Reagent, kit and system for identifying canine parvovirus and / or feline parvovirus

Abstract

The invention discloses a reagent, a kit and a system for identifying canine parvovirus and / or feline parvovirus. Wherein the reagent comprises a reagent for detecting nucleic acid sequences of the canine parvovirus and the feline parvovirus, the nucleic acid sequence of the canine parvovirus comprises a nucleic acid sequence as shown in the 38th-156th site of SEQ ID NO: 11, and the nucleic acid sequence of the feline parvovirus comprises a nucleic acid sequence as shown in the 38th-216th site of SEQ ID NO: 12. By applying the technical scheme provided by the invention, the nucleotide difference between CPV-2 and FPV genotypes is found, and the universal forward and reverse primers for the canine and feline parvoviruses are designed in a conserved region, so that the canine and feline parvoviruses can be accurately, quickly and efficiently detected. Furthermore, an FPV specific probe is designed according to the differential base sites, so that CPV-2 and FPV can be distinguished and identified.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a reagent, a kit and a system for identifying canine parvovirus and / or feline parvovirus. Background Art

[0002] Canine parvovirus 2 (CPV-2) and feline parvovirus (FPV) both belong to the Parvoviridae family and the Parvovirus genus. They are widely distributed in nature and are important pathogens in wild carnivores.

[0003] Parvovirus particles are small (about 25 nanometers in diameter) non-enveloped icosahedral capsids. The virus has a linear, single-stranded, negative-sense DNA genome of about 5200 nucleotides, containing two major open reading frames (ORFs). One of them encodes the nonstructural proteins NS1 and NS2, and the other encodes the structural proteins VP1 and VP2. At both ends of the genome, palindromic hairpins of about 150 bases are used for the replication of viral DNA. Canine parvovirus (CPV-2) and feline parvovirus (FPV) are more than 98% identical in DNA sequence.

[0004] Currently, CPV-2 is prevalent around the world, and the virus continues to evolve and form multiple variants: CPV-2a, CPV-2b and CPV-2c. The original CPV-2 can infect dogs but has lost the ability to infect cats, while the variants CPV-2a / 2b / 2c have regained the ability to infect cats. As for FPV, under natural conditions, it can infect a variety of animals such as cats, mustelids and procyonids, such as tigers, leopards, lions and raccoons, but not domestic dogs (FPV can replicate in the thymus and bone marrow of dogs, but not in important disease sites such as the dog's mesenteric lymph node or small intestine, and does not invade the internal organs and digestive tract, let alone spread the virus).

[0005] Studies have shown that there are common antigenic components between CPV-2 and FPV, and serological reactions can occur. There are also reports on the use of FPV attenuated vaccines to immunize dogs to prevent CPV-2 infection. However, the immune protection produced by FPV is far less than that of CPV-2. The immune effects of using FPV vaccines to prevent CPV-2 or using CPV-2 vaccines to prevent FPV are not ideal. Given that the diseases caused by CPV-2 and FPV are common and frequent diseases in dogs and cats in clinical practice, and have similar symptoms, and the diseases caused by CPV-2 have a higher mortality rate. Therefore, a typing method that can identify and detect CPV-2 and FPV is needed to provide a reference for the prevention, diagnosis, epidemiological investigation and vaccine development of canine and feline parvovirus diseases in clinical practice.

[0006] At present, the main methods for detecting parvovirus include virus isolation and culture, fluorescent antibody technology, electron microscopy and immunoelectron microscopy technology, hemagglutination test and hemagglutination inhibition test, enzyme-linked immunosorbent assay, etc. However, all of the above methods have certain shortcomings and deficiencies. Virus isolation and culture require necessary laboratory conditions and professional skills; electron microscopy-related technologies require expensive instruments and equipment; fluorescent antibody technology is limited to detecting viruses in pathological tissues or cell cultures; enzyme-linked immunosorbent assay is easily affected by interference factors and has poor sensitivity; hemagglutination test and hemagglutination inhibition test require fresh sensitive red blood cells to be prepared at any time, and sometimes hemagglutination inhibition test is required for verification. All of them have the problems of cumbersome operation, time-consuming and low sensitivity.

