Application of molecular marker linked with male sterility character of mung bean in detection of male sterility character of mung bean

Abstract

The invention discloses application of a molecular marker linked with the male sterility character of mung beans in detection of the male sterility character of the mung beans, and belongs to the technical field of molecular markers. The molecular marker is located on the No.10 chromosome of the mung bean, and the molecular marker has deletion of a nucleotide fragment as shown in SEQ ID NO.1 from 679bp from a translation start site of a jg31919 gene; the deleted fragment is located from 15143368 bp to 15195752 bp of the tenth chromosome; and the reference genome is Jilv 7. The molecular marker provided by the invention is linked with the male sterility character of the mung bean, and great convenience is brought to breeding of a new male sterility mung bean strain.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, in particular to the application of molecular markers linked to male sterility traits of mung beans in detecting male sterility traits of mung beans. Background Art

[0002] Mung bean (Vigna radiata) is an important grain crop that contains high-quality starch and rich vitamins, minerals, dietary fiber and protein. Therefore, mung bean is in great demand in both direct consumption and food processing industries.

[0003] However, compared with field crops, mung bean has a lower yield. Studies have found that the use of hybrid vigor is one of the ways to increase mung bean yield. Among them, hybrids prepared from different combinations of mung bean lines KPS1 and Korea7 can achieve a super-parent advantage of more than 40% in yield (Chen et al., 2003). Male sterile lines of crops are conducive to hybrid seed production, thereby achieving the purpose of using hybrid vigor to increase crop yields. Therefore, discovering the male sterile gene of mung bean and developing molecular markers linked to the male sterile trait of mung bean can facilitate the breeding of male sterile lines of mung bean, and have practical value in the use of hybrid vigor of mung bean. Summary of the invention

[0004] The purpose of the present invention is to provide a molecular marker linked to the male sterility trait of mung bean for use in detecting the male sterility trait of mung bean, so as to solve the problems existing in the above-mentioned prior art.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] One of the technical solutions of the present invention is the use of a molecular marker linked to the male sterility trait of mung bean in the detection of the male sterility trait of mung bean, wherein the molecular marker is located on chromosome 10 of mung bean, and the molecular marker has a deletion of the nucleotide fragment shown in SEQ ID NO.1 starting from the 679 bp calculated from the translation start site of the jg31919 gene;

[0007] The deleted fragment is located at 15143368bp to 15195752bp of chromosome 10; the reference genome is Jilv 7 (JL7, Liu C, Wang Y, Peng J, et al. High-quality genome assembly and pan-genome studies facilitate genetic discovery in mung bean and its improvement [J]. Plant Communications, 2022, 3 (6).).

[0008] The second technical solution of the present invention is the application of a specific primer in the detection of male sterility traits of mung bean or mung bean assisted breeding, wherein the specific primer includes a forward primer and two reverse primers; the nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3 and SEQ ID NO.4.

[0009] The third technical solution of the present invention is the use of a kit in the detection of male sterility traits of mung beans or assisted breeding of mung beans, wherein the kit includes the specific primers.

[0010] A fourth technical solution of the present invention is a method for detecting the molecular marker, comprising the following steps:

[0011] (1) Extracting mung bean DNA to be tested;

[0012] (2) using the extracted DNA as a template, amplifying using the specific primers or the kit to obtain an amplified product;

[0013] (3) Identifying the genotype of the amplified product to screen out mung bean individuals with a missing genotype, i.e., male sterile individuals.

[0014] A fifth technical solution of the present invention is a method for detecting whether mung beans are male sterile, wherein the molecular marker is detected on the mung bean individuals to be tested.

[0015] The sixth technical solution of the present invention is a mung bean assisted breeding method, comprising the step of detecting the molecular marker.

[0016] Based on the above technical solution, the present invention has the following technical effects:

[0017] 1. The present invention designs a mung bean male sterility molecular marker vrnp-52k-del by utilizing a deletion variation in the intron of the jg31919 gene of the mung bean line vrnp, and uses an F2 population to analyze the linkage relationship between vrnp-52k-del and the male sterility trait, and finds that the molecular marker vrnp-52k-del is linked to the mung bean male sterility trait.

