Intermediate filament protein as a biomarker for predicting stage, prognosis and drug resistance of renal clear cell carcinoma and application thereof
By detecting the expression level of intermediate filament protein IFFO1, IFFO1 antibodies and inhibitors can be provided, solving the problems of staging, prognosis and drug resistance assessment of clear cell renal cell carcinoma, and improving the treatment effect of clear cell renal cell carcinoma.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CHONGQING MEDICAL UNIVERSITY
- Filing Date
- 2024-12-20
- Publication Date
- 2026-06-19
AI Technical Summary
The lack of effective biomarkers in current technologies for predicting the stage, prognosis, and drug resistance of clear cell renal cell carcinoma, especially sensitivity and resistance to the tyrosine kinase inhibitor sunitinib, leads to poor treatment outcomes.
By detecting the expression level of intermediate filament protein IFFO1, the staging and prognosis of clear cell renal cell carcinoma can be assessed using IFFO1 antibody detection products. Furthermore, resistance to sunitinib can be improved by using IFFO1 inhibitors, and therapeutic drugs can be prepared by combining them with DNA damage inducers such as cisplatin.
IFFO1, as a biomarker, can accurately assess the stage and prognosis of clear cell renal cell carcinoma, enhance tolerance to sunitinib, improve treatment efficacy, and reduce drug resistance.
Smart Images

Figure CN119846209B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the technical field of biomedical detection, specifically an intermediate filament protein as a biomarker for predicting the stage, prognosis, and drug resistance of clear cell renal cell carcinoma and its application. Background Technology
[0002] Renal cell carcinoma (RCC) is a heterogeneous tumor originating from the renal tubular epithelium and is one of the ten most common cancers worldwide. In 2020, over 400,000 new cases of RCC were reported globally, with approximately 75% being clear cell renal cell carcinoma (ccRCC). Partial or radical nephrectomy, ablation, and radiographic monitoring are the main treatments for ccRCC, but the 5-year recurrence rate is close to 60%, and 30% of ccRCC patients eventually develop metastases. Previous studies have shown that ccRCC is inherently resistant to conventional chemotherapy and molecularly targeted therapies, and mutations in the Von Hippel-Lindau (VHL) gene are detected in over 50% of patients diagnosed with ccRCC. This leads to the accumulation of hypoxia-inducible factor (HIF) in cells, promoting tumor drug resistance by facilitating the formation of platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), and multidrug resistance pumps. Therefore, identifying biomarkers associated with drug resistance in ccRCC is crucial for the application of therapeutic drugs for ccRCC.
[0003] Protein tyrosine kinases participate in multiple signaling pathways related to cell growth, differentiation, and metabolism. Growth factors VEGF and PDGF in the blood bind to receptor tyrosine kinases on ccRCC cells, thereby transmitting signals for proliferation and survival to tumor cells. In 2006, Europe approved the tyrosine kinase inhibitor (TKI) sunitinib as a treatment for advanced RCC, and it was one of the first TKIs approved for the treatment of metastatic RCC. In clinical application, patients with advanced or metastatic ccRCC show significant improvement in prognosis after sunitinib treatment; however, approximately 20% of patients develop innate resistance upon initial sunitinib treatment, and most develop secondary resistance after 6-11 months of treatment. Some studies have revealed factors associated with sunitinib resistance in ccRCC, including (1) activated HIF in ccRCC helps cells adapt to the hypoxic tumor microenvironment, inducing cell quiescence and increasing treatment tolerance; (2) anti-angiogenic therapy used in ccRCC treatment causes secondary hypoxia and bypass activation, leading to the production and acquisition of resistance to several VEGF and PDGF-independent pro-angiogenic factors; and (3) high immune infiltration is associated with poor response to sunitinib. However, these predictive factors are insufficient to accurately differentiate patients' sensitivity, and the exact molecular mechanism of sunitinib resistance in ccRCC has not been elucidated. Therefore, it is necessary to find more reliable biomarkers to predict sunitinib sensitivity and patient prognosis.