[0007] In summary, the prior art obviously has inconveniences and defects in practical use, so it is necessary to improve it. Summary of the invention

[0008] The present invention aims to provide a reagent, a kit and a system for identifying canine parvovirus and / or feline parvovirus, so as to improve the accuracy of identifying canine parvovirus and feline parvovirus.

[0009] In order to achieve the above object, according to one aspect of the present invention, a reagent for identifying canine parvovirus and / or feline parvovirus is provided. The reagent includes a reagent for detecting canine parvovirus and feline parvovirus nucleic acid sequences, the nucleic acid sequence of canine parvovirus includes the nucleic acid sequence shown at positions 38-156 of SEQ ID NO: 11, and the nucleic acid sequence of feline parvovirus includes the nucleic acid sequence shown at positions 38-216 of SEQ ID NO: 12.

[0010] Furthermore, the nucleic acid sequence of canine parvovirus includes the nucleic acid sequence shown in SEQ ID NO:11, and the nucleic acid sequence of feline parvovirus includes the nucleic acid sequence shown in SEQ ID NO:12.

[0011] Furthermore, the reagent includes a universal probe for detecting canine parvovirus and feline parvovirus nucleic acid sequences, whose sequence is selected from a nucleotide sequence complementary to or identical to 23 to 29 consecutive nucleotides in SEQ ID NO: 11; preferably, the reagent also includes a feline parvovirus-specific probe, whose sequence is selected from a nucleotide sequence complementary to or identical to 19 to 25 consecutive nucleotides at the junction of two repeated sequences in SEQ ID NO: 12.

[0012] Furthermore, the probe includes a universal probe for canine and feline parvovirus SEQ ID NO: 5; preferably, the reagent also includes a feline parvovirus-specific probe SEQ ID NO: 6.

[0013] Furthermore, the reagent includes a primer pair for detecting the canine parvovirus and feline parvovirus nucleic acid sequences, the primer pair including an upstream primer and a downstream primer, the upstream primer sequence is selected from a 22 to 28 consecutive nucleotide sequence in the upstream of SEQ ID NO: 11; the downstream primer sequence is selected from a nucleotide sequence complementary to 25 to 32 consecutive nucleotides in the downstream of SEQ ID NO: 11.

[0014] Furthermore, the primer pair includes a universal forward primer for canine and feline parvovirus SEQ ID NO: 1 and a universal reverse primer for canine and feline parvovirus SEQ ID NO: 3.

[0015] Furthermore, the feline parvovirus-specific probe and / or the canine and feline parvovirus universal probe are each modified with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end; optionally, the fluorescent reporter group is any one or more of FAM, HEX (VIC), TAMRA, ROX and CY5, and the quencher group is MGB.

[0016] According to another aspect of the present invention, a kit for identifying canine parvovirus and / or feline parvovirus is provided. The kit comprises the above-mentioned reagent for identifying canine parvovirus and / or feline parvovirus, and preferably, the kit further comprises a Realtime PCR reaction reagent; more preferably, the Realtime PCR reaction reagent comprises at least one of Mix, Taq enzyme and water; further preferably, Mix comprises an amplification buffer, dNTPs, UDG enzyme and MgCl2.

[0017] According to another aspect of the present invention, a system for identifying canine parvovirus and / or feline parvovirus is provided. The system comprises: a nucleic acid extraction device configured to extract sample nucleic acid; a detection device comprising a real-time fluorescence quantitative PCR analyzer and any of the above reagents for identifying canine parvovirus and feline parvovirus; and a data analysis device configured to analyze the data file of the real-time fluorescence quantitative PCR analyzer and output the result.

