RAA-CRISPR / Cas12a detection system for circle virus avian origin type 1 and application of RAA-CRISPR / Cas12a detection system

Abstract

The invention discloses an RAA-CRISPR / Cas12a detection system of a circle virus avian origin type 1 and application of the RAA-CRISPR / Cas12a detection system, and relates to the technical field of microbiological detection. The detection system comprises an RAA amplification primer pair, crRNA, an FQ-ssDNA probe, an FB-ssDNA probe and an LbCas12a nuclease, and is characterized in that the detection system comprises an RAA amplification primer pair; the RAA amplification primer pair comprises an upstream primer of which the nucleotide sequence is shown as SEQ ID NO.5 and a downstream primer of which the nucleotide sequence is shown as SEQ ID NO.8; the nucleotide sequence of the crRNA is as shown in SEQ ID NO. 11. The RAA-CRISPR / Cas12a detection kit established by adopting the detection system developed by the invention has the advantages of high efficiency, high specificity and high sensitivity, can be used for on-site rapid detection of GyVg1, and provides a powerful diagnostic tool with a cost advantage for a basic-level working environment.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial detection, and in particular to a RAA-CRISPR / Cas12a detection system for avian-origin type 1 circovirus and applications thereof. Background Art

[0002] Gyrovirus galga1 (GyVg1) is a small, non-enveloped, single-stranded circular DNA virus with a genome length of about 2376 bp. It belongs to the genus Gyrovirus of the family Anelloviridae. In 2011, Rijsewijk et al. cloned and sequenced the 2.4-kb phi29 polymerase amplification product of the serum of sick chickens to explore the cause of clinical symptoms in 3-week-old chickens from a poultry breeding base in southern Brazil. They found that the genome structure of the complete nucleotide sequence of one of the amplification products was similar to that of CAV. The strain was named "Ave-3". Based on these limited similarities, the virus was classified as a member of the family Anelloviridae and the genus Gyrovirus, and was initially named Aviangyrovirus 2 (AGV2). In the same year, Sauvage et al. detected the first human gyrovirus related to chicken anemia virus in skin swabs of healthy people and named it Human gyrovirus (HGyV). Later, Chu, Daniel KW and others found that the nucleotide homology of HGyV and AGV2 was >92%, and no phylogenetic differences were found between human (including human skin) and avian viruses, indicating that AGV2 and HGyV are essentially the same virus. As of 2024, 21 species of circular viruses have been identified. Based on the VP1 sequence pairwise identity value, Kraberger et al. defined a 69% VP1 nucleotide sequence pairwise identity threshold, established 9 new species for the division of new circular viruses, and adopted the binomial "genus + free name" species nomenclature proposed by Siddell et al. The past AGV2 was officially renamed Gyrovirus galga1 (GyVg1), which has been adopted by ICTV.

[0003] GyVg1 is the second member of the genus Cyclovirus. GyVg1 infection is mostly found in chickens. Epidemiological survey results show that the total positive rate is between 1.9% and 27.6%, and it often appears in the form of mixed infection (82%). GyVg1 and other non-pathogenic avian virus co-infection can lead to high morbidity and mortality in chickens. Sick chickens show clinical symptoms such as bleeding, edema, glandular stomach erosion, and head swelling, which brings new threats to the development of the poultry industry. At present, there is no effective treatment for GyVg1 infection, and there is no commercial vaccine for GyVg1 infection. Therefore, it is necessary to improve the relevant detection technology research as soon as possible, conduct timely and accurate diagnosis and analysis of clinical samples, monitor GyVg1 infection, and protect the healthy development of the poultry industry.

