Nucleic acid medicine for treating hepatocellular carcinoma as well as preparation method and application of nucleic acid medicine

Abstract

The invention provides a nucleic acid medicinal preparation for treating hepatocellular carcinoma as well as a preparation method and application thereof, and belongs to the technical field of nucleic acid medicines. The invention provides a nucleic acid delivery carrier, which is prepared by compounding a neutral cytidine lipid material DNCA, a cystine skeleton cationic lipid material CLD and an auxiliary lipid material 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine-polyethylene glycol DSPE-PEG according to a specific proportion. The invention also provides a nucleic acid medicine for treating hepatocellular carcinoma. The nucleic acid medicine comprises a nucleic acid delivery carrier, siRNA which is wrapped in the nucleic acid delivery carrier and is targeted to IGF1RmRNA, and a cell transfection solution. The nucleic acid medicine can efficiently target subcutaneous tumor parts of mouse hepatocytes, remarkably inhibits tumor growth and is free of liver and kidney toxicity. According to the technical scheme, a foundation is laid for wide clinical application of siRNA drugs for resisting hepatocellular carcinoma.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid drugs, and in particular relates to a nucleic acid drug preparation for treating hepatocellular carcinoma, and a preparation method and application thereof. Background Art

[0002] Hepatocellular carcinoma is one of the most common cancers in the world, with a low survival rate. Conventional treatment strategies for hepatocellular carcinoma include resection, liver transplantation, chemotherapy and molecular targeted therapy. Currently, first-line treatment drugs such as sorafenib and lenvatinib have the problem of short treatment survival. Nucleic acid drugs can achieve specific regulation of certain physiological or pathological processes by targeting specific functional proteins or their encoding genes, thereby achieving the prevention and treatment of hepatocellular carcinoma.

[0003] The targets of nucleic acid drugs are mostly located in cells. It is an obstacle that needs to be solved urgently to safely and efficiently deliver them to target tissues, achieve transfection into cells and successfully bind to targets. As one of the representative nucleic acid drugs, siRNA binds to mRNA and activates RISC to cut mRNA, thereby preventing protein expression to achieve the purpose of treating diseases. In recent years, the US Food and Drug Administration and the European Medicines Agency have approved a total of 6 siRNA drugs. Among them, the first siRNA drug Onpattro uses the LNP delivery strategy, which uses ionizable cationic lipid DLin-MC3-DMA to bind siRNA through electrical action. The preparation can reach the liver after intravenous injection and be taken up by hepatocytes. However, the surface of the lipid nanoparticles formed is too positively charged, which is easy to bind to a variety of serum proteins, reducing the delivery efficiency and causing immunogenic reactions; the remaining 5 drugs are delivered by GalNAc conjugation at the 3' end of the positive chain, but this delivery strategy is only suitable for liver targeting and has great application limitations. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a nucleic acid delivery vector, which not only improves the delivery efficiency of nucleic acid molecules to target cells and improves the anti-cancer activity, but also has good safety by compounding the neutral cytidine lipid material DNCA and the cysteine ​​backbone cationic lipid material CLD with DSPE-PEG.

[0005] The present invention provides a nucleic acid delivery vector, comprising a neutral cytidine lipid material DNCA of a structural formula such as formula I, a cystine backbone cationic lipid material CLD of a structural formula such as formula II, and an auxiliary lipid material 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol DSPE-PEG of a structural formula such as formula III;

[0006]

[0007] In Formula I and Formula II, R1 is In formula III, R2 is C16 H 33 .

[0008] Preferably, the molar ratio of DNCA to CLD is 21:31.5.

[0009] Preferably, the molar amount of the DSPE-PEG accounts for 0.25% to 0.75% of the total molar mass of the DNCA and CLD.

[0010] The present invention provides a siRNA drug delivery system for treating hepatocellular carcinoma, comprising the nucleic acid delivery vector and the siRNA targeting IGF1R mRNA encapsulated in the nucleic acid delivery vector;

[0011] The molar ratio of DNCA to siRNA is 21:1.

