Primer combination for detecting virulent strain and variant strain of infectious bursal disease virus, detection method and kit

Abstract

The invention relates to the technical field of biological nucleic acid detection, in particular to a primer combination, a detection method and a kit for detecting virulent strains and variants of infectious bursal disease viruses. The primer probe combination comprises three pairs of specific primer probes designed according to VP2 gene segments of a virulent strain, a variant 1 and a variant 2 of the infectious bursal disease virus, and the sequences of the three pairs of primers are as shown in SEQ ID NO: 1-9. The primer probe combination provided by the invention can achieve the purpose of distinguishing and detecting different strains of IBDV through fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction). The primer probe combination provided by the invention has the advantages of high sensitivity, strong specificity and the like, and provides a new effective detection means for rapid differential diagnosis of IBDV, epidemiological investigation and prevention and control of IBD clinically.

Description

Technical Field

[0001] The present invention relates to the field of virus detection, and in particular to a primer combination, a detection method and a kit for detecting virulent strains and variant strains of infectious bursal virus. Background Art

[0002] Infectious bursal disease (IBD) is an acute, highly contagious, immunosuppressive disease of chickens caused by infectious bursal virus (IBDV).

[0003] IBDV is a virus of the genus avian biRNA virus of the family BiRNAviridae. It is mainly divided into two serotypes: serotype I and serotype II. In recent years, strong strains and even mutant strains have gradually appeared, and there are many serotypes of different strains, which increases the difficulty of prevention and control of the disease. According to the virulence of type I virus, the virus is divided into classic virulence strains, vaccine strains, mutant strains and strong virulence strains. Classic virulence strains can damage the bursa of Fabricius of chickens and cause immunodeficiency, but the mortality rate of chicks is not high. Strong strains are highly virulent, and the vaccine has a weak ability to protect chickens affected by strong strains, which in turn causes a large number of deaths in chickens, with a mortality rate of about 80%. There are differences in the antigenicity of mutant strains and classic virulence strains. The attenuated vaccine made with classic strains cannot completely neutralize its antibodies. In more serious cases, it will break through the protection of maternal antibodies, causing serious economic losses to the poultry industry. Currently, the economic losses caused by infection and mutation of IBDV are the most serious. Therefore, the typing and identification of IBDV strains are of great significance for the diagnosis and prevention of the disease. Summary of the invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art and provide a set of primer-probe combinations and a detection method for rapidly identifying a virulent strain and two variant strains of infectious bursal virus of chicken.

[0005] The purpose of the present invention is to provide a primer combination for detecting virulent strains and variant strains of infectious bursal virus.

[0006] Another object of the present invention is to provide a method for detecting virulent strains and variant strains of infectious bursal virus.

[0007] Another object of the present invention is to provide a kit for detecting virulent strains and variants of infectious bursal virus.

[0008] The specific primer-probe combination for rapid identification of virulent strains and variants of infectious bursal virus of chickens according to the present invention comprises the following primer pairs:

[0009] Primer pairs for detecting virulent strains of infectious bursal virus in chickens:

[0010] SEQ ID NO: 1 and SEQ ID NO: 2 and probe SEQ ID NO: 3;

[0011] Primer pairs for detection of infectious bursal virus variant 1:

[0012] SEQ ID NO:4 and SEQ ID NO:5 and probe pair SEQ ID NO:6;

[0013] Primer pair SEQ ID NO:7 and SEQ ID NO:8 and probe pair SEQ ID NO:9 for detecting infectious bursal virus variant 2.

[0014] They are:

[0015] SEQ ID NO:1:5'-CAACCTTATGCCATTCAATA-3'

[0016] SEQ ID NO:2:5'-CTTGGAGGTCACTATCTC-3'

[0017] SEQ ID NO:3:5'-HEX-TGTGATTCCAACCAGCGAGATAAC-BHQ-1-3'

[0018] SEQ ID NO:4:5'-GGGGTAACAATCACACTG-3'

[0019] SEQ ID NO:5:5'-GATGCTGGTTTTGAACAC-3'

[0020] SEQ ID NO:6:5'-ROX-TGCCATCACTAGCCTCAGCG-BHQ-2-3'

[0021] SEQ ID NO:7:5'-GCCACCATCTACCTTATAG-3'

[0022] SEQ ID NO:8:5'-CATGGATTGTCACTGCTA-3'

[0023] SEQ ID NO:9:5'-Cy5-ACTTGCCGACCACGACATCT-BHQ-3-3'.