[0004] The rapid development of nucleic acid amplification technology has expanded its application in pathogen detection and analysis. Traditional PCR detection methods include conventional PCR, real-time fluorescence quantitative PCR (qPCR) and droplet digital PCR (ddPCR). However, these methods require the use of specific thermal cyclers for nucleic acid amplification and are limited to laboratory testing. Recombinase-mediated nucleic acid isothermal amplification (RAA) technology is a new pathogen diagnosis technology that has emerged in recent years. The primer design is simple and easy to operate. It can quickly amplify the target fragment in a short time (20 minutes) under constant temperature (37°C to 42°C) conditions. It does not rely on professional thermal cycle equipment and provides a field-deployable detection tool for infectious disease diagnosis. The GyVg1 real-time fluorescence RAA rapid detection method established in the early stage of the present invention can identify GyVg1 within 20 minutes. However, the binding of primers or probes to the target sequence can still tolerate a certain degree of mismatch, and without thermal cycling to avoid binding between primers, it is difficult to eliminate some nonspecific amplification. The target specificity and nuclease cleavage activity of the clustered regularly interspaced short palindromic repeats (CRISPR) and Cas (CRISPR-associated protein) system make CRISPR / Cas technology have aM-level sensitivity and single nucleotide specificity, and high stability. However, when the sample target concentration is low, the number of activated Cas proteins is limited, and a large number of detectable signals cannot be generated in a short time to meet the requirements of rapid detection. Therefore, the present invention intends to develop a new detection method, by combining the CRISPR / Cas system and RAA technology, to achieve a comprehensive effect of rapid, high sensitivity and high specificity, and apply it to GyVg1 detection, and innovatively construct an efficient detection method that is not limited by the environment and laboratory equipment. Summary of the invention

[0005] The purpose of the present invention is to provide a RAA-CRISPR / Cas12a detection system for avian-origin type 1 of circle virus and its application to solve the problems existing in the above-mentioned prior art. The RAA-CRISPR / Cas12a detection kit established by the RAA-CRISPR / Cas12a detection system developed by the present invention has the advantages of high efficiency, high specificity and high sensitivity, and can be used for rapid on-site detection of GyVg1, providing a powerful diagnostic tool with cost advantages for grassroots working environments.

[0006] The new circular virus GyVg1 infects a wide range of hosts and has been detected in 15 hosts, including different tissues in humans, posing a public health safety hazard. The pathogenicity of this virus alone is not obvious, and it mainly manifests itself in co-infection with other viruses. Just like the synergistic infection of CAV, it can cause non-pathogenic viruses to present a high mortality rate. A study specifically detecting CIAV and GyVg1 in commercial poultry vaccines found that 9 of the 32 live vaccines sampled contained GyVg1, which may be one of the reasons for the widespread spread of GyVg1. At present, GyVg1 is widely present in the world and is prevalent in poultry breeding areas in my country, but no effective drugs and vaccines have been developed to prevent and control it. The threat persists and should be of great concern. Pathogen detection is an indispensable part of prevention and control. Therefore, establishing a method for rapid identification and accurate diagnosis of GyVg1 is of great significance for the prevention of the disease.

[0007] At present, no suitable GyVg1 culture system has been found, the virus cannot be isolated and identified, and no immunological detection method for GyVg1 has been established. Molecular biology methods are still the main detection methods for GyVg1, among which the most widely used is polymerase chain reaction, but PCR technology requires timed temperature operation, long amplification time, and high instrument accuracy requirements, and is mainly used in professional laboratories. The rapid development of constant temperature amplification technology has provided a new solution for nucleic acid detection, which only requires a constant temperature to complete target amplification, and has high amplification efficiency and short reaction time. It can be amplified normally in an ordinary water bath or even a thermos cup. Common constant temperature amplification technologies include loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (also called RPA, RAA, MIRA), rolling circle amplification (RCA) and cross-primer amplification (CPA). Among them, RAA primer design is simple, reaction temperature is mild (37-42°C), and reaction speed is the fastest (within 30min). It is an excellent nucleic acid amplification technology, but it is easy to react spontaneously and there is non-specific amplification. CRISPR / Cas12a (clustered regularly interspaced short palindromic repeats / CRISPR-associated12a) belongs to the second type of effector protein in the CRISPR system. It relies on RNA to guide the activity of endonucleases at the target site, and shows its non-specific enzyme cutting activity. It is used in conjunction with fluorescent probes or special nanoparticles. The color change of the reaction system can be directly observed by the naked eye, so it is applied to pathogen detection. Since the optimum temperature (37-42°C) for Cas12a to play the nuclease function is close to the RAA reaction temperature, the present invention combines the two, that is, RAA is responsible for isothermal amplification of the target sequence to increase the copy number of the target sequence, and Cas12a is responsible for specific identification of the enzyme cutting target sequence and relies on the reporter probe to visualize the test results, and greatly improves the detection sensitivity and specificity.