[0018] Furthermore, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 92-98°C for 30s-90s; denaturation at 92-98°C for 2-8s, annealing at 58-62°C for 8-12s and collecting fluorescence signal processing, for a total of 40-44 cycles.

[0019] According to another aspect of the present invention, there is provided a use of any one of the above reagents, kits or systems in the detection of canine parvovirus and / or feline parvovirus.

[0020] By applying the technical solution of the present invention, the nucleotide differences between CPV-2 and FPV genotypes are found, and universal canine and feline parvovirus forward and reverse primers are designed in the conserved region, which can accurately, quickly and efficiently detect canine and feline parvovirus. Furthermore, FPV-specific probes are designed according to the differential base sites, so that CPV-2 and FPV can be distinguished and identified. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The drawings constituting a part of the present application are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0022] Figure 1 The location of the probe specific for feline parvovirus is shown;

[0023] Figure 2 The amplification curve of the primer-probe screening of canine parvovirus (FAM, ROX channels) in Example 1 is shown;

[0024] Figure 3 The amplification curve of the primer-probe screening of feline parvovirus (FAM channel) in Example 1 is shown;

[0025] Figure 4 The amplification curve of the primer-probe screening of feline parvovirus (ROX channel) in Example 1 is shown;

[0026] Figure 5 The amplification curve of the sensitivity detection of canine parvovirus (FAM channel) in Example 2 is shown;

[0027] Figure 6 The amplification curve of the sensitivity detection of feline parvovirus (FAM channel) in Example 2 is shown;

[0028] Figure 7 The amplification curve of the sensitivity detection of feline parvovirus (ROX channel) in Example 2 is shown;

[0029] Figure 8 The amplification curve of the sensitivity confirmation of canine parvovirus (FAM channel) in Example 2 is shown;

[0030] Fig. 9 The amplification curve of the sensitivity confirmation of feline parvovirus (FAM channel) in Example 2 is shown;

[0031] Fig.10 The amplification curve of the sensitivity confirmation of feline parvovirus (ROX channel) in Example 2 is shown;

[0032] Fig.11 The amplification curves of the canine and feline parvovirus reagents in Example 3 specific to other viruses are shown. DETAILED DESCRIPTION

[0033] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0034] In order to provide a more accurate primer-probe combination or reagent for distinguishing canine parvovirus (CPV-2) and feline parvovirus (FPV), the inventors of the present invention found the nucleotide differences between CPV-2 and FPV genotypes, designed FPV-specific probes based on the differential base sites, designed universal canine and feline parvovirus probes in the conserved region, and universal forward and reverse primers. Thus, CPV-2 and FPV can be distinguished and identified, providing a reference for the prevention, diagnosis, epidemiological investigation and vaccine development of canine and feline parvovirus diseases in clinical practice.

[0035] Specifically, the genome sequences of CPV-2 and FPV are highly consistent. Based on the full gene sequences of canine parvovirus (CPV-2a: OP972596.1 and OP972595.1; CPV-2b: MW539053.1; CPV-2c: KU508407.1) and feline parvovirus (FPV: OM638042.1, MZ005633.1) logged in Genbank, it was found that FPV had an inserted repetitive sequence (SEQ ID NO: 10): CAACTAGCACCTAGAAAATTATATTAATATACTTACTATGTTTTTATGTTTATTACATAT. Based on this, a universal canine and feline parvovirus probe and a specific feline parvovirus probe were designed, thereby distinguishing and identifying CPV-2 and FPV.

[0036] According to a typical embodiment of the present invention, a reagent for distinguishing canine parvovirus and feline parvovirus is provided. The reagent includes a reagent for detecting canine parvovirus and feline parvovirus nucleic acid sequences, the nucleic acid sequence of canine parvovirus includes the nucleic acid sequence shown at positions 38-156 of SEQ ID NO: 11, and the nucleic acid sequence of feline parvovirus includes the nucleic acid sequence shown at positions 38-216 of SEQ ID NO: 12; preferably, the nucleic acid sequence of canine parvovirus includes the nucleic acid sequence shown at positions 38-216 of SEQ ID NO: 12.