[0024] The present invention provides an RT-PCR detection method for rapidly identifying virulent strains and variants of infectious bursal disease virus of chickens. The reagents required for the detection method include a primer pair SEQ ID NO:1, SEQ ID NO:2 and a probe SEQ ID NO:3 for detecting virulent strains of infectious bursal disease virus of chickens; a primer pair SEQ ID NO:4 and SEQ ID NO:5 and a probe pair SEQ ID NO:6 for detecting variant 1 of infectious bursal disease virus; and a primer pair SEQ ID NO:7 and SEQ ID NO:8 and a probe pair SEQ ID NO:9 for detecting variant 2 of infectious bursal disease virus. The detection results of the primers and probes of infectious bursal disease virus, combined with the collection results of the probe fluorescence signals, can identify the infection of the virulent strain and two variants.

[0025] Furthermore, the detection method requires the use of RT-PCR reaction reagents and positive controls, including a strong strain positive control plasmid, a variant 1 positive control plasmid, a variant 2 positive control plasmid and a negative control sample, etc.

[0026] Typing primers: the virulent strain primer, variant 1 primer and variant 2 primer, the primer concentration is 10 mM;

[0027] Positive samples: including nucleic acid samples of virulent strains, variant 1 and variant 2, extracted with RNA using a magnetic bead kit;

[0028] The positive controls included the virulent strain positive control plasmid, the variant 1 positive control plasmid, and the variant 1 positive control plasmid, and the concentration of each was 0.01 ng / mL.

[0029] Negative control sample: sterile double distilled water.

[0030] Furthermore, the present invention also provides the operating steps of the detection method, which is characterized by comprising the following steps:

[0031] (1) extracting genomic RNA from the sample to be tested;

[0032] (2) using the extracted RNA as a template, amplifying using the primer combination of the present application and collecting HEX, ROX and Cy5 signals;

[0033] (3) Result determination: The positive control HEX, ROX and Cy5 signals have amplification curves with Ct values ​​less than 36, and the negative control standard has no amplification curve. Otherwise, the test fails and needs to be repeated;

[0034] For the sample to be tested, if the HEX signal has an amplification curve and the Ct value is <36, the sample to be tested is a strong strain of infectious bursal virus;

[0035] For the sample to be tested, if the ROX signal has an amplification curve and the Ct value is <36, the sample to be tested is infectious bursal virus variant 1;

[0036] For the sample to be tested, if the Cy5 signal has an amplification curve and the Ct value is <36, the sample to be tested is infectious bursal virus variant 2;

[0037] For the samples to be tested, there is no amplification curve for HEX, ROX and Cy5 signals, or the Ct value is >36, then the samples to be tested are not virulent strains of infectious bursal virus, infectious bursal virus variant 1, or infectious bursal virus variant 2.

[0038] Preferably, the amplification conditions are: reverse transcription at 50°C for 10 min; pre-denaturation at 95°C for 1 min, denaturation at 95°C for 15 s, annealing and extension at 55°C for 30 s, 45 cycles, and collecting fluorescence signals at the end of each cycle.

[0039] The samples to be tested include, but are not limited to, the environment, serum, tissue, excrement, and aerosol.

[0040] The present invention has the following advantages and beneficial effects:

[0041] The present invention provides a specific primer set for identifying a virulent strain of infectious bursal disease virus, a variant strain 1 of infectious bursal disease virus and a variant strain 2 of infectious bursal disease virus of chickens, and constructs a fluorescent probe detection method in combination with an RT-PCR method, and can judge whether it is a virulent strain of infectious bursal disease virus of chickens, a variant strain 1 of infectious bursal disease virus of chickens and a variant strain 2 of infectious bursal disease virus of chickens through the amplification curve and Ct value of the probe without sequencing. The method can be applied to the identification of infection by virulent strains and variant strains of infectious bursal disease virus of chickens.