[0008] The present invention selects a pair of primers with the best amplification efficiency through a series of primers and crRNA screening, F: CAGCTCGCCAGAGATCTACGTCGGCTTC and R: TTACCACATAGGAGCCCGGGTGTGGGTT, and the crRNA with the best cutting efficiency: UAAUUUCUACUAAGUGUAGAUAUCGCCGCGUUAAGAGGAGG for reaction, optimizes the concentration and temperature of the main reaction components, and finally establishes an ideal RAA-CRISPR / Cas12a visualization detection method. When the first step of the experiment is amplified for 30 minutes, the researchers can configure the cutting system at this time, and the cas enzyme and crRNA are fully combined by incubation in the system at room temperature. Once the nucleic acid sequence amplification product is added, the cas enzyme trans-cutting activity can be immediately stimulated, and the connecting arm sequence in the middle of the reporter probe is cut. The cutting is timed for 20 minutes, so that the entire RAA-CRISPR / Cas12a reaction can be completed within 1 hour. Studies have found that RAA has the best amplification efficiency at 37°C, CRISPR / Cas12a has the best cutting efficiency at 40°C, and the reaction is normally carried out in two steps. RAA and CRISPR / Cas12a have similar reaction temperatures. Some studies have been devoted to combining RAA and CRISPR / Cas into a one-tube reaction, with the aim of preventing aerosol overflow when opening the lid for liquid transfer after the first nucleic acid amplification reaction is completed, resulting in false positives for negative samples. However, there is another challenge in the one-tube reaction. When RAA has not amplified enough targets, it will be cut off by CRISPR / Cas, and the detection sensitivity will be greatly reduced, which does not meet the original experimental design purpose of the present invention. Then other studies have been devoted to physically or biologically isolating nucleic acid amplification and CRISPR reaction in one tube, amplifying first and then reverse mixing, which is essentially a two-step reaction, including spatial isolation, using organic phase separation solutions, using suboptimal protospacer adjacent motif sites to weaken CRISPR reactions, or designing silent oligonucleotides connected by photocleavable linkers (PC-links) to hybridize with guide RNAs to block the recognition and cutting functions of the CRISPR system, but these methods are still inconvenient or inhibit the efficiency of CRISPR reactions, so the incompatibility problem has not been well solved. In fact, the RAA-CRISPR developed in the present invention is mainly to meet the requirements of non-central laboratory testing, that is, the grassroots level may be a completely open field environment in the fields. Even if there is aerosol pollution, it can be quickly dissipated. It is the only choice for grassroots on-site instant testing.

[0009] In addition, the present invention has previously developed a real-time fluorescence RAA detection method for GyVg1, designed primers in the 5'-uncoding region (5'-UTR) of GyVg1, and the minimum detection limit of the reaction is 1×10 2The present invention finds a conserved region with a PAM site in the GyVg1 VP2 gene, designs amplification primers and crRNA, and has excellent specificity. The minimum detection limit of fluorescent RAA-CRISPR / Cas12a can reach 5 copies / μL. Even if only ultraviolet light is used for naked eye observation, positive samples with more than 10 copies / μL can be clearly distinguished. The minimum detection limit of RAA-CRISPR / Cas12a on the test strip can reach 5×10 2 The RAA-CRISPR / Cas12a technology is an efficient and affordable tool for GyVg1 diagnosis.

[0010] Based on this, the present invention provides the following solutions:

[0011] The present invention provides a RAA-CRISPR / Cas12a detection system for circovirus avian type 1, comprising a RAA amplification primer pair, crRNA, an FQ-ssDNA probe, an FB-ssDNA probe and an LbCas12a nuclease;

[0012] The RAA amplification primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.8;

[0013] The nucleotide sequence of the crRNA is shown in SEQ ID NO.11;

[0014] The nucleotide sequence of the FQ-ssDNA probe is TTATT;

[0015] The nucleotide sequence of the FB-ssDNA probe is shown in SEQ ID NO.12.

[0016] Furthermore, the 5' end and 3' end of the FQ-ssDNA probe are labeled with different fluorescent genes;

[0017] The 5' end and 3' end of the FB-ssDNA probe are labeled with different fluorescent genes.

[0018] Furthermore, the 5' end of the FQ-ssDNA probe is labeled with a FAM group, and the 3' end is labeled with a BHQ1 gene;

[0019] The 5' end of the FB-ssDNA probe is labeled with a FAM group, and the 3' end is labeled with a Biotin gene.