[0012] Preferably, the siRNA targeting IGF1R mRNA comprises at least one of the following siRNAs: siIGF1R-a, siIGF1R-b, siIGF1R-c, siIGF1R-d and siIGF1R-e;

[0013] The siIGF1R-a comprises a sense strand as shown in SEQ ID NO: 1 and an antisense strand as shown in SEQ ID NO: 2;

[0014] The siIGF1R-b comprises a sense strand as shown in SEQ ID NO: 3 and an antisense strand as shown in SEQ ID NO: 4;

[0015] The siIGF1R-c comprises a sense strand as shown in SEQ ID NO: 5 and an antisense strand as shown in SEQ ID NO: 6;

[0016] The siIGF1R-d comprises a sense strand as shown in SEQ ID NO: 7 and an antisense strand as shown in SEQ ID NO: 8;

[0017] The siIGF1R-e comprises a sense strand as shown in SEQ ID NO:9 and an antisense strand as shown in SEQ ID NO:10.

[0018] Preferably, the siRNA targeting IGF1R mRNA comprises chemically modified nucleotides and / or a phosphorothioate group connected between two adjacent nucleotides.

[0019] Preferably, the chemical modifications in the chemically modified nucleotides include F modification, 2′-deoxyribose modification and 2′-methoxy modification.

[0020] The invention provides a nucleic acid drug for treating hepatocellular carcinoma, comprising the siRNA drug delivery system and a cell transfection solution.

[0021] The present invention provides a method for preparing the nucleic acid drug for treating hepatocellular carcinoma, comprising the following steps:

[0022] Mixing a mother solution of siRNA targeting IGF1R mRNA and a cell transfection solution to obtain a first material;

[0023] Sequentially adding a neutral cytidine lipid material DNCA, a cystine backbone cationic lipid material CLD, and an auxiliary lipid material 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol DSPE-PEG to the first material, and mixing the obtained second material with the remaining cell transfection solution to obtain a third material;

[0024] The third material is subjected to ultrasonic treatment to obtain a nucleic acid drug.

[0025] The present invention provides the use of the nucleic acid delivery vector and the siRNA drug delivery system in preparing drugs for preventing and / or treating hepatocellular carcinoma.

[0026] The present invention provides a nucleic acid delivery vector, which is prepared by combining a neutral cytidine lipid material DNCA with a cystine backbone cationic lipid material CLD, and using DSPE-PEG as an auxiliary lipid material. The nucleic acid delivery vector is used to encapsulate nucleic acid molecules, and a breakthrough is achieved in the efficient delivery of nucleic acid drugs. Experiments have shown that after the nucleic acid delivery system prepared by encapsulating siRNA targeting IGF1RmRNA with the nucleic acid delivery vector is injected into mice through the tail vein, the accumulation amount in the mouse liver tumor site is as high as 41%, and the accumulation time is greater than 72h, which significantly silences the target mRNA in the tumor tissue cells, plays a role in efficiently inhibiting tumor growth, and the preparation is highly safe. The delivery system provided by the present invention can be used as a platform technology and is widely used in liver tissue targeted delivery of different types of functional oligonucleotides. At the same time, the new preparation obtained by encapsulating siRNA targeting IGF1R mRNA with the nucleic acid delivery vector significantly inhibits tumor growth in a hepatocellular carcinoma mouse model, and has no liver and kidney toxicity, laying a foundation for the clinical application of anti-hepatocellular carcinoma siRNA drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The results of the silencing activity of the target gene of HepG-2 and Huh-7 by targeting IGF1R mRNA-siRNA; Blank is the blank solvent control group, and NC is the negative control group. siRNA administration concentration: 25nM, detection time: 24h after administration, **** indicates the single-factor variance compared with NC;

[0028] Figure 2 The results of silencing target mRNA of HepG-2 and Huh-7 cells by siIGF1R-b with different chemical modifications, where Blank is the blank solvent control group and NC is the negative control group; siRNA administration concentration: 25 nM, detection time: 24 h after administration, **** indicates single factor variance compared with NC;

[0029] Figure 3 The results of characterization of the Mix lipid complex encapsulated siIGF1R-b2 preparations incorporated with DSPE-PEG; A. Dynamic light scattering (DLS) was used to determine the particle size and PDI coefficient of the siIGF1R-b2 / Mix lipid complexes with 0%, 0.25%, 0.5%, and 0.75% DSPE-PEG; B. Dynamic light scattering (DLS) was used to determine the Zeta potential of the siIGF1R-b2 / Mix lipid complexes with 0%, 0.25%, 0.5%, and 0.75% PEG; C. Particle size distribution of the siIGF1R-b2 / Mix / 0.75% PEG lipid complex; D. Cumulative release curve of the siIGF1R-b2 / Mix / 0.75% PEG lipid complex in PBS at 37°C; E. Representative TEM images of the siIGF1R-b2 / Mix / 0.75% PEG lipid complex, scale bar: 200nm;