[0042] The fluorescent quantitative RT-PCR detection method provided by the present invention has the advantages of strong specificity, high sensitivity, good repeatability, etc., and can accurately identify whether the sample contains a strong strain of infectious bursal disease virus, a variant strain 1 of infectious bursal disease virus, and a variant strain 2 of infectious bursal disease virus, and can effectively solve the problem of difficulty in distinguishing infections by different strains in the prevention and control of infectious bursal disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 The test results are for the strong strains of IBDV;

[0044] Figure 2 This is the test result of IBDV variant 1;

[0045] Figure 3 This is the test result of IBDV variant 2;

[0046] Figure 4To identify the specific detection results of primers and probes of virulent IBDV strains and two variants;

[0047] Figure 5 , Figure 6 and Figure 7 , Figure 8 , Fig. 9 , Fig.10 The results of primer and probe sensitivity tests were used to identify the virulent strains and two variant strains of IBDV. DETAILED DESCRIPTION

[0048] The present invention aims to provide a set of primer-probe combinations and detection methods capable of identifying infection by a virulent strain of infectious bursal virus of chickens and two variant strains, and is used to solve the problem of infection identification by a virulent strain of infectious bursal virus of chickens, variant 1 of infectious bursal virus and variant 2 of infectious bursal virus. The primer-probe combination and detection method can effectively identify the virulent strain of infectious bursal virus of chickens and the two variant strains.

[0049] The present invention adopts the following technical solution:

[0050] The present invention provides a primer-probe combination and a detection method for identifying a virulent strain of infectious bursal virus and two variant strains. The detection reagents required by the detection method are composed of RT-PCR reaction reagents, three pairs of typing primers and probes, and positive control and negative control samples.

[0051] (1) PCR reaction reagents: 5×FastAmpli RT Buffer (DG), 12.5×FastAmpli Part Taq / UNG Mix (with dNTPs) (DG), 50×FastAmpli Part RTase (DG).

[0052] (2) Three pairs of typing primers: the virulent IBDV primer pair of SEQ ID NO:1, SEQ ID NO:2 and probe SEQ ID NO:3, the IBDV variant 1 primer pair of SEQ ID NO:4, SEQ ID NO:5 and probe SEQ ID NO:6, the IBDV variant 2 primer pair of SEQ ID NO:7, SEQ ID NO:8 and probe SEQ ID NO:9, the primer concentrations were all 10 mM, and were respectively:

[0053] SEQ ID NO:1:5'-CAACCTTATGCCATTCAATA-3',

[0054] SEQ ID NO:2:5'-CTTGGAGGTCACTATCTC-3',

[0055] SEQ ID NO:3':5'-HEX-TGTGATTCCAACCAGCGAGATAAC-BHQ-1-3';

[0056] SEQ ID NO:4:5'-GGGGTAACAATCACACTG-3',

[0057] SEQ ID NO:5:5'-GATGCTGGTTTTGAACAC-3',

[0058] SEQ ID NO:6:5'-ROX-TGCCATCACTAGCCTCAGCG-BHQ-2-3';

[0059] SEQ ID NO:7:5'-GCCACCATCTACCTTATAG-3',

[0060] SEQ ID NO:8:5'-CATGGATTGTCACTGCTA-3',

[0061] SEQ ID NO:9:5'-Cy5-ACTTGCCGACCACGACATCT-BHQ-3-3'.

[0062] (3) Positive controls: including a virulent strain positive control plasmid, whose gene sequence is SEQ ID NO: 10, a variant 1 positive control plasmid, whose gene sequence is SEQ ID NO: 11, and a variant 2 positive control plasmid, whose gene sequence is SEQ ID NO: 12.