[0020] The present invention also provides the use of the above-mentioned RAA-CRISPR / Cas12a detection system in the preparation of a kit for detecting avian-origin type 1 of circle virus.

[0021] Furthermore, the kit is a fluorescence detection kit or a lateral flow chromatography kit.

[0022] The present invention also provides a kit for detecting avian-origin type 1 of circle virus, comprising the above-mentioned RAA-CRISPR / Cas12a detection system.

[0023] Furthermore, the kit is a fluorescence detection kit.

[0024] Furthermore, the kit is a lateral flow chromatography kit.

[0025] Furthermore, the detection method of the fluorescence detection kit comprises the following steps:

[0026] Using the genomic DNA of the sample to be tested as a template, performing RAA amplification using the RAA amplification primer pair to obtain a RAA amplification product;

[0027] The RAA amplification product was used to prepare a CRISPR / Cas12a reaction solution, and after the CRISPR / Cas12a reaction, the fluorescence intensity was detected.

[0028] Furthermore, the detection method of the lateral flow chromatography kit comprises the following steps:

[0029] Using the genomic DNA of the sample to be tested as a template, performing RAA amplification using the RAA amplification primer pair to obtain a RAA amplification product;

[0030] The RAA amplification product was used to prepare a CRISPR / Cas12a reaction solution, and after the CRISPR / Cas12a reaction, it was detected using a lateral flow chromatography test strip.

[0031] The present invention discloses the following technical effects:

[0032] The present invention successfully developed a RAA-CRISPR / Cas12a detection platform for GyVg1, and based on this platform, two rapid visual detection methods were established: fluorescent RAA-CRISPR / Cas12a and test strip RAA-CRISPR / Cas12a detection methods. The two detection methods can identify GyVg1 within 1 hour, while other related poultry pathogens show negative reaction results. The detection limit of the fluorescent RAA-CRISPR / Cas12a method is 5 copies / μL, and the naked eye observation under ultraviolet light is 10 copies / μL. The detection limit of the test strip RAA-CRISPR / Cas12a method is 5×10 2Among the 192 clinical sample test results, the positive detection rates of the two RAA-CRISPR / Cas12a methods and the fluorescent quantitative PCR method were both around 10%, and the positive samples detected by the three methods were completely consistent.

[0033] The two RAA-CRISPR / Cas12a visualization detection methods established in the present invention have the advantages of high efficiency, high specificity and high sensitivity, and can be used for rapid on-site detection of GyVg1, providing a powerful diagnostic tool with cost advantages for grassroots working environments. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0035] Figure 1 The results of the RAA-CRISPR / Cas12a primer and crRNA screening experiment are shown in Figure 1. A is the RAA primer combination of crRNA1; B is the RAA primer combination of crRNA2; and C is the RAA primer combination of crRNA3.

[0036] Figure 2 The results of the RAA-CRISPR / Cas12a temperature optimization experiment are shown in Figure 1. A is the RAA temperature optimization result when the CRISPR temperature is 40°C; B is the CRISPR temperature optimization result when the RAA temperature is 40°C.

[0037] Figure 3 The results of the RAA-CRISPR / Cas12a parameter optimization experiment are shown in Figure 1. A shows the results of different RAA primer concentrations; B shows the results of different crRNA concentrations; C shows the results of different FQ-ssDNA concentrations; and D shows the test strip detection diagram of different FB-ssDNA concentrations.

[0038] Figure 4 The results of the fluorescence RAA-CRISPR / Cas12a sensitivity test are shown in Figure 1. A is the result of the QuantStudio5 fluorescence quantitative PCR instrument test; B is the result of naked eye observation under ultraviolet light;

[0039] Figure 5 The results of the fluorescent RAA-CRISPR / Cas12a specificity test are shown in Figure 1. A is the result of the QuantStudio5 fluorescent quantitative PCR instrument test; B is the result of naked eye observation under ultraviolet light;

[0040] Figure 6 This is a test strip test image for the RAA-CRISPR / Cas12a sensitivity test;

[0041] Figure 7 This is a test strip test image for RAA-CRISPR / Cas12a specificity test;