[0037] Among them, the canine parvovirus (CPV-2) amplified fragment is (SEQ ID NO: 11):

[0038] TGTACCAAGTAATATTGGAGGTATGAAAATTGTATATGAAAAATCTCAACTAGCACCTAGAAAATTATAYTAACATACTTACTATGTTTTTATGTTTATTACATATTATTTTAAGATTAATTAAATTACAGCATAGAAATATTGTACTTGTAYTTGATA, Y=C or T.

[0039] The feline parvovirus (FPV) amplified fragment is (SEQ ID NO: 12):

[0040] TGTACCAAAATAATATTGGAGCTATGAAAATTGTATATGAAAAATCT CAACTAGCACCTAGAAAATTAT ATTAATATACTTACTATGTTTTTATGTTTATTACATATCAACTAGCACCTAGAAAATTATATTAATATACTTACTA TGTTTTTATGTTTATTACATAT TATTTTAAGATTAATTAAATTACAGCATAGAAATATTGTACTTGTATTTGATA, or 87del T (the nucleotide sequence of the double underlined portion and the single underlined portion is repeated).

[0041] In one embodiment of the present invention, the reagent includes a primer pair for detecting the canine parvovirus and feline parvovirus nucleic acid sequences, the primer pair including an upstream primer and a downstream primer, the upstream primer sequence is selected from the 22 to 28 consecutive nucleotide sequences in the upstream of SEQ ID NO: 11; the downstream primer sequence is selected from the nucleotide sequence complementary to the 25 to 32 consecutive nucleotides in the downstream of SEQ ID NO: 11 ("upstream" and "downstream" have the conventional meanings in the art).

[0042] Typically, the reagents include primer pairs, which include primer pairs for detecting canine parvovirus and feline parvovirus nucleic acid sequences. Preferably, the primer pairs include canine and feline parvovirus universal forward primer SEQ ID NO: 1 and canine and feline parvovirus universal reverse primer SEQ ID NO: 3.

[0043] By applying the technical solution of the present invention, the nucleotide differences between CPV-2 and FPV genotypes are found, and universal canine and feline parvovirus forward and reverse primers are designed in the conservative region, which can accurately, quickly and efficiently detect canine and feline parvovirus.

[0044] In one embodiment of the present invention, the reagent also includes a universal probe for detecting canine parvovirus and feline parvovirus nucleic acid sequences, and its sequence is selected from a nucleotide sequence that is complementary or identical to 23 to 29 consecutive nucleotides in SEQ ID NO: 11; preferably, the reagent also includes a feline parvovirus-specific probe, and its sequence is selected from a nucleotide sequence that is complementary or identical to 19 to 25 consecutive nucleotides at the junction of two repeated sequences in SEQ ID NO: 12 (i.e., the feline parvovirus-specific probe covers the junction of two repeated sequences).

[0045] Preferably, the reagent also includes a feline parvovirus-specific probe SEQ ID NO: 6, and more preferably, the reagent also includes a canine and feline parvovirus universal probe SEQ ID NO: 5. CPV-2 and FPV can be detected using a universal primer probe, and FPV can be identified using a specific probe, thereby achieving the purpose of distinguishing CPV-2 from FPV. The reagent of the present invention can be used to amplify the target fragment from the feces or secretions of animals infected with parvovirus, which is fast and efficient, has a high detection rate, accurate results, and controllable costs.