[0063] SEQ ID NO:10:

[0064] 5'TCTCCAGCCAATATTGATGCCATCACAAGCCTCAGTATCGGGGGGGAACTCGT GTTTCAAACAGAAGTCCAAGACCTTTTACTGGGCGCCACCATCTACCTCATAGGCTTTGATGGGACTGCGGTAATCACCAGAGCTGTGGCTGCAAACACTGGGCTAACGCCCGGCACTGACAACCTTAT GCCATTCAATATTGTGATTCCAACCAGCGAGATAACCCAGCCAATCACATCCATCAAACTGGAGATAGTGACCTCCAAGCGTGGTGGTCAGGCAGGGGATCAGATGGCATGGTCAGCAAGTGGGAG3';

[0065] SEQ ID NO:11:

[0066] 5’CCAGAGTTCTACACCATAACTGCAGCCGACAATTACCAATTCTCATCAC AGTACAAGACAGGTGGGGTAACAATCACACTGTTCTCAGCCAACATTGATGCCATCACTAGCCTCAGCGTTGGGGGGGAGCTTGTGTTCAAAACCAGCATCCAAAACCTTGTACTGGGTGCCACAATCTACCTTATAGGCTTTGATGGGACTGCGGTAATCACCAGAGCTGTAGCTGCAAACAATGGGCTGACGGCCGGCATCGACAACCTTATGCCATTCAACCTAGTGATTCCGACCAGCGAGATAACCCAG3’;

[0067] SEQ ID NO:12:

[0068] 5’AACCTTGTACTGGGCGCCACCATCTACCTTATAGGCTTTGATGGGACTG CGGTAATCACCAGAGCTGTAGCTGCAAACAATGGGCTGACGGCCGGCATCGACAATCTCATGCCATTCAACCTTGTGATCCCGACCAGCGAGATAACCCAGCCAATCACATCCATCAAATTGGAGATAGTGACTTCCAAAAGTGATGGCCAGGCAGGGGAACAGATGTCGTGGTCGGCAAGTGGGAGTCTAGCAGTGACAATCCATGGTGGCAACTACCCAGGGGCTCTCCGTCCTGTCACGCTAGTGGCCT3’。

[0069] (4) The negative control sample includes sterilized double-distilled water.

[0070] The primers SEQ ID NO:1 to SEQ ID NO:3 are amplified as follows (5′-3′):

[0071] SEQ ID NO:13

[0072] CAACCTTATGCCATTCAATATTGTGATTCCAACCAGCGAGATAACCCAGCCAATCACATCCATCAAACTGGAGATAGTGACCTCCAAG;

[0073] Primers SEQ ID NO:4 to SEQ ID NO:6 amplify the following (5′-3′):

[0074] SEQ ID NO:14:

[0075] GGGGTAACAATCACACTGTTCTCAGCCAACATTGATGCCATCACTAGCCTCAGCGTTGGGGGGGAGCTTGTGTTCAAAACCAGCATC;

[0076] Primers SEQ ID NO:7 to SEQ ID NO:9 amplify the following (5′-3′):

[0077] SEQ ID NO:15:

[0078] GCCACCATCTACCTTATAGGCTTTGATGGGACTGCGGTAATCACCAGAG

[0079] CTGTAGCTGCAAACAATGGGCTGACGGCCGGCATCGACAATCTCATGCCAT

[0080] TCAACCTTGTGATCCCGACCAGCGAGATAACCCAGCCAATCACATCCATCA

[0081] AATTGGAGATAGTGACTTCCAAAAGTGATGGCCAGGCAGGGGAACAGATGTCGTGGTCGGCAAGTGGGAGTCTAGCAGTGACAATCCATG.

[0082] In the present invention, the fluorescent groups used to label the probe include HEX, ROX, Cy5, BHQ1, BHQ2, BHQ3 and the like.

[0083] The method for using the above detection reagent comprises the following steps in sequence:

[0084] (1) RNA extraction: RNA of virulent strains and variants of infectious bursal disease virus was extracted using a magnetic bead-based viral nucleic acid extraction kit. The extracted RNA was used as a template, and the template, PCR reaction reagents, and primer pairs were mixed in proportion to amplify and collect HEX, ROX, and Cy5 signals;

[0085] (2) RT-PCR amplification: The PCR amplification system was 25 μL, including 5 μL 5×FastAmpli RT Buffer (DG), 2 μL 12.5×FastAmpli Part Taq / UNG Mix (with dNTPs) (DG), 0.5 μL 50×FastAmpli Part RTase (DG), 5 μL extracted RNA template, 0.5 μL primer pair, 0.25 μL probe, 5 μL ddH 2 O.