[0004] Intermediate filaments are components of the cytoskeleton and are crucial for maintaining cell structure and morphology, as well as for functional maintenance. Intermediate filaments are polymers encoded by more than 70 different genes, exhibiting significant multifunctionality and cell type specificity. The deletion or mutation of different intermediate filament proteins is closely related to various human diseases. The IFFO family of intermediate filament proteins consists of two proteins, IFFO1 and IFFO2, whose expression levels and functions in ccRCC have not yet been investigated. Summary of the Invention
[0005] Based on existing research, the inventors, through long-term technical exploration and experimental verification, have developed an invention that utilizes IFFO1 to maintain genomic stability in ccRCC and promote sunitinib sensitivity in ccRCC cells. Specifically, this invention provides new insights into IFFO1 expression as a biomarker for ccRCC by detecting IFFO1 expression levels in ccRCC patient tissue samples and analyzing databases. By altering IFFO1 expression levels in cells, increased proliferation, metastasis, and clone generation of ccRCC cells, as well as improved genomic stability, were detected. Furthermore, expression of IFFO1 in ccRCC cells increased tolerance to sunitinib, and the expression levels of the IFFO protein family were elevated in constructed drug-resistant ccRCC cells. This invention is based on the above research findings.
[0006] Therefore, the technical solution adopted by the present invention includes:
[0007] In a first aspect, the present invention provides the application of intermediate filament protein as a biomarker for predicting the stage and prognosis of clear cell renal cell carcinoma.
[0008] Furthermore, the intermediate filament protein is IFFO1.
[0009] More specifically, this also includes products that detect IFFO1 expression levels. These products include IFFO1 antibodies.
[0010] Specifically, this invention found that the expression level of IFFO1 in tumor tissue was significantly increased compared to adjacent normal tissue, and patients with ccRCC exhibiting high IFFO1 expression had shorter overall survival (OS), disease-specific survival (DSS), and disease-free interval (PFI). Therefore, the product (test kit or device) for detecting IFFO1 expression levels can be used to assess the staging and prognosis of ccRCC patients.
[0011] Secondly, this invention provides the application of IFFO1 as a biomarker in the preparation of products for predicting the stage and prognosis of clear cell renal cell carcinoma.
[0012] Thirdly, this invention provides the application of IFFO1 in the preparation of products for predicting drug resistance in clear cell renal cell carcinoma.
[0013] Specifically, the drug used to treat clear cell renal cell carcinoma is sunitinib.
[0014] Thirdly, this invention provides the use of IFFO1 in the preparation or screening of therapeutic agents for clear cell renal cell carcinoma, wherein the therapeutic agents include interventional antibodies or protein inhibitors targeting IFFO1. IFFO1 inhibitors can improve sunitinib resistance in ccRCC.
[0015] Furthermore, the IFFO1 inhibitor described in this invention can also be used in combination with DNA damage inducers such as cisplatin to prepare ccRCC drugs.
[0016] Compared with existing technical solutions, the technical solution of the present invention can bring the following beneficial effects:
[0017] The above-described technical solution is the first study to demonstrate that the intermediate filament protein IFFO1 is overexpressed in ccRCC tumor tissue and acts as a key molecule for stabilizing the genome. Overexpression of IFFO1 in cells promotes the malignant progression of ccRCC and enhances its tolerance to sunitinib. Therefore, IFFO1 can serve as a potential intervention target for ccRCC treatment. This invention demonstrates that IFFO1 promotes cellular tolerance to DNA damage inducers and the tyrosine kinase inhibitor sunitinib in ccRCC by stabilizing the genome. Research on the molecular mechanisms targeting IFFO1 and drug development can contribute to improving therapeutic efficacy and has clear and beneficial practical application value. Attached Figure Description
[0018] Figure 1 The high expression of IFFO1 in ccRCC tumor tissue;
[0019] Figure 2 The relationship between IFFO1 expression level and different tumor stages;
[0020] Figure 3 To detect the proliferation and migration of IFFO1 knockdown and overexpression cells, shCon in the figure represents the control lentivirus group, and shRNA-1 and shRNA-2 represent the two lentivirus groups with IFFO1 knockdown.
[0021] Figure 4 The impact of IFFO1 on genome stability;
[0022] Figure 5 The effect of IFFO1 on the response to sunitinib;
[0023] Figure 6 This represents the network of interacting proteins with IFFO1 in ccRCC cells.