[0030] Figure 4 Flow cytometry was used to investigate the uptake of unencapsulated and DNCA / CLD (Mix)-encapsulated siIGF1R-b2 preparations in Huh-7 and HepG-2 cells; A. Cell fluorescence intensity after administration of different preparation groups; B. Cell uptake rate and cell flow cytometric peak graph after administration of different preparation groups; Cells used: Huh-7, HepG-2; siIGF1R-b2 conjugated with FAM, administration concentration: 25nM, detection time: 4h after administration; Among them, Blank: blank solvent control group; Naked: naked siIGF1R-b2; siIGF1R-b2 / Mix group: siIGF1R-b2:DNCA:CLD=1:21:31.5 (molar ratio);

[0031] Figure 5The ability of siIGF1R-b2 / Mix lipid complex to induce apoptosis of HepG-2 and Huh-7 cells was detected by flow cytometry; Blank: blank solvent control group; NC: negative control group; siIGF1R-b2 / Mix group: siIGF1R-b2: DNCA: CLD = 1:21:31.5 (molar ratio); the ratios of normal cells (orange), early apoptotic cells (purple), late apoptotic cells (red) and dead cells (green) are shown in the bar graph, siIGF1R-b2 administration concentration: 50 nM; detection time: 48 h after administration;

[0032] Figure 6 Flow cytometry was used to detect the effect of siIGF1R-b2 / Mix lipid complex on cell cycle; A. Cell cycle distribution diagram; B. Cell cycle distribution bar graph; Cells used: Huh-7, HepG-2; siIGF1R-b2 administration concentration: 50 nM, detection time: 4 h after administration;

[0033] Figure 7 The results of in vivo imaging and organ accumulation of naked Cy5.5-siIGF1R-b2 and Mix-encapsulated Cy5.5-siIGF1R-b2 preparations in nude mice with subcutaneous hepatocellular carcinoma tumors after tail vein administration; A. In vivo fluorescence imaging of mice with Mix-encapsulated siIGF1R-b2 at different time points and fluorescence quantitative analysis of tumor sites, Blank: blank solvent control group, Nake: siIGF1R-b2; siIGF1R-b2 / Mix / PEG group: siIGF1R-b2: DNCA: CLD = 1:21:31.5 (molar ratio), 0.75% DSPE-PEG in molar percentage of DNCA and CLD;

[0034] Figure 8 The fluorescence imaging results and mean fluorescence intensity results of major organs (heart, lung, liver, spleen, kidney) and tumors 24h and 72h after administration. Cells used: HepG-2; siIGF1R-b2 administration dose: 0.8mpk, single dose; Administration method: tail vein injection;

[0035] Fig. 9 The results are the accumulation ratios of the drug in the main organs of mice 24h and 72h after administration; the cells used are HepG-2; the dosage of siIGF1R-b2 is 0.8mpk, single time; the administration method is tail vein injection;

[0036] Fig.10The results show that siIGF1R-b2 can inhibit tumor growth in nude mice with subcutaneous hepatocellular carcinoma under the condition of naked administration and preparation; A. Mouse tumor, administration information and group setting; B. Tumor growth line graph of each group of mice; C. Photos of tumor tissues of each group of mice dissected; D. Weight changes of mice in each group during the whole experiment; E. Weight of tumor tissues of each group of mice dissected; F. Relative expression of IGF1R mRNA in tumor tissues of each group of mice; Cells used: HepG-2; siIGF1R-b2 administration dose: 0.8mpk;

[0037] Fig.11 The results of blood biochemical liver and kidney function index detection of mice in different preparation administration groups; among them, alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bile acid (TBA) are liver function indexes; urea nitrogen (UREA) and creatinine (CREA) are kidney function indexes. DETAILED DESCRIPTION

[0038] The present invention provides a nucleic acid delivery vector, comprising a neutral cytidine lipid material DNCA of a structural formula such as formula I, a cystine backbone cationic lipid material CLD of a structural formula such as formula II, and an auxiliary lipid material 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol DSPE-PEG of a structural formula such as formula III;

[0039]

[0040] In Formula I and Formula II, R1 is In formula III, R2 is C 16 H 33 .

[0041] In the present invention, the molar ratio of DNCA to CLD is preferably 21:31.5. The molar amount of DSPE-PEG preferably accounts for 0.25% to 0.75% of the total molar mass of DNCA and CLD, and can be 0.5%.