[0086] The amplification conditions were as follows: reverse transcription at 50°C for 10 min; pre-denaturation at 95°C for 1 min, denaturation at 95°C for 15 s, annealing and extension at 55°C for 30 s, 45 cycles, and fluorescence signals were collected at the end of each cycle.

[0087] (3) Result judgment: The positive control HEX, ROX and Cy5 signals have amplification curves with Ct values ​​less than 36, and the negative control standard has no amplification curve. Otherwise, the test fails and needs to be repeated;

[0088] For the sample to be tested, if the HEX signal has an amplification curve and the Ct value is <36, the sample to be tested is a strong strain of infectious bursal virus;

[0089] For the sample to be tested, if the ROX signal has an amplification curve and the Ct value is <36, the sample to be tested is infectious bursal virus variant 1;

[0090] For the sample to be tested, if the Cy5 signal has an amplification curve and the Ct value is <36, the sample to be tested is infectious bursal virus variant 2;

[0091] For the samples to be tested, there is no amplification curve for HEX, ROX and Cy5 signals, or the Ct value is >36, then the samples to be tested are not virulent strains of infectious bursal virus, infectious bursal virus variant 1, or infectious bursal virus variant 2.

[0092] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as the conditions recommended by the manufacturer's instructions for the magnetic bead-based viral nucleic acid extraction kit for nucleic acid extraction.

[0093] The test materials used in the following examples are:

[0094] The clinical samples of virulent IBDV strain, IBDV variant 1 and IBDV variant 2 were all provided by Shengnong Food Co., Ltd.

[0095] The following is further described in conjunction with the examples and drawings. It should be understood that these examples are only for illustrative purposes and are not intended to limit the scope of the present invention.

[0096] Example 1 Design and screening of primers and probes

[0097] By comparing the genomic VP2 gene sequences of IBDV virulent strain (GenBank accession number: AF076224.1), IBDV classical strain F52 / 70 (GenBank accession number: HG974565), IBDV variant 1 (GenBank: MW328553.1) and IBDV variant 2 (GenBank accession number: OR960825.1), since the VP2 gene sequences of IBDV virulent strain, IBDV variant 1 and IBDV variant 2 have a high degree of homology and the gene sequences of each strain contain fewer mutation sites, the primers (SEQ ID NO.16-24) (Table 1) provided by the primer design software are difficult to distinguish the specificity of the primers between the strains, which causes great trouble to the experimental research. The inventors compared the genome sequences of IBDV strong strains, IBDV variant 1 and IBDV variant 2 multiple times, and determined the genome sequences with relatively low homology among the strains in multiple pairs of VP2 genes, from which they designed primers and probes corresponding to each strain. Using real strain samples, the inventors repeatedly screened and tested the specificity of primers and probes for IBDV strong strains, IBDV variant 1 and IBDV variant 2, and finally screened out a primer and probe combination that can truly distinguish the three strains.

[0098] The fluorescent quantitative PCR method was used to screen and identify the primer-probe combinations for the virulent IBDV strains, IBDV variant 1, and IBDV variant 2. The specific method of fluorescent quantitative PCR is as follows: Swab sample processing: Use swabs to take the throats of dead chickens, stain them with tracheal secretions, and wipe the surfaces of chicken cages and walls in the farm. All sampling swabs are placed in the same collection tube for mixed testing. The collected samples are used to extract total RNA according to the magnetic bead virus nucleic acid extraction kit, and the nucleic acids are diluted in multiples with TE solution for subsequent PCR testing.

[0099] Result determination: There is no amplification curve for the negative control sample, but there is an amplification curve for the positive sample, so the test is established.

[0100] Results: The feasibility of detecting different types of infectious bursal virus is shown in Figure 1 to Figure 3Since the test samples included clinical samples of IBDV virulent strains, variant 1 and variant 2, and there were amplification curves for SEQ ID NO:1-3 in the HEX channel, SEQ ID NO:4-6 in the ROX channel and SEQ ID NO:7-9 in the Cy5 channel, and the Ct value was less than 36, and there was no amplification curve for the negative quality control standard, indicating that the control of this experiment was established.