[0024] Figure 7 This diagram illustrates the changes in signaling pathways in sunitinib-resistant cells treated with ccRCC. Detailed Implementation
[0025] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0026] Example 1: Materials and Methods of the Invention
[0027] 1.1 Tissue Microarray
[0028] This invention has been approved by the Ethics Committee of Chongqing Medical University (Approval No. 2024036). Tissue microarrays containing cancer and adjacent tissue samples were obtained from Shanghai Autobio Biotechnology Co., Ltd. (Catalog No. HKidE180Su02). IFFO1 expression was determined by immunohistochemical staining (antibody from Proteintech).
[0029] 1.2 Data Sources
[0030] RNA-seq data were obtained from the TCGA (https: / / portal.gdc.cancer.gov / ) and GEO (https: / / www.ncbi.nlm.nih.gov / geo / ) databases. The obtained data were standardized and transformed using log2. The affy package in R was used for dataset normalization and background noise removal. Functional enrichment analysis of central genes was performed using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG).
[0031] 1.3 Cell lines and plasmid transfection
[0032] 786-O and ACHN cell lines were purchased from Pricela Biotechnology. 786-O cells were cultured in RPMI-1640 medium (Pricela, catalog number PM150110). HEK-293 and ACHN cells were cultured in high-glucose DMEM medium (Pricela, catalog number PM150210). All cell cultures were supplemented with 10% fetal bovine serum (FBS) (Excell, catalog number FSP500) and 1% penicillin / streptomycin (10000 μg / mL, Gibco, catalog number 15140-122) and cultured at 37°C and 5% CO2. HEK-293 cells were transfected with polyethyleneimine (PEI, Yeasen Biotechnology). Transfection reagent (Polyplus, catalog number 101000015) was used to transfect 786-O and ACHN cells.
[0033] 1.4 Protein Immunoblotting
[0034] Cells were digested with trypsin (Gibco, catalog number 25200-072), and collected with culture medium. The cells were centrifuged at 3000 rpm for 5 minutes, and the pellet was retained. The cell pellet was washed with pre-chilled PBS, and the mixture was centrifuged at 3000 rpm for 5 minutes, and the pellet was retained. Total protein was extracted from the washed cell pellet using RIPA lysis buffer (1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS). The lysis buffer was thoroughly mixed with the cell pellet, and lysis was performed on ice for 15 minutes. The lysed mixture was centrifuged at 12000 rpm for 5 minutes, the supernatant was collected, and a quarter volume of 5X loading buffer (Yeasen, catalog number 20315ES05) was added. After mixing, the mixture was boiled at 95°C for 10 minutes. Extracted proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (Yazyme, catalog numbers PG111 and PG112) and then transferred to polyvinylidene fluoride membranes (Millipore, catalog number IPVH00010). After transfer, appropriate bands were selected based on protein size, and the membranes were blocked for 1 hour in PBST (PBS containing 0.1% Tween-20) solution containing 5% skim milk powder. The membranes were then incubated overnight at 4°C with primary antibody and washed three times with PBST, each time with a 5-minute shake on a horizontal shaker. Afterward, the membranes were incubated for 2 hours at room temperature with HRP-labeled secondary antibody and washed three times with PBST, each time with a 5-minute shake on a horizontal shaker. Chemiluminescent ECL working solution was placed on the membranes, and the acquired signals were quantified using a fully automated chemiluminescent gel imaging system (BIO-RAD, CANICES-3(A) / NMB-3(A)).
[0035] 1.5 Cell proliferation detection
[0036] Cultured 786-O and ACHN cells were trypsinized, centrifuged, and counted. Cells were seeded at a density of 2000 cells / well in 96-well plates and cultured at 37°C with 5% CO2 for 5 days. Metabolic activity was measured daily using CCK-8 (MedChemExpress). A 10% concentration of CCK-8 reagent was added to each well, and the cells were incubated for 3 hours. Absorbance was measured at 450 nm using a microplate reader, and the results were analyzed using Graphpad Prism.
