiment group and the comparative example group.

[0213] In the embodiment, first, a national standard duck detection standard curve was established using different probes, and then the results of the embodiment group and the comparative group were compared from the dimensions of the linear relationship of the standard curve, the qPCR fluorescence increment and the probe basal fluorescence value.

[0214] Based on the comparative analysis of qPCR data, ΔRn was used to compare the fluorescence increment of the two probes, and Fluorescence was used to compare the basal fluorescence values ​​of the two probes.

[0215] (1)Reference Figures 1 to 3 (Eclipse modified probe), and Figure 4 and Figure 6(DBQ double quenching probe), wherein the standard curve established based on the Eclipse modified probe is y = -3.146x + 26.329, r 2 =0.99; the standard curve established based on the DBQ double quenching probe is y=-3.185x+26.704, r 2 =0.995. It can be seen that the standard curves established by the two probes have good linear relationships and can both be used to establish standard curves for national standard duck detection.

[0216] (2) Figure 3 The quenching group of the probe in the comparative group will have a fluorescent signal, and the base fluorescence value is high. Figure 6 The basal fluorescence value of the DBQ double-quenching probe in this application is significantly lower, and the light gain increment is also higher than that of the control group probe in the test group, which is more conducive to result analysis.

[0217] (3) Furthermore, the qPCR results at each concentration of the standard were analyzed separately, and the fluorescence increment and basal fluorescence values ​​of the two probes were compared, and the detection results from the concentration of 450 pg / μL standard to 0.45 fg / μL standard were obtained.

[0218] refer to Figures 7 to 13 The results show that compared with the Eclipse probe in the comparative example group, the DBQ double-quenching probe in the embodiment group has a low basal fluorescence value and a significantly better fluorescence increment, which is better than the control group probe.

[0219] In summary, by comparing the standard curves, basal fluorescence values, and fluorescence increments established for the two probes (Example Group and Comparative Example Group), the DBQ dual-quenching probe in the Example Group exhibited lower background fluorescence and a better fluorescence increment. Analysis and comparison of the test results revealed that the DBQ dual-quenching probe in the Example Group was superior, with its higher fluorescence increment facilitating analysis. When observing test samples of varying concentrations, the comparison was clear and easy to analyze, thereby improving the accuracy and sensitivity of the experiment.

[0220] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer set, characterized in that: include: Primer pair and DBQ double quenching probe; wherein the primer set is specific to the conserved region of the national standard duck cytb gene.

2. The primer set according to claim 1, characterized in that: The nucleotide sequence of the DBQ double quenching probe is shown in SEQ ID NO.

1.

3. The primer set according to claim 1, characterized in that: The oligonucleotide sequence of the DBQ double quenching probe has a fluorescent group at the 5' end and a double quenching group at the 3' end; Preferably, the dual quencher group is DBQ1 or DBQ2; Preferably, the dual quencher group is DBQ1; Preferably, the fluorescent group is selected from at least one of FAM, HEX, VIC, JOE, TET, CY3, ROX, TexasRed and CY5.

4. The primer set according to claim 1, characterized in that: The primer pair includes a forward primer and a reverse primer; The nucleotide sequence of the forward primer is shown in SEQ ID NO.2; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.

3.

5. A kit, characterized in that: Comprising the primer set according to any one of claims 1 to 4.

6. A method for detecting the national standard chicken gene residue based on the primer set according to any one of claims 1 to 4, characterized in that: include: S1, synthesize single-stranded S1 molecules as target template DNA; S2, using the primer pair in the primer set to amplify the target template DNA, and using the amplified product as a positive standard; S3, performing absolute quantification on the positive standard, and constructing a standard curve based on the absolute quantification of the positive standard; S4, collecting the sample to be tested, and using the primer pair in the primer set and the DBQ double quenching probe to perform qPCR amplification reactions on the absolutely quantitative positive standard, the target template DNA and the sample to be tested, respectively, to obtain the fluorescence signals of the positive standard at different concentrations, and the fluorescence signals corresponding to the sample to be tested; S5, obtaining a detection result of the sample to be tested based on the standard curve and the fluorescent signal corresponding to the sample to be tested; Preferably, the nucleotide sequence of the single-stranded S1 molecule is as shown in SEQ ID NO.

4.

7. The method for detecting the national standard chicken gene residue as claimed in claim 6, characterized in that: The step S4, collecting the sample to be tested, and using the primer pair and DBQ double quenching probe in the primer set to perform qPCR amplification reaction on the absolutely quantitative positive standard, the target template DNA and the sample to be tested, respectively, includes: preparing a template-free qPCR reaction mixture to perform a template-free qPCR reaction; and preparing a qPCR amplification reaction system containing a DNA sample; Amplifying the positive standard and the target template DNA based on the qPCR amplification reaction system to obtain a fluorescent signal result corresponding to the positive standard; Amplifying the sample to be tested by using the qPCR amplification reaction system to obtain a fluorescent signal result of the sample to be tested; Preferably, the qPCR amplification reaction system comprises: 2×qPCR Mix UDG, 12.5 μL; The forward primer in the primer pair was at a concentration of 10 μM, 0.5 μL; The reverse primer in the primer pair was 10 μM concentration, 0.5 μL; The DBQ double quenching probe has a concentration of 10 μM, 0.5 μL; ddH2O, 9 μL; DNA sample, 2 μL; Wherein, the DNA sample includes the positive standard and the target template DNA; Preferably, the template-free qPCR reaction mixture comprises: 2×qPCR Mix UDG, 12.5 μL; The forward primer in the primer pair was at a concentration of 10 μM, 0.5 μL; The reverse primer in the primer pair was 10 μM concentration, 0.5 μL; The DBQ double quenching probe has a concentration of 10 μM, 0.5 μL; ddH2O, 11 μL.

8. The method for detecting the national standard chicken gene residue as claimed in claim 6, characterized in that: The step S3, performing absolute quantification on the positive standard, and constructing a standard curve based on the absolutely quantified positive standard, comprises: The positive standard was diluted in a gradient manner, with a dilution factor of 10 1 ~10 8 times, to obtain the positive standard at different concentrations; Take serial dilution 10 1 ~10 8 The positive standard sample after multiplication is subjected to qPCR detection, a standard curve is drawn, and the absolute quantitative result of the positive standard sample is obtained; wherein the standard curve is drawn with the copy number logarithm value obtained based on the concentration of the positive standard sample as the horizontal axis and the CT value measured by the positive standard sample as the vertical axis.

9. Use of the primer set according to any one of claims 1 to 4 in preparing a product for detecting national standard duck gene residues.

10. Use of the primer set according to any one of claims 1 to 4 in the detection of national standard duck.

Images