[0042] Figure 8 The following are the test results of GyVg1 clinical positive samples; A is the qPCR test result; B is the fluorescence RAA-CRISPR / Cas12a test result; C is the test strip RAA-CRISPR / Cas12a test result. DETAILED DESCRIPTION

[0043] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0044] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0045] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0046] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0047] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0048] Example 1

[0049] 1. Materials and Methods

[0050] 1.1 Sample

[0051] The four GyVg1-positive samples were from liver tissue of sick chickens with neurological symptoms, bile of healthy asymptomatic chickens, sewage samples from live poultry markets, and visceral tissue homogenates of chickens with tumor symptoms, which had been confirmed by PCR and sequenced; the other 13 non-target reference strains included circovirus human type 1 (GyH1), chicken infectious anemia virus (CIAV), avian adenovirus type 4 (FAdV4), H9 subtype avian influenza virus (H9-AIV), Newcastle disease virus (NDV), avian infectious bronchitis virus (AIV), and avian influenza virus type 2 (AIV). Virus (IBV), infectious bursal virus (IBDV), chicken parvovirus (ChPV), avian leukemia virus (ALV), avian nephritis virus (ANV), chicken astrovirus (CAstV), Mycoplasma gallisepticum (MG), and Mycoplasma synoviae (MS) were provided by the Biological Laboratory of Guangxi Veterinary Research Institute; 192 clinical samples were collected from live poultry markets and small-scale chicken farms in Guangxi, including 120 chicken oroanal swabs and 72 chicken tissue samples, and frozen at -80°C.

[0052] 1.2 Reagents and instruments

[0053] All primers used in the present invention were synthesized by Shanghai Shenggong Biotechnology Co., Ltd.; RAA-basic kit was purchased from Nanning Zhuangbo Biotechnology Co., Ltd.; Lb Cas12a Nuclease and HPLC-purified cr RNA, ssDNA fluorescent reporter probe and ssDNA biotin reporter probe were purchased from Guangzhou Aidi Gene Technology Co., Ltd.; CRISPR single system test strips were purchased from Tolo Biotech. Fluorescence readings were recorded by QuantStudio5 fluorescent quantitative PCR instrument of Thermo Fisher Scientific.

[0054] 1.3 Primer and crRNAs design

[0055] First, three crRNAs were designed to screen out the crRNA with the best activity for the establishment of the CRISPR / Cas12a system. All existing sequences of GyVg1 were obtained from the NCBI database, and multiple sequence alignments were performed using the Bioedit program of DNAStar software to confirm the conservative target sequence, find the target sequence or the target sequence complementary chain adjacent motif (PAM, TTTN, N represents any base in A, T, C, G), and take the 20 bases downstream of the PAM sequence as the crRNA spacer sequence. The first 8 bases of the spacer sequence are the seed region and need to be highly conserved. Previously, Doudna et al. obtained the optimal direct repeat sequence: 5'-UAAUUUCUACUAAGUGUAGAU-3', and the crRNA consisted of two parts, the direct repeat sequence and the spacer sequence, thereby determining the crRNA sequence. Then, three upstream RAA primers and three downstream RAA primers were designed on the periphery of the crRNA, with a primer length of 28-32bp and an amplicon length of about 300bp. The primer sequence avoids pairing with the crRNA sequence. Finally, a pair of primers for preparing plasmid standards were designed around the amplicon. All sequences are shown in Table 1.

[0056] Table 1 Primers, crRNA and ssDNA reporter probe sequences

[0057]

[0058]

[0059] 1.4 Genomic DNA extraction

[0060] The oral and anal cotton swab samples were soaked and squeezed with PBS, and the tissue samples were soaked and ground with PBS, and then frozen and thawed three times at -80°C. The viral DNA was extracted using a pre-packaged viral RNA / DNA extraction kit. 200 μL of viral supernatant was added to the sample well of the 96-well extraction kit, and the kit was placed in a fully automatic nucleic acid extraction and purification instrument for automatic extraction. After 18 minutes, the genomic DNA of the sample was directly aspirated from the nucleic acid well and stored at -20°C for later use.

[0061] Take one of the GyVg1 positive DNA templates, use GyVg1-F and GyVg1-R to amplify and prepare a positive plasmid standard, determine the plasmid concentration with an ultraviolet spectrophotometer, calculate the plasmid copy concentration, and store it at -20°C for future use.