[0046] The fluorescence PCR method is to detect and analyze the target gene by detecting the real-time changes of the fluorescence signal during the PCR process. Fluorescence PCR can quickly detect the target gene DNA with high sensitivity and high specificity. Even when the specimen contains trace amounts of parvovirus DNA, it can be efficiently detected. Although there are reports on fluorescence PCR detection methods for canine parvovirus or feline parvovirus, there are no reports on fluorescence PCR detection methods for typing canine parvovirus and feline parvovirus. According to a typical embodiment of the present invention, the 5' end of each canine parvovirus and feline parvovirus probe is modified with a fluorescent reporter group, and the 3' end is modified with a fluorescent quencher group; optionally, the CPV-2 and FPV reporter groups are any one or more of FAM, HEX (VIC), TAMRA, ROX, and CY5, respectively, and the quencher group is MGB.

[0047] According to a typical embodiment of the present invention, a kit for identifying canine parvovirus and / or feline parvovirus is provided. The kit comprises the above-mentioned reagents for identifying canine parvovirus and / or feline parvovirus, preferably, the kit also comprises a Real time PCR reaction reagent; more preferably, the Real time PCR reaction reagent comprises at least one of Mix, Taq enzyme and water; further preferably, Mix comprises amplification buffer, dNTPs, UDG enzyme and MgCl2.

[0048] The primers and probes provided by the present invention can simultaneously detect canine parvovirus and feline parvovirus and distinguish them in one reaction system, have good accuracy and specificity, and can save costs. Since the present invention adopts a probe with high specificity to be applied to the reagent, canine parvovirus and feline parvovirus nucleic acids in unknown samples can be quickly detected, providing a reliable experimental basis for distinguishing canine parvovirus and feline parvovirus nucleic acids.

[0049] According to a typical embodiment of the present invention, a system for distinguishing canine parvovirus and feline parvovirus is provided. The system comprises a nucleic acid extraction device, a detection device and a data analysis device, wherein the nucleic acid extraction device is configured to extract sample nucleic acid; the detection device comprises a real-time fluorescence quantitative PCR analyzer and any of the above reagents for distinguishing canine parvovirus and feline parvovirus; and the data analysis device is configured to analyze the data file of the real-time fluorescence quantitative PCR analyzer and output the result.

[0050] In a preferred embodiment of the present invention, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 92-98°C for 30s-90s; denaturation at 92-98°C for 2-8s, annealing at 58-62°C for 8-12s and collecting fluorescence signal processing, for a total of 40-44 cycles. According to a typical embodiment of the present invention, the use of any of the above reagents or kits in the detection of canine parvovirus and / or feline parvovirus is provided. In a typical embodiment of the present invention, the system is configured to select a fluorescence channel according to the fluorescent group of the probe corresponding to each reagent combination. If the channel detects a typical S-type amplification curve and Ct≤36, the output detection result is positive; if the channel detects a typical S-type amplification curve and Ct>36, the output detection result is negative.

[0051] The present invention provides a method for detecting canine parvovirus and feline parvovirus for non-diagnostic or therapeutic purposes, comprising:

[0052] (1) obtaining nucleic acid from a sample to be tested;

[0053] (2) Using the above primer-probe combination to perform Real time PCR on the sample to be tested,

[0054] In the present invention, the sample to be tested is an anal swab, feces and secretions of a dog or cat.

[0055] The reaction system and reaction procedure of Real time PCR are the same as those in the above system.

[0056] According to a typical embodiment of the present invention, the result analysis includes:

[0057] 1) The target detection signal is FAM (common to CPV-2 and FPV) and ROX (FPV);

[0058] 2) Baseline setting: The baseline is generally set to 3-15 cycles, which can be adjusted according to actual conditions. The adjustment principle is: select the area where the fluorescence signal is relatively stable before exponential amplification, avoid the signal fluctuation at the beginning of fluorescence acquisition at the starting point (Start), and reduce the Ct of the sample with the earliest exponential amplification by 1-2 cycles at the end point (End). Threshold setting: The threshold line is set to just exceed the highest point of the normal negative control.