[0037] 1.6 Cell migration detection
[0038] Cell migration was detected using scratch assays and Transwell assays. In the scratch assay, treated cells were evenly seeded in 12-well plates at a density of 40%. When the cells reached 90%-100% confluence, a blank area was drawn in each well using a pipette tip. The cells were then washed three times with PBS, and any detached cells were removed. Serum-free medium was added for further culture. Images were taken at different time points, and the area of the scratch was calculated. In the Transwell assay, trypsin-digested cells were centrifuged and counted. 20,000 cells were resuspended in serum-free medium. Transwell chambers were placed in a culture plate, with medium added to the lower chamber and the resuspended cells added to the upper chamber. Cells were then cultured at 37°C and 5% CO2 for 24 hours. The chambers were carefully removed with forceps, and all medium from both chambers was removed. Cells were washed with PBS and fixed with 4% paraformaldehyde for 15 minutes. After removing the paraformaldehyde, the cells were stained with 0.1% crystal violet for 15 minutes. The upper and lower chambers were then washed three times with PBS, and all cells in the upper chamber were gently wiped away with a cotton swab. The remaining cells adhering to the lower layer of the Transwell chamber were photographed and counted.
[0039] 1.7 Cell Clonal Formation Detection
[0040] The processed cells were trypsinized, centrifuged, and counted. Cells were then placed in 6-well plates at a density of 200 cells / well. The plates were then incubated at 37°C and 5% CO2 for 7–10 days until visible cell clones were formed. After removing the culture medium, the cells were washed once with PBS, fixed with 4% paraformaldehyde for 15 minutes, and stained with 0.1% crystal violet for 15 minutes. After the liquid in the 6-well plates dried, photographs and cell counts were performed.
[0041] 1.8 Immunofluorescence detection
[0042] Transfected cells were seeded onto sterile glass slides (Servicebio, catalog number WG655) and cultured at 37°C and 5% CO2 for 24 hours. After washing the cell slides three times with PBS, they were fixed with 4% paraformaldehyde for 15 minutes at room temperature. The cells were then incubated with PBS containing 0.5% Triton X-100 for 15 minutes, followed by three washes with PBS. Cells were then blocked in PBS containing 5% bovine serum albumin (BSA) for 1 hour at room temperature, followed by overnight incubation with primary antibody at 4°C. After washing the cells three times with PBST, they were incubated with fluorescent secondary antibody at room temperature in the dark for 1 hour, followed by three washes with PBST. Finally, the slides were mounted on glass slides using mounting medium (Beyotime, catalog number P0131) for microscopic imaging.
[0043] 1.9 Drug susceptibility testing
[0044] Transfected cells were trypsinized, centrifuged, and counted. Cells were seeded at a density of 4000 cells / well in 96-well plates, and sunitinib was added at concentrations of 0 μM, 0.25 μM, 0.5 μM, 1 μM, 2.5 μM, 5 μM, 10 μM, 25 μM, 50 μM, and 100 μM. Cell viability was assessed using CCK-8 assays after 48 hours of drug treatment.
[0045] 1.10 Immunoprecipitation and Mass Spectrometry Identification
[0046] IFFO1 protein tagged with Flag was expressed in HEK-293 cells. After cell collection, cells were washed twice with pre-chilled PBS. Cells were then lysed with NTEN buffer (20 mM Tris-HCl (pH 7.5), 10% glycerol, 150 mM NaCl, 0.5% NP40, and 1 mM PMSF). The cells were centrifuged at 14,000 rpm for 30 minutes at 4°C, and 50 μL of supernatant was collected to prepare the input sample. The remaining supernatant was incubated overnight with 30 μL of anti-DYKDDDDK (Flag) affinity gel (Yeasen Biotechnology, catalog number 20584). Cells were washed four times with washing buffer (20 mM Tis-HCl, pH 7.5, 150 mM NaCl, 10% glycerol, 1% Nonidet P40, and 2 mM EDTA, pH 8.0). 1X loading buffer was added, mixed, and then heated to 95°C for 10 minutes.
[0047] 1.11 Lentiviral transfection and knockdown cell construction
[0048] HEK-392 cells were transfected with a lentiviral packaging vector and short hairpin RNA (shRNA) targeting IFFO1 mRNA using PEI. The sequences of the two shRNAs were CGAGTACAAGCGGAGATGCTT and GCCTGGCTTGTCGTGGGTGCA, respectively. 72 hours after transfection, lentiviral particles were collected from the cell culture supernatant and used to infect ccRCC cells. Cells were selected using puromycin to obtain a cell line with stable IFFO1 knockdown, and protein expression was verified by Western blotting.