[0101] The synthesized primer probes were used to amplify the viral nucleic acid samples of the virulent IBDV strain and the two variants. The amplification statistical results are shown in Tables 2 and Figure 1 to Figure 3 From the results, a group of primer-probe combinations suitable for detecting and identifying the virulent strain and two variant strains of infectious bursal virus of chickens can be screened out, namely, the virulent strain of infectious bursal virus primer pair SEQ ID NO:1, SEQ ID NO:2 and probe SEQ ID NO:3, the variant 1 of infectious bursal virus primer pair SEQ ID NO:4, SEQ ID NO:5 and probe SEQ ID NO:6, the variant 2 of infectious bursal virus primer pair SEQ ID NO:7, SEQ ID NO:8 and probe SEQ ID NO:9.

[0102] Table 1. Information of primers and probes designed for different IBDV strains

[0103]

[0104]

[0105] Table 2. Primer specificity detection results between primer probes for virulent IBDV strains and two variants

[0106] Primer probe IBDV strong strain sample IBDV variant 1 sample IBDV variant 2 sample SEQ ID NO: 1-3 Positive Negative Negative SEQ ID NO:4~6 Negative Positive Negative SEQ ID NO:7~9 Negative Negative Positive SEQ ID NO: 13-15 Positive Positive Negative SEQ ID NO: 16-18 Positive Positive Positive SEQ ID NO: 19-21 Negative Positive Positive .

[0107] The sites of the VP2 gene of IBDV amplified by the better primer-probe combination obtained through screening are shown in the underlined positions of the gene sequence in Table 3.

[0108] Table 3

[0109]

[0110]

[0111] Example 2 Testing the specificity of primer probes for virulent infectious bursal virus strains, variant 1 and variant 2

[0112] The primers and probes for the virulent strain, variant 1 and variant 2 of infectious bursal virus screened were used to detect positive samples of virulent IBDV, variant 1 and variant 2 of IBDV, respectively. At the same time, other positive samples of common chicken infectious diseases were selected, including nucleic acid verification specificity of avian infectious laryngotracheitis virus AILT, avian adenovirus type 4 FAdV-4, infectious bronchitis virus IBV, Newcastle disease virus NDV, reovirus NDRV, Marek's disease virus MDV and avian leukosis virus ALV. The fluorescent quantitative PCR method of Example 1 and the primers and probes (SEQ ID NOs: 1-9) were used. The detection results are as follows: Figure 4 As shown, Figure 4 1,2-IBDV strong strain, 3,4-IBDV variant 1, 5,6-IBDV variant 2, 7,8-avian infectious laryngotracheitis virus AILT, 9,10-avian adenovirus type 4 FAdV-4, 11,12-chicken infectious bronchitis virus IBV, 13,14-Newcastle disease virus NDV, 15,16-reovirus NDRV, 17,18-Marek's disease virus MDV, 19,20-avian leukosis virus ALV.

[0113] Test results such as Figure 4 As shown in Table 4, the results show that the screened IBDV strong strain primer probe only recognizes IBDV strong strain, IBDV variant 1 primer probe only recognizes IBDV variant 1, IBDV variant 2 primer probe only recognizes IBDV variant 2, and there is no amplification curve for other viruses, with good specificity.

[0114] Table 4 Specificity detection results of primers and probes for IBDV virulent strains and two variants

[0115] Nucleic acid samples Exploring the virulent strains of IBDV Exploration of IBDV variant 1 Exploration of IBDV variant 2 IBDV virulent strains Positive Negative Negative IBDV variant 1 Negative Positive Negative IBDV variant 2 Negative Negative Positive AILTV Negative Negative Negative FAdV-4 Negative Negative Negative IBV Negative Negative Negative NDV Negative Negative Negative NDRV Negative Negative Negative MDV Negative Negative Negative ALV Negative Negative Negative .