[0059] 3) Select a fluorescence channel according to the fluorescent group of the probe corresponding to each reagent combination. If the channel detects a typical S-shaped amplification curve and Ct≤36, it means that the test result is positive; if the channel detects a typical S-shaped amplification curve and Ct>36, it means that the test result is negative.

[0060] The present invention provides a primer-probe combination for identifying canine parvovirus and feline parvovirus. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0061] The specific implementation of the present invention is further described below in conjunction with the accompanying drawings and embodiments. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and cannot be used to limit the protection scope of the present invention.

[0062] The test materials and instruments used in the present invention are all common commercial products and can be purchased in the market.

[0063] The primers and probes used in the following examples were synthesized by Shanghai Sangon Biotechnology Service Co., Ltd.

[0064] The sources of some reagents and instruments in the following examples are as follows:

[0065] 2×Mix (containing amplification buffer, dNTPs, UDG enzyme, MgCl2) and 5U / μl Taq enzyme were both from Feipeng Biotechnology Co., Ltd.

[0066] The present invention will be further described below in conjunction with embodiments:

[0067] Example 1

[0068] Design and validation of primers and probes

[0069] Parvovirus has a linear, single-stranded, antisense DNA genome of about 5,200 nucleotides in length, containing two major open reading frames (ORFs). One of them encodes the nonstructural proteins NS1 and NS2, and the other encodes the structural proteins VP1 and VP2. According to the full gene sequences of canine parvovirus (CPV-2a: OP972596.1 and OP972595.1; CPV-2b: MW539053.1; CPV-2c: KU508407.1) and feline parvovirus (FPV: OM638042.1, MZ005633.1) registered in Genbank, the results were compared (e.g. Figure 1 As shown, Figure 1 The sequences of the upper and lower parts are continuous sequences), and it was found that FPV has an inserted repetitive sequence (see the description of the specific implementation method part for details). Therefore, FPV-specific probes can be designed in the inserted sequence and the common sequence, and canine and feline parvovirus probes can be designed in the common conserved region to distinguish CPV-2 from FPV.

[0070] In the design process of the above primers and probes, try to select primer probe fragments with fewer hairpin structures, primer internal dimers, primer inter-dimers, and mismatch formation. Then compare and analyze the designed primer probe sequences on the NCBIBlast online database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to avoid non-specific binding and amplification with other pathogens or human genes.

[0071] After multiple rounds of screening and optimization on a conventional real-time fluorescence quantitative PCR instrument, performance comparison and confirmation were performed using a real-time fluorescence quantitative PCR analyzer to ultimately determine a set of primer and probe combinations with the best sensitivity and specificity.

[0072] In addition, a pair of universal primer probes for canine and feline parvovirus were designed as controls.

[0073] Table 1 CPV-2 and FPV specific probe and primer sequences

[0074]

[0075] Five sets of primer-probe combinations were prepared using the following amplification systems, and the amplification efficiencies of the five sets of primer-probe combinations were compared. The 2×Mix (containing amplification buffer, dNTPs, UDG enzyme, MgCl2) and 5U / μl Taq enzyme in the preparation table were all derived from self-produced raw materials developed by Feipeng Biotechnology Co., Ltd., and the primers and probes in the preparation table were all synthesized by Sangon Biotechnology.

[0076] Table 2-1Real time PCR reaction system

[0077]

[0078]

[0079] Table 2-2

[0080]

[0081] Table 2-3

[0082]

[0083] Among them, there are 2 canine and feline parvovirus probes, 2 universal forward primers, and 2 reverse primers, as shown in Table 1. Therefore, 4 sets of primer-probe combinations can be formed, which are respectively recorded as 1-1, 1-2, 2-1, and 2-2 systems, plus a control group, for a total of 5 groups.

[0084] A sick dog confirmed to be infected with canine parvovirus and a sick cat confirmed to be infected with feline parvovirus were taken, and a small amount of feces was scraped from each. Virus DNA / RNA rapid extraction reagent (magnetic bead method) (Guangdong Runpeng Biological, RK1001) was used to complete the extraction of 200 μL samples, and then the above-mentioned Real time PCR reaction system was used for detection, and the template sample volume was 10 μl.