[0062] 1.5 Standard RAA and CRISPR / Cas12a system establishment

[0063] Standard RAA is used for primer pair screening. In a 50μL RAA system, according to the instructions of the RAA basic kit, add 25μL Abuffer, 13.5μL ddH2O, 2μL of upstream primer (10μM) and downstream primer (10μM) to the unit tube freeze-dried powder containing enzymes (recombinase, polymerase, single-stranded binding protein, etc.) to make an amplification premix. Then add 5μL of the DNA sample to be tested to the detection unit tube. Add 2.5μL B Buffer to the cap of the detection unit tube, cover the tube, turn it upside down and shake it gently to mix thoroughly 5 times, and centrifuge it at low speed for 10sec. Finally, place the detection unit tube in a 39℃ constant temperature metal bath and incubate it for 30min.

[0064] The standard CRISPR / Cas12a system was used to screen crRNA. In a 30μL cutting system, according to the LbCas12aNuclease instructions, 3μL 10×CleavageBuffer, 3μL LbCas12aNuclease (1μM), 2μL crRNA (500nM), 6μL FQ-ssDNAReporter (2μM) and 15μL DEPC H2O were added to a clean, enzyme-free 0.2mL PCR unit tube, vortexed and centrifuged thoroughly, and incubated at room temperature for 15min. Finally, 3μL RAA amplification product was added to the unit tube cap, centrifuged instantaneously, mixed, and centrifuged again. The fluorescence signal was detected using QuantStudio5 fluorescence quantitative PCR instrument, reacted at 37°C, and the fluorescence signal was collected every 30sec.

[0065] 1.6 RAA-CRISPR / Cas12a reaction optimization

[0066] Take one of the GyVg1 positive DNA as a template, optimize and adjust the reaction temperature, primer concentration, crRNA concentration, FQ-ssDNA Reporter and FB-ssDNA Reporter based on the standard RAA and standard CRISPR / Cas12a system to make the RAA-CRISPR / Cas12a reaction efficiency ideal. Explore the range of amplification reaction temperature (37℃, 38℃, 39℃, 40℃, 41℃and42℃) and cleavage reaction temperature (37℃, 38℃, 39℃, 40℃, 41℃and42℃) to determine the ideal reaction conditions. Then change the primer concentration (200nM, 300nM, 400nM, 500nM, 600nM), crRNA concentration (8.3nM, 16.7nM, 25nM, 33nM, 41.3nM, 50nM, 58nM) (LbCas12a Nuclease standard system concentration is 33nM), FQ-ssDNAReporter concentration (200nM, 300nM, 400nM, 500nM, 600nM) in turn, and select the ideal working concentration according to the fluorescence intensity. Finally, change the FB-ssDNA Reporter concentration (50nM, 100nM, 200nM, 300nM, 400nM, 500nM), detect with lateral flow chromatography strips, and confirm the ideal working concentration of FB-ssDNA Reporter according to the color development of the quality control line (C line) and the detection line (T line).

[0067] 1.7 Sensitivity and specificity determination

[0068] The sensitivity of the RAA-CRISPR / Cas12a system was evaluated using serially diluted plasmids. 2 copies / μL, 5 copies / μL, 10 copies / μL, 20 copies / μL, 50 copies / μL, 500 copies / μL, and 5000 copies / μL of positive plasmids were selected as templates, and the RAA-CRISPR / Cas12a reaction was performed using the optimized ideal system. The fluorescence signal was collected in real time. After the reaction, the fluorescence of the reaction product was observed under ultraviolet light to determine the minimum detection limit of the fluorescent RAA-CRISPR / Cas12a method for GyVg1. Similarly, 5.0×10 0 ~5.0×10 8 The plasmid with 10 copies / μL was used as a template for RAA-CRISPR / Cas12a reaction. After the reaction, the result was observed with a test strip to determine the minimum detection limit of the test strip RAA-CRISPR / Cas12a method for GyVg1.

[0069] Subsequently, the present invention evaluates the specificity of the reaction by detecting other pathogens with similar symptoms to GyVg1 infection and other common poultry pathogens, including GyH1, CIAV, FAdV4, H9-AIV, NDV, IBV, IBDV, ChPV, ALV, ANV, CAstV, MG, and MS. The results are based on the fluorescence signal collected by the fluorescence quantitative PCR instrument, the fluorescence of the reaction product observed under ultraviolet light, and the color development results of the test strip.