[0049] 1.12 Statistical Analysis
[0050] Data from this invention were analyzed using GraphPad Prism 9 software. Experiments were independently repeated at least three times under identical conditions. All immunoblots were performed at least three times. Data were analyzed using the Student's t-test and are expressed as mean ± standard deviation. Statistical significance was determined as follows: ***p<0.001, **p<0.01, *p<0.05; not significant (ns), p>0.05.
[0051] The following examples illustrate the verification results of the present invention.
[0052] Example 2: IFFO1 is highly expressed in ccRCC tumor tissue.
[0053] Using the TCGA database, the inventors analyzed the expression level of IFFO1 in ccRCC tumor tissues. RNA sequencing (RNA-seq) data from 613 tumor tissues and 72 adjacent normal tissues showed that the expression level of IFFO1 in ccRCC tumors was higher than that in normal tissues. Figure 1 A). Kaplan-Meier survival curves were used to assess the potential impact of IFFO1 expression on the prognosis of cancer patients. In all ccRCC patients, IFFO1 expression was observed to be negatively correlated with overall survival (OS), disease-specific survival (DSS), and disease-free interval (PFI). Figure 1 B). To verify the expression of IFFO1 in ccRCC, the inventors obtained a tissue microarray containing cancer and adjacent tissue samples from Shanghai Aotu Biotechnology Co., Ltd. Immunohistochemical staining of the ccRCC tissue microarray with IFFO1 was performed. After evaluation by a pathologist, the results showed that the expression level of IFFO1 in the nuclei of tumor tissue in ccRCC was higher than that in adjacent normal tissue. Figure 1 C).
[0054] Example 3: High expression of IFFO1 is associated with poor prognosis in ccRCC.
[0055] Patients with ccRCC were grouped according to different stages, and the expression levels of IFFO1 in different groups were compared. This study shows that IFFO1 expression increases with increasing primary tumor involvement (T stage), distant metastasis (M stage), and pathologic stage. Figure 2 ).
[0056] Example 4: IFFO1 can promote cell proliferation and migration.
[0057] Adenovirus carrying IFFO1 interfering RNA was transfected into ccRCC cells using a lentiviral packaging system, and the knockdown effect of IFFO1 was confirmed by testing. Figure 3A). Transfection of the IFFO1 plasmid into cells showed strong expression levels in different ccRCC cells, as detected by Western blotting. Figure 3 B). The proliferation capacity of the two IFFO1 knockdown cell lines was significantly lower than that of the non-knockdown group. Figure 3 C), and the healing ability of knocked-down cells after scratch testing was significantly lower than that of the non-knocked-down group. Figure 3 D). Furthermore, Transwell assays confirmed that IFFO1 knockdown reduced cell migration, while IFFO1 overexpression increased cell migration. Figure 3 E). This suggests that IFFO1 can promote the proliferation and migration of ccRCC cells.
[0058] Example 5: IFFO1 can improve genome stability
[0059] Genomic instability is a prominent feature of tumors and is considered a driving factor in tumorigenesis, closely related to malignant progression and prognosis. The inventors assessed the ability of IFFO1 as a biomarker for ccRCC by detecting genomic instability. Chromosomal breakage or mitotic errors due to genomic instability result in the formation of micronuclei in the cytoplasm, which are markers of chromosomal instability in tumors. Through immunofluorescence staining and counting of micronuclei, the inventors demonstrated that IFFO1 knockdown increased the number of intracellular micronuclei, while overexpression of IFFO1 decreased the number of micronuclei. Figure 4 A). Following DNA double-strand breaks, histone H2AX is rapidly phosphorylated at the Ser139 site (γ-H2AX), which is an indicator of the degree of DNA damage. Through immunofluorescence experiments and data analysis, the inventors confirmed that, under untreated conditions, IFFO1 knockdown increased the number of intracellular γ-H2AX aggregation sites. Figure 4 B). After irradiating cells with 4 Gy of X-rays and recovering for 2 hours, the damage intensity was recalculated. Following IFFO1 knockdown, the number of γ-H2AX aggregation sites in the cells was significantly higher than in the control group. Figure 4 C).