[0018] 2. The molecular marker vrnp-52k-del linked to the male sterility trait of mung bean provided by the present invention can be used for molecular marker-assisted selection of male sterile mung bean breeding, and can also be used for breeding new male sterile mung bean lines.

[0019] 3. Since the male sterility of vrnp is a recessive trait, it is impossible to find plants with recessive sterility genes by direct observation during the breeding process. The molecular marker vrnp-52k-del provided by the present invention is a co-dominant marker. If two bands of 348bp and 583bp appear in the amplified product, it is a heterozygous plant with a recessive sterility gene. Therefore, the molecular marker vrnp-52k-del provided by the present invention can facilitate the breeding of new male sterile mung bean lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 The process of genetic positioning of the male sterility gene vrnp in mung bean. A is the linkage analysis of the sterility gene on chromosome 10; B is the chromosome recombination analysis in a population of 206 F2 plants; C is the chromosome recombination analysis in a population of 1000 F2 plants; black rectangles represent sterile genotypes; gray rectangles represent heterozygous genotypes; white rectangles represent fertile genotypes; F represents fertile phenotypes; S represents sterile phenotypes; Seg represents the separable fertility phenotypes of the offspring lines (F3) of the fertile plants.

[0022] Figure 2 Design principles for the mung bean male sterility molecular marker vrnp-52k-del.

[0023] Figure 3 The electrophoresis results of the mung bean male sterility molecular marker vrnp-52k-del are shown, where S represents Sulu No. 1, V represents V2709, and H represents a heterozygous plant.

[0024] Figure 4 The molecular marker vrnp-52k-del was linked to the male sterility trait of mung bean: an F2 population was used to analyze the linkage relationship between vrnp-52k-del and the male sterility trait, and it was found that vrnp-52k-del was linked to the male sterility trait of mung bean.

[0025] Figure 5 To use the molecular marker vrnp-52k-del to breed new male sterile mung bean lines. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0032] The embodiment of the present invention provides an application of a molecular marker linked to a male sterility trait of mung bean in detecting the male sterility trait of mung bean, wherein the molecular marker is located on chromosome 10 of mung bean, and the molecular marker has a deletion of a nucleotide fragment as shown in SEQ ID NO.1 starting from the 679 bp starting from the translation start site of the jg31919 gene;

[0033] The deleted fragment is located at 15143368bp to 15195752bp of chromosome 10; the reference genome is Jilv 7 (JL7, Liu C, Wang Y, Peng J, et al. High-quality genome assembly and pan-genome studies facilitate genetic discovery in mung bean and its improvement [J]. Plant Communications, 2022, 3 (6).).

[0034] In some specific embodiments, the genotype of the molecular marker includes a deletion of the nucleotide fragment shown in SEQ ID NO.1; when the genotype is deletion, the mung bean is a male sterile individual.

[0035] The embodiment of the present invention also provides an application of a specific primer in the detection of male sterility traits of mung bean or assisted breeding of mung bean, wherein the specific primer comprises a forward primer and two reverse primers; the nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3 and SEQ ID NO.4.

[0036] The embodiment of the present invention also provides a kit for use in detecting male sterility traits of mung beans or assisted breeding of mung beans, wherein the kit includes the specific primers.

[0037] The present invention also provides a method for detecting the molecular marker, comprising the following steps:

[0038] (1) Extracting the mung bean DNA to be tested;

[0039] (2) using the extracted DNA as a template, amplifying using the specific primers or the kit to obtain an amplified product;

[0040] (3) Identifying the genotype of the amplified product to screen out mung bean individuals with a missing genotype, i.e., male sterile individuals.

[0041] In some specific embodiments, the amplification reaction system is: ddH2O 5 μL, PCR MIX 10 μL, vrnp-52k-del-F (10 μM) 1 μL, vrnp-52k-del-R1 (10 μM) 1 μL, vrnp-52k-del-R2 (10 μM) 2 μL, DNA 1 μL;

[0042] The reaction program was: 95°C for 5 min; 94°C for 30 sec, 57°C for 30 sec, 72°C for 30 sec, 35 cycles; 72°C for 10 min.