[0070] 1.8 Clinical sample testing

[0071] The fluorescent RAA-CRISPR / Cas12a detection method and the test strip RAA-CRISPR / Cas12a detection method established in the present invention were used to detect 192 clinical samples collected in the laboratory, and the test results were compared with the established qPCR method to evaluate the consistency of the three detection methods.

[0072] 2. Results

[0073] 2.1 Study plan

[0074] In the first step, RAA is amplified at a constant temperature for 30 minutes to obtain sufficient target. In the second step, crRNA and Cas12a form a crRNA / Cas12a complex, which recognizes the PAM site on the double-stranded DNA and specifically binds to the target. Cas12a undergoes conformational changes, resulting in RAA-CRISPR / Cas12a non-specifically cutting ssDNAReporter, thereby completing signal amplification detection. The results can be directly identified by the naked eye under ultraviolet light or combined with a test strip, providing a simple and rapid visual detection method.

[0075] 2.2 RAA primers and crRNA screening

[0076] 3 upstream primers, 3 downstream primers, and 3 crRNAs were arranged and combined, totaling 27 experimental groups, and 27 corresponding negative control groups were set up. The 54 combinations were simultaneously placed in a fluorescent quantitative PCR instrument for detection and 40 cycles were performed. The ideal crRNA and primers were screened based on the collected fluorescent signals. The experimental results are shown in Figure 2. Figure 1 As shown, only some experimental groups produced fluorescent signals using crRNA1 and crRNA2 ( Figure 1 In A and B), all experimental groups using crRNA3 produced fluorescent signals, and the corresponding negative control group did not produce fluorescent signals ( Figure 1 (C) According to the curve appearance time and fluorescence intensity, the ideal primers and crRNA were determined to be GyVg1-F3, GyVg1-R3 and crRNA3, respectively.

[0077] 2.3 Ideal reaction conditions for RAA-CRISPR / Cas12a

[0078] The temperature optimization results are shown in Figure 2 When the amplification temperature is 37°C ( Figure 2 A), cutting temperature is 40℃( Figure 2 When the fluorescence curve appears earliest, the background fluorescence value is the largest, and the reaction efficiency is the highest. The results of reaction component concentration optimization are shown in Figure 3 :When the primer concentration is 500nM( Figure 3 A), crRNA concentration was 25nM ( Figure 3 B), FQ-ssDNAReporter concentration was 500nM ( Figure 3 When the concentration of FB-ssDNAReporter was 60nM ( Figure 3 In D), the reaction efficiency is the highest and the T line of the test strip is the most obvious. The ideal RAA-CRISPR / Cas12a system and reaction conditions are shown in Table 2.

[0079] Table 2 Ideal reaction conditions for RAA-CRISPR / Cas12a

[0080]

[0081] Step 2: CRISPR / Cas12a reaction temperature 40°C

[0082]

[0083] 2.4 Sensitivity and specificity of fluorescent RAA-CRISPR / Cas12a

[0084] The sensitivity of fluorescent RAA-CRISPR / Cas12a was evaluated using different dilutions of plasmid DNA, and the results are shown in Figure 4 When the plasmid DNA concentration was 5 copies / μL, the fluorescence signal could still be detected ( Figure 4 When the plasmid DNA concentration is greater than 10 copies / μL, obvious fluorescence can be observed under ultraviolet light ( Figure 4 (B) This means that the detection limit of this method is 5 copies / μL, and the detection limit for naked eye visualization is 10 copies / μL, which indicates high sensitivity.

[0085] The established fluorescent RAA-CRISPR / Cas12a method was used to detect 17 reference strain nucleic acids. The results are shown in Figure 5 All four GyVg1 nucleic acid samples showed amplification and produced corresponding fluorescence curves, while the other 13 non-target strain nucleic acid samples showed no amplification, just like ddH2O.

[0086] 2.5 Test strip RAA-CRISPR / Cas12a sensitivity and specificity

[0087] Use test strips for 5.0×10 0 ~5.0×10 8 The plasmid RAA-CRISPR / Cas12a reaction product was tested with 100 copies / μL of the sample. The results are shown in Figure 6 The plasmid DNA concentration was 5×10 2 When the number of copies / μL was 0.04, the T line could still be observed, indicating that the detection limit of the test strip RAA-CRISPR / Cas12a was 5×10 2 17 reference strain nucleic acids were tested using test strips. The results are shown in Figure 7 For the 4 reaction products using GyVg1 positive nucleic acid as template, clear detection lines and quality control lines can be observed on the test strips. For other pathogens, like the negative control, only the quality control line can be observed.