[0060] Example 6: IFFO1 promotes increased sunitinib tolerance in ccRCC cells
[0061] Sunitinib, a classic first-line drug for treating recurrent cancer (RCC), is a receptor tyrosine kinase inhibitor that also inhibits the VEGF signaling pathway in angiogenesis. However, approximately 20% of advanced-stage patients do not respond to sunitinib, and most develop tolerance. To expand the application of IFFO1 as a biomarker and therapeutic target for ccRCC, the inventors evaluated the sensitivity of cells overexpressing IFFO1 to sunitinib. The results showed that cells were more tolerant to sunitinib after IFFO1 expression was increased. Figure 5A) The half-maximal effector concentration (EC50) of cells increased from 9.86 μM to 13.52 μM. However, IFFO1 expression had no effect on the sensitivity to conventional chemotherapy drugs cisplatin and camptothecin. Figure 5 BC). Under the same treatment conditions, IFFO1 did not affect the sensitivity of NCI-H1299 lung cancer cells to sunitinib. Figure 5 D). Therefore, IFFO1 specifically promotes tolerance of ccRCC cells to sunitinib treatment, which also suggests the application of IFFO inhibitors in improving sunitinib resistance in ccRCC cells.
[0062] Example 7: Establishment of the IFFO1 interacting protein network in ccRCC cells
[0063] By expressing a flag-tagged empty vector plasmid and a flag-tagged IFFO1 protein in the ccRCC cell line, and through immunoprecipitation and Orbitrap FUSION LUMOS mass spectrometry, the inventors constructed an interaction protein map of IFFO1. 45,582 spectra were obtained from the control group, and after matching, 257 proteins and 1,156 peptides were identified. Figure 6 A). 43,162 spectra were obtained from the IFFO1 immunoprecipitation group, and 512 proteins and 2,807 peptides were identified after search and matching. Figure 6 B). A total of 227 proteins were found in both groups, with 30 proteins specific to the blank control group and 285 proteins specific to the IFFO1 immunoprecipitation group. Figure 6 C) This demonstrates effective immunoprecipitation. Proteins enriched with 3 or more specific peptides from the immunoprecipitation group were subjected to GO (Gene Ontology) and KEGG (Kyoto Encclopedia of Genes and Genomes) enrichment analyses. The results showed that in KEGG analysis, interacting proteins were concentrated in the pathways of platelet activation and complement and coagulation cascades. In biological process analysis, interacting proteins were concentrated in the regulatory pathways of actin filament organization and cell morphogenesis during differentiation. In cellular component analysis, interacting proteins were concentrated in the pathways of cytoplasmic vesicle lumen and secretory granule lumen. In molecular function analysis, interacting proteins were concentrated in the pathways of actin binding and cadherin binding.
[0064] Example 8: The expression level of the IFFO protein family was significantly increased in sunitinib-resistant cells.
[0065] To further confirm the potential of IFFO1 as a biomarker for ccRCC tolerance, the inventors performed whole transcriptome analysis on sunitinib-resistant cells using constructed ccRCCs. Tolerant cells were established through gradient drug stimulation, and the EC50 of the cells increased from 8.9 μM to 20.3 μM. Figure 7 A). By comparing sunitinib-resistant cells with wild-type cells, the inventors identified 3095 specific proteins in the resistant cells ( Figure 7 B). Pathways associated with sunitinib resistance primarily involve PI3K-Akt signaling, MAPK signaling, cytokine and cytokine receptor interactions, and cell adhesion molecule signaling. Figure 7 C). In drug-resistant cells, the IFFO family protein IFFO2 showed significant upregulation. Figure 7 D).
[0066] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. It should be pointed out that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. Use of IFF01 as a biomarker in the manufacture of a product for predicting drug resistance in renal clear cell carcinoma, characterized in that: The drug for treating renal clear cell carcinoma is sunitinib.
2. Use according to claim 1, characterized in that: The products include products for detecting IFFO1 expression levels.
3. Use according to claim 2, characterized in that: The products for detecting IFFO1 expression levels include IFFO1 antibodies.