[0043] The embodiment of the present invention also provides a method for detecting whether mung beans are male sterile, and the molecular marker is detected on the mung bean individuals to be tested.

[0044] The embodiment of the present invention also provides a mung bean assisted breeding method, comprising the step of detecting the molecular marker.

[0045] In some specific embodiments, the mung bean assisted breeding method uses the mung bean male sterile mutant vrnp as the donor parent and 'Su Lu No. 1' as the recurrent parent, and performs backcrossing and selection for 5 generations;

[0046] In some specific embodiments, the mung bean assisted breeding method comprises the following steps:

[0047] (1) The male sterile mutant vrnp of mung bean was used as the donor parent and the excellent mung bean variety 'Su Lu No. 1' was used as the recurrent parent to obtain F1;

[0048] (2) backcrossing F1 with the recurrent parent described in step (1) to obtain BC1F1;

[0049] (3) Using DNA from BC1F1 plants as template, PCR amplification was performed using specific primers;

[0050] (4) Identifying the genotype of the PCR product, selecting the heterozygous plant with two bands of 348 bp and 583 bp amplified, and performing the next round of backcrossing with 'Su Lu No. 1' to obtain BC2F1;

[0051] (5) Using the BCnF1 plant DNA obtained in each generation as a template, repeat steps (3) and (4) until BC4F1 is obtained;

[0052] (6) BC4F2 was obtained by self-pollination of BC4F1. The DNA of BC4F2 plants was used as a template and specific primers were used for PCR amplification. The genotype of the amplified product was identified and the plants that only amplified the 583 bp band were selected, which were the male sterile individuals.

[0053] The experimental methods in the examples of the present invention where specific conditions are not specified are usually carried out under conventional conditions, such as those described in Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) by Sambrook et al., or according to the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0054] Example 1

[0055] Development of Molecular Markers for Male Sterility in Mung Bean

[0056] In the early stage of the present invention, a male sterile mutant vrnp showing no pollen was screened from the gamma-ray radiation mutagenesis material of the mung bean variety Sulu No. 1.

[0057] The male sterile mutant vrnp was crossed with the male normal line V2709 to develop an F2 population containing 206 plants. Linkage analysis using InDel molecular markers and SSR markers located the gene controlling mung bean sterility between InDel05 and InDel10 ( Figure 1 Analysis of the chromosome recombinant plants of the F2 population revealed that the sterility gene can be located between the molecular markers InDel15 and InDel20 ( Figure 1 Then, a 1000-plant F2 population was planted, and the chromosome recombinant plants in the F2 population were screened using InDel20 and InDel05, and 9 recombinant plants were obtained. KASP markers were developed within the localization interval to analyze these 9 recombinant plants, and the sterility gene of vrnp was located within a 423.76 kb interval between molecular markers KASP01 and KASP04 on chromosome 10 ( Figure 1 Middle C).

[0058] By analyzing the functions of candidate genes in the localization interval, jg31919 was found to be a candidate gene for male sterility. The gene is located on chromosome 10 of mung bean. The gene encodes a MYB transcription factor, which is involved in the programmed degradation of the anther tapetum and is related to male sterility. Sequencing analysis revealed that the jg31919 gene of the mung bean male sterile mutant vrnp has a nucleotide fragment missing from position 679 as shown in SEQ ID NO.1, resulting in a C'-terminal deletion of the encoded protein. The missing fragment is located from 15143368bp to 15195752bp on chromosome 10.

[0059] SEQ ID NO.1:

[0060] ATAAAAGATTGGATTTTGTATGTAAACTATTGTAGAGAAAGAGGAAAACAAA AATTATACCACAAGAAGTCCCTCAGAAAGGAGAGGCAGATCCATGATC…TCTC AACAGTTGCGTCCTTTTCATCTGACTTACAATTAATGTAATCAGTGAAGTTATTCCC CAGTGCTGCAGCGGAATGCTGGCCATGGAAGTTAATTGG.