[0116] Example 3 Testing the sensitivity of primers and probes for virulent strains, variant 1 and variant 2 of infectious bursal virus

[0117] The positive control plasmid of the virulent strain of infectious bursal virus was constructed, and its gene sequence was SEQ ID NO: 10, the positive control plasmid of variant 1 was constructed, and its gene sequence was SEQ ID NO: 11, and the positive control plasmid of variant 2 was constructed, and its gene sequence was SEQ ID NO: 12. 9The positive control plasmid of IBDV strong strain with 10 copies / μL, the positive control plasmid of IBDV variant 1, and the positive control plasmid of IBDV variant 2 were diluted 10 times with the prepared sterile double distilled water as templates, and 5 μL of each dilution was taken as template. The fluorescence quantitative PCR method described in Example 1 was used for detection, and the sensitivity was calculated based on the highest dilution of the template amount used to appear the positive expected curve, and the standard curve was drawn. The sensitivity test results of IBDV strong strains are shown in the figure. Figure 5 and Figure 6 As shown, the sensitive detection results of IBDV variant 1 are as follows Figure 7 and Figure 8 As shown, the sensitivity test results of IBDV variant 2 are as follows Fig. 9 and Fig.10 As shown, the detection results show that the designed and screened primer probe has high sensitivity, a good linear range, and the minimum detection limit can reach 13.4 copies.

[0118] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A primer combination for detecting virulent strains and variants of infectious bursal virus, characterized in that: The primer combination comprises: A primer pair for detecting a virulent strain of infectious bursal virus, the primer pair comprising the following primers: Primer 1: 5'-CAACCTTATGCCATTCAATA-3' Primer 2: 5'-CTTGGAGGTCACTATCTC-3' Primer 3: 5′-TGTGATTCCAACCAGCGAGATAAC-3′; A primer pair for detecting infectious bursal virus variant 1, the primer pair comprising the following primers: Primer 4: 5'-GGGGTAACAATCACACTG-3' Primer 5: 5'-GATGCTGGTTTTGAACAC-3' Primer 6: 5′-TGCCATCACTAGCCTCAGCG-3′; A primer pair for detecting infectious bursal virus variant 2, the primer pair comprising the following primers: Primer 7: 5'-GCCACCATCTACCTTATAG-3' Primer 8: 5'-CATGGATTGTCACTGCTA-3' Primer 9: 5'-ACTTGCCGACCACGACATCT-3', Wherein, the 5' ends of the primers 3, 6 and 9 are connected with fluorescent groups of different colors.

2. A method for detecting virulent strains and variants of infectious bursal virus, characterized in that: The method comprises the following steps: (1) extracting genomic RNA from the sample to be tested; (2) amplifying the extracted genomic RNA of the sample to be tested using the primer combination for detecting a virulent strain of infectious bursal virus according to claim 1 and collecting the fluorescent signals amplified using each primer pair; (3) Result determination: If, for the sample to be tested, there is an amplification curve of the fluorescent group connected to the 5' end of primer 3 and the Ct value is <36, then the sample to be tested contains a virulent strain of infectious bursal virus. If for the sample to be tested, there is an amplification curve of the fluorescent group connected to the 5' end of primer 6 and the Ct value is <36, then the sample to be tested contains a variant strain of infectious bursal virus; If for the sample to be tested, there is an amplification curve of the fluorescent group connected to the 5' end of primer 9 and the Ct value is <36, then the sample to be tested contains a variant strain of infectious bursal virus.

3. The method for detecting virulent strains and variants of infectious bursal virus according to claim 2, characterized in that: The virulent strain of infectious bursal disease virus is a strain with a GenBank accession number of AF076224.1, and the variant strain of infectious bursal disease virus is a strain with a GenBank accession number of MW328553.1 and OR960825.

1.

4. A kit for detecting virulent strains and variants of infectious bursal virus, characterized in that: The kit comprises: the primer combination for detecting a virulent strain of infectious bursal virus according to claim 1.

5. The kit for detecting virulent strains and variants of infectious bursal virus according to claim 4, characterized in that: The kit also includes RT-PCR reaction reagents, positive controls of virulent strains and variants of infectious bursal virus, and negative control samples.

Images