[0085] The amplification program is shown in Table 3 below:

[0086] Table 3: Real time PCR amplification program

[0087]

[0088] Among them, the target detection signals are FAM (common to CPV-2 and FPV) and ROX (FPV);

[0089] The amplification results are shown in the following table. Figure 2 , Figure 3 , Figure 4 As shown:

[0090] Table 4-1 Table 4-2

[0091]

[0092] The results showed that these four systems could clearly distinguish CPV-2 from FPV, and the detection effect was better than that of the control group. Among them, the overall amplification effect of the 1-1 system was the best, with a better linear shape and a higher signal value, so the first set of primer probe combinations was used as primer probes in subsequent examples.

[0093] Example 2

[0094] Sensitivity

[0095] The canine parvovirus sample and the feline parvovirus sample in Example 1 were calibrated for concentration, and then diluted 2-fold with deionized water to concentrations of 1000 copies / mL, 500 copies / mL, and 250 copies / mL, respectively. The diluted sample nucleic acid was detected using the reaction system determined above. The results are shown in Table 5. Figure 5 , Figure 6 , Figure 7 Then the canine parvovirus sample and the feline parvovirus sample were confirmed at a concentration of 500 copies / mL. The results are shown in Table 6. Figure 8 , Fig. 9 , Fig.10 The results show that the detection method of the present invention has high sensitivity, and the sensitivity can reach 500 copies / mL.

[0096] The amplification results are shown in Tables 5 and 6 below. Figures 5 to 10 As shown:

[0097] Table 5

[0098]

[0099] Table 6

[0100]

[0101]

[0102] Example 3

[0103] Specificity

[0104] Samples of canine coronavirus, feline coronavirus, canine distemper virus, canine rotavirus, feline herpes virus and feces samples of healthy dogs and cats were taken for specific testing. After extracting the samples, nucleic acid was tested. The results were as follows: Fig.11 As shown. According to the results, neither canine parvovirus nor feline parvovirus was detected. The results were in line with expectations, confirming that the primer probe or reagent has good specificity.

[0105] The amplification results are shown in the following table. Fig.11 As shown:

[0106] Table 7

[0107]

[0108]

[0109] Example 4

[0110] In this embodiment, a specific kit is provided, comprising: a universal forward primer for canine and feline parvovirus SEQ ID NO: 1 and a universal reverse primer for canine and feline parvovirus SEQ ID NO: 3; a feline parvovirus-specific probe SEQ ID NO: 6, and a universal probe for canine and feline parvovirus SEQ ID NO: 5; and a Real time PCR reaction reagent, wherein the Real time PCR reaction reagent comprises Mix, Taq enzyme and water, and the Mix comprises an amplification buffer, dNTPs, UDG enzyme and MgCl2.

[0111] Example 5

[0112] In this embodiment, a system for identifying canine parvovirus and feline parvovirus is provided. The system includes a nucleic acid extraction device, a detection device and a data analysis device, wherein the nucleic acid extraction device is configured to extract sample nucleic acid; the detection device includes a real-time fluorescence quantitative PCR analyzer and any of the above reagents for identifying canine parvovirus and feline parvovirus; and the data analysis device is configured to analyze the data file of the real-time fluorescence quantitative PCR analyzer and output the result.

[0113] The program settings of the real-time fluorescence quantitative PCR analyzer are as follows:

[0114] Table 8

[0115]

[0116] The reaction system in the real-time fluorescence quantitative PCR analyzer is:

[0117] Table 9

[0118]

[0119]

[0120] The baseline of the real-time fluorescence quantitative PCR analyzer was set to 3-15 cycles; the threshold was set to just exceed the highest point of the normal negative control.