[0061] Therefore, the specific primers for the mung bean male molecular marker vrnp-52k-del were designed using this deletion. The primers include:

[0062] Common forward primer vrnp-52k-del-F (SEQ ID NO. 2): 5′-CCAGGACGCACTGACAATGA-3′;

[0063] Reverse primer vrnp-52k-del-R1 (SEQ ID NO. 3): 5′-TTGTTGCATGGCCTTGGATA-3′;

[0064] Reverse primer: vrnp-52k-del-R2 (SEQ ID NO. 4): 5′-TCCAGCAATCAGCAACACAA-3′).

[0065] The principle of marker amplification is shown in the attached Figure 2 As shown, for the fertile Sulu No. 1 and V2709, the reverse primer vrnp-52k-del-R1 designed on the missing fragment and the shared forward primer vrnp-52k-del-F amplified a 348 bp fragment; however, this fragment was missing in the sequence of the male sterile mutant vrnp, so vrnp-52k-del-F / vrnp-52k-del-R1 could not be amplified in vrnp. For vrnp, the reverse primer vrnp-52k-del-R2 and the shared forward primer vrnp-52k-del-F amplified a 583bp fragment; however, there was no deletion fragment in Sulu No. 1 or V2709 with normal fertility, and vrnp-52k-del-F / vrnp-52k-del-R2 exceeded the capacity of PCR amplification, so vrnp-52k-del-F / vrnp-52k-del-R2 could not be amplified in Sulu No. 1 or V2709.

[0066] The DNA of Su Lu No. 1, V2709, the F1 heterozygote hybridized by the male sterile mutant vrnp and the male normal strain V2709, and vrnp were amplified by PCR using vrnp-52k-del-F / vrnp-52k-del-R1 / vrnp-52k-del-R2 (the PCR reaction system is shown in Table 1, and the PCR program is shown in Table 2). Then, the bands amplified from Su Lu No. 1, V2709, the F1 heterozygote, and vrnp were distinguished by 2% agarose electrophoresis, where the band results of Su Lu No. 1 and V2709 were recorded as A, the band results of the F1 heterozygote were recorded as H, and the band results of vrnp were recorded as ( Figure 3). Therefore, the primers vrnp-52k-del-F / vrnp-52k-del-R1 / vrnp-52k-del-R2 can be used to form a molecular marker, named vrnp-52k-del, which can be used to detect plants carrying male sterility genes in mung bean segregation groups.

[0067] If the amplified band is 348 bp, it indicates that the plant is fertile; if the amplified band is 583 bp, it indicates that the plant is sterile; if the amplified bands are 348 bp and 583 bp, it indicates that the plant is a fertile / sterile heterozygous plant.

[0068] Table 1 PCR reaction system (20 μL system)

[0069]

[0070] Table 2 PCR reaction program

[0071]

[0072] Example 2

[0073] Molecular marker-assisted selection breeding of male sterility in mung bean

[0074] 1. Linkage between the vrnp-52k-del molecular marker and the male sterility trait in mung bean

[0075] The male sterile mutant vrnp of mung bean was crossed with the fertile V2709 to develop an F2 population. DNA was extracted from each individual plant in the population according to the instructions of the kit (Tiangen, High-efficiency Plant Genomic DNA Extraction Kit, DP350). Then, PCR reaction was performed using the primers of the molecular marker vrnp-52k-del. The reaction system is shown in Table 1, and the PCR program is shown in Table 2.

[0076] The obtained PCR products were subjected to electrophoresis using 2% agarose gel. Figure 4 Among them, the plant that only amplified the 348bp band was a normal male plant, recorded as "A"; the plant that amplified both the 348bp and 583bp bands was a heterozygous plant, recorded as "H"; the plant that only amplified the 583bp band was a male sterile plant, recorded as "B".

[0077] Based on the above results, the linkage relationship between vrnp-52k-del and the male sterility trait was analyzed. Some results are shown in Table 3. It can be seen that the molecular marker vrnp-52k-del is linked to the male sterility trait of mung bean.