[0088] 2.6 Clinical sample testing

[0089] To further evaluate the clinical performance of the RAA-CRISPR / Cas12a detection method, the fluorescent RAA-CRISPR / Cas12a detection method and the test strip RAA-CRISPR / Cas12a detection method were used to detect 192 samples collected in the laboratory. The results were compared with the fluorescent quantitative PCR, and the positive samples detected were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification. The results showed that the fluorescent RAA-CRISPR / Cas12a detection method correctly identified 21 positive samples (10.94%), and the test strip RAA-CRISPR / Cas12a detection method correctly identified 18 positive samples (9.38%). At the same time, qPCR identified 21 positive samples, which were subsequently sequenced and verified. The results showed that the three methods had good consistency, and the positive samples identified were completely consistent ( Figure 8 As shown), it shows that the RAA-CRISPR / Cas12a detection method established by the present invention has high accuracy.

[0090] In summary, the present invention has successfully developed a RAA-CRISPR / Cas12a detection platform for GyVg1, and the two rapid visualization detection methods established based on the platform, namely, fluorescent RAA-CRISPR / Cas12a and test strip RAA-CRISPR / Cas12a detection methods, have high sensitivity and specificity. The detection operation is simple and low-cost, providing a powerful instant detection tool for grassroots working environments, significantly improving the efficiency of GyVg1 diagnosis and detection, and the RAA-CRISPR / Cas12a detection platform has broad application prospects.

[0091] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A RAA-CRISPR / Cas12a detection system for avian-origin type 1 circular virus, characterized in that: Including RAA amplification primer pair, crRNA, FQ-ssDNA probe, FB-ssDNA probe and LbCas12a nuclease; The RAA amplification primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.8; The nucleotide sequence of the crRNA is shown in SEQ ID NO.11; The nucleotide sequence of the FQ-ssDNA probe is TTATT; The nucleotide sequence of the FB-ssDNA probe is shown in SEQ ID NO.

12.

2. The RAA-CRISPR / Cas12a detection system according to claim 1, characterized in that The 5' end and 3' end of the FQ-ssDNA probe are labeled with different fluorescent genes; The 5' end and 3' end of the FB-ssDNA probe are labeled with different fluorescent genes.

3. The RAA-CRISPR / Cas12a detection system according to claim 2, characterized in that The 5' end of the FQ-ssDNA probe is labeled with a FAM group, and the 3' end is labeled with a BHQ1 gene; The 5' end of the FB-ssDNA probe is labeled with a FAM group, and the 3' end is labeled with a Biotin gene.

4. An application of the RAA-CRISPR / Cas12a detection system as described in any one of claims 1 to 3 in the preparation of a kit for detecting avian-origin type 1 of circle virus.

5. The use according to claim 4, characterized in that: The kit is a fluorescence detection kit or a lateral flow chromatography kit.

6. A kit for detecting avian-origin type 1 of circle virus, characterized in that: Comprising the RAA-CRISPR / Cas12a detection system according to any one of claims 1 to 3.

7. The kit according to claim 6, characterized in that The kit is a fluorescence detection kit.

8. The kit according to claim 6, characterized in that The kit is a lateral flow chromatography kit.

9. The kit according to claim 7, characterized in that The detection method of the kit comprises the following steps: Using the genomic DNA of the sample to be tested as a template, performing RAA amplification using the RAA amplification primer pair to obtain a RAA amplification product; The RAA amplification product was used to prepare a CRISPR / Cas12a reaction solution, and after the CRISPR / Cas12a reaction, the fluorescence intensity was detected.

10. The kit according to claim 8, characterized in that The detection method of the kit comprises the following steps: Using the genomic DNA of the sample to be tested as a template, performing RAA amplification using the RAA amplification primer pair to obtain a RAA amplification product; The RAA amplification product was used to prepare a CRISPR / Cas12a reaction solution, and after the CRISPR / Cas12a reaction, it was detected using a lateral flow chromatography test strip.

Images