[0121] The system is configured to select a fluorescence channel according to the fluorescent group of the probe corresponding to each reagent combination. If the channel detects a typical S-shaped amplification curve and Ct≤36, the output detection result is positive; if the channel detects a typical S-shaped amplification curve and Ct>36, the output detection result is negative.

[0122] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A reagent for identifying canine parvovirus and / or feline parvovirus, characterized in that: The reagents include reagents for detecting the canine parvovirus and feline parvovirus nucleic acid sequences, wherein the canine parvovirus nucleic acid sequence includes the nucleic acid sequence shown at positions 38-156 of SEQ ID NO: 11, and the feline parvovirus nucleic acid sequence includes the nucleic acid sequence shown at positions 38-216 of SEQ ID NO:

12.

2. The reagent according to claim 1, characterized in that The nucleic acid sequence of the canine parvovirus includes the nucleic acid sequence shown in SEQ ID NO: 11, and the nucleic acid sequence of the feline parvovirus includes the nucleic acid sequence shown in SEQ ID NO:

12.

3. The reagent according to claim 2, characterized in that The reagent comprises a universal probe for detecting the canine parvovirus and feline parvovirus nucleic acid sequences, wherein the probe sequence is selected from a nucleotide sequence complementary to or identical to 23 to 29 consecutive nucleotides in SEQ ID NO: 11; Preferably, the reagent further comprises a feline parvovirus-specific probe, the sequence of which is selected from a nucleotide sequence complementary to or identical to 19 to 25 consecutive nucleotides at the junction of two repeat sequences in SEQ ID NO:

12.

4. The reagent according to claim 3, characterized in that The probe includes a universal probe for canine and feline parvovirus SEQ ID NO: 5; Preferably, the reagent further comprises a feline parvovirus-specific probe SEQ ID NO:

6.

5. The reagent according to claim 1, characterized in that The reagent further includes a primer pair for detecting the canine parvovirus and feline parvovirus nucleic acid sequences, the primer pair including an upstream primer and a downstream primer, the upstream primer sequence is selected from a 22 to 28 consecutive nucleotide sequence in the upstream of SEQ ID NO: 11; the downstream primer sequence is selected from a nucleotide sequence complementary to 25 to 32 consecutive nucleotides in the downstream of SEQ ID NO:

11.

6. The reagent according to claim 5, characterized in that The primer pair comprises a universal forward primer SEQ ID NO: 1 for canine and feline parvovirus and a universal reverse primer SEQ ID NO: 3 for canine and feline parvovirus.

7. The reagent according to claim 6, characterized in that The feline parvovirus-specific probe and / or the canine and feline parvovirus universal probe are each modified with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end; Optionally, the fluorescent reporter groups are any one or more of FAM, HEX (VIC), TAMRA, ROX and CY5, and the quencher group is MGB.

8. A kit for identifying canine parvovirus and / or feline parvovirus, characterized in that: The kit comprises the reagent for identifying canine parvovirus and / or feline parvovirus according to any one of claims 1 to 7; Preferably, the kit further comprises a Real time PCR reaction reagent; More preferably, the Real time PCR reaction reagent includes at least one of Mix, Taq enzyme and water; Further preferably, the Mix comprises an amplification buffer, dNTPs, UDG enzyme and MgCl2.

9. A system for identifying canine parvovirus and / or feline parvovirus, characterized in that: include: A nucleic acid extraction device, configured to extract sample nucleic acid; A detection device, comprising a real-time fluorescence quantitative PCR analyzer and a reagent for distinguishing canine parvovirus and feline parvovirus according to any one of claims 1 to 8; The data analysis device is configured to analyze the data file of the real-time fluorescence quantitative PCR analyzer and output the result.

10. Use of the reagent for detecting canine parvovirus and / or feline parvovirus in a sample as claimed in any one of claims 1 to 7, the kit as claimed in claim 8 or the system as claimed in claim 9 in the detection of canine parvovirus and / or feline parvovirus.

Images