[0078] Table 3

[0079] Plant number genotype Phenotype 1 H Fertile 2 A Fertile 3 H Fertile 4 H Fertile 5 B Infertility 6 A Fertile 7 H Fertile 8 A Fertile 9 H Fertile 10 H Fertile 11 H Fertile 12 A Fertile 13 B Infertility 14 B Infertility 15 H Fertile 16 B Infertility 17 A Fertile 18 A Fertile 19 H Fertile 20 H Fertile 21 B Infertility 22 H Fertile

[0080] 2. Application of Molecular Markers of Male Sterility in Backcrossing to Select New Male Sterile Mung Bean Lines

[0081] like Figure 5 As shown, the mung bean male sterile mutant vrnp was used as the donor parent, and the excellent mung bean variety 'Su Lu No. 1' was used as the recurrent parent, and five generations of backcrossing and selection were performed. The specific steps are as follows:

[0082] (1) The male sterile mutant vrnp of mung bean was used as the donor parent and the excellent mung bean variety 'Su Lu No. 1' was used as the recurrent parent to obtain F1;

[0083] (2) backcrossing F1 with the recurrent parent described in step (1) to obtain BC1F1;

[0084] (3) Using DNA from BC1F1 plants as template and molecular marker vrnp-52k-del as primers, PCR reaction was performed. The reaction system is shown in Table 1 and the PCR program is shown in Table 2.

[0085] (4) The obtained PCR products were subjected to electrophoresis using 2% agarose gel, and the heterozygous plants with two bands of 348 bp and 583 bp were selected for the next round of backcrossing with 'Su Lu No. 1' to obtain BC2F1;

[0086] (5) Using the BCnF1 plant DNA obtained in each generation as a template, repeat steps (3) and (4) until BC4F1 is obtained;

[0087] (6) BC4F2 was obtained by self-pollination of BC4F1, and BC4F2 plant DNA was used as a template to perform PCR amplification according to the method of step (3). The amplified product was subjected to electrophoresis using 2% agarose gel, and the plant with only a 583 bp band was selected as the new male sterile mung bean variety.

[0088] In summary, the present invention provides a molecular marker linked to the male sterility trait of mung bean and its application, which can facilitate the breeding of male sterile lines of mung bean. The present invention uses the long fragment deletion variation in the EVM0016947 gene of the sterile mung bean line vrnp to design a molecular marker vrnp-52k-del linked to the male sterility trait of mung bean, uses an F2 population to analyze the linkage relationship between vrnp-52k-del and the male sterility trait, and finds that the molecular marker vrnp-52k-del is linked to the male sterility trait of mung bean, which can be used to breed new male sterile mung bean lines.

[0089] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. Application of a molecular marker linked to the male sterility trait of mung bean in detecting the male sterility trait of mung bean, characterized in that: The molecular marker is located on chromosome 10 of mung bean, and the molecular marker has a deletion of the nucleotide fragment shown in SEQ ID NO.1 starting from the 679 bp starting from the translation start site of the jg31919 gene; The deleted fragment is located from 15143368bp to 15195752bp of chromosome 10; the reference genome is Jilv 7.

2. The use according to claim 1, characterized in that: The genotype of the molecular marker includes the deletion of the nucleotide fragment shown in SEQ ID NO.1; when the genotype is deletion, the mung bean is a male sterile individual.

3. Application of a specific primer in detecting male sterility of mung bean or in assisted breeding of mung bean, characterized in that: The specific primers include a forward primer and two reverse primers; the nucleotide sequence of the forward primer is shown as SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.3 and SEQ ID NO.

4.

4. Use of a kit for detecting male sterility traits of mung beans or assisted breeding of mung beans, characterized in that: The kit comprises the specific primer according to claim 3.

5. A method for detecting the molecular marker according to claim 1, characterized in that: The following steps are involved: (1) Extracting mung bean DNA to be tested; (2) using the extracted DNA as a template, and performing amplification using the specific primers described in claim 3 or the kit described in claim 4 to obtain an amplified product; (3) Identifying the genotype of the amplified product to screen out mung bean individuals with a missing genotype, i.e., male sterile individuals.

6. A method for detecting whether mung bean is male sterile, characterized in that: The molecular markers as claimed in claim 1 are detected on the mung bean individuals to be tested.

7. A mung bean assisted breeding method, characterized in that: The method comprises the step of detecting the molecular marker as claimed in claim 1.

Images