[0042] In the present invention, the amount of DSPE-PEG added is optimized. Compared with the siRNA drug delivery system prepared without adding DSPE-PEG, as the amount of DSPE-PEG added gradually increases, the particle size of the siRNA drug delivery system gradually decreases, the particle uniformity is better, the Zeta point increases, and it is close to neutral; at the same time, the drug release conforms to the first-order release equation Mt=115.63 (1-e-0.0082t). When the molar amount of the DSPE-PEG is 0.75% of the total molar mass of DNCA and CLD, the particle size is ideal, the particle size uniformity is good, and a good lipid nanosphere can be formed ( Figure 3 E), the potential is close to neutral, and it also has good release in vitro.

[0043] The invention provides a siRNA drug delivery system for treating hepatocellular carcinoma, comprising the nucleic acid delivery vector and the siRNA targeting IGF1R mRNA encapsulated in the nucleic acid delivery vector; the molar ratio of the siRNA to DNCA is 1:21.

[0044] In the present invention, the siRNA targeting IGF1R mRNA preferably includes at least one of the following siRNAs: siIGF1R-a, siIGF1R-b, siIGF1R-c, siIGF1R-d and siIGF1R-e. The siRNA is an siRNA designed based on the IGF1R mRNA gene sequence (NM_000875.5) mRNA CDS region). The siIGF1R-a includes a sense strand as shown in the nucleotide sequence of SEQ ID NO: 1 (GCC UGAGCAAGAUGAUUCAGA) and an antisense strand as shown in SEQ ID NO: 2 (UCU GAA UCAUCUUGC UCAGGC). The siIGF1R-b includes a sense strand as shown in the nucleotide sequence of SEQ ID NO: 3 (AAG CCU GAGCAA GAU GAU UCA) and an antisense strand as shown in SEQ ID NO: 4 (UGAAUC AUC UUG CUCAGG CUU). The siIGF1R-c comprises a sense strand as shown in SEQ ID NO: 5 (CCU GAG CAAGAU GAU UCAGAU) and an antisense strand as shown in SEQ ID NO: 6 (AUC UGAAUCAUC UUG CUCAGG). The siIGF1R-d comprises a sense strand as shown in SEQ ID NO: 7 (CAAGCC UGA GCAAGAUGAUUC) and an antisense strand as shown in SEQ ID NO: 8 (GAAUCAUCU UGC UCAGGC UUG). The siIGF1R-e comprises a sense strand as shown in SEQ ID NO: 9 (UCC AAG CCU GAG CAA GAU GAU) and an antisense strand as shown in SEQ ID NO: 10 (AUC AUC UUG CUCAGGCUU GGA). The siIGF1R-a, siIGF1R-b, siIGF1R-c, siIGF1R-d and siIGF1R-e all have good targeted silencing efficiency on IGF1R mRNA in hepatocellular carcinoma, among which siIGF1R-b has the best silencing effect.

[0045] In the present invention, the siRNA targeting IGF1R mRNA preferably includes chemically modified nucleotides and / or thiophosphate groups connected between two adjacent nucleotides. The chemical modifications in the chemically modified nucleotides preferably include F modification, 2′-deoxyribose modification and 2′-methoxy modification. The chemically modified siRNA (siIGF1R-b1 to siIGF1R-b5, the sequence is shown in Table 4 below) has good targeted silencing efficiency for IGF1R mRNA in hepatocellular carcinoma, among which siIGF1R-b2 has the best silencing effect on the target gene IGF1R mRNA. The antisense chain of the siIGF1R-b2 is chemically modified in the following manner: in the direction of 5′ to 3′, the nucleotides at positions 2, 6, 8, 9, 14 and 16 of the antisense chain are 2′-fluorine-modified nucleotides, the nucleotides at positions 22 and 23 of the antisense chain are 2′-deoxyribose-modified thymidylic acid, and the remaining positions of the antisense chain are 2′-methoxy-modified nucleotides. The antisense strand is linked by thiophosphate between positions 1 and 2, between positions 2 and 3, between positions 21 and 22, and between positions 22 and 23, and the remaining adjacent nucleotides are linked by phosphate groups.

[0046] The invention provides a nucleic acid drug for treating hepatocellular carcinoma, comprising the siRNA drug delivery system and a cell transfection solution.

[0047] In the present invention, the cell transfection solution is preferably a GenOpti solution. In an embodiment of the present invention, the GenOpti solution is purchased from Maichen Technology (Beijing) Co., Ltd.

[0048] In the present invention, the entrapment concentration of siRNA in the nucleic acid drug can be 50-1000 nM, or can be 50 nM, 200 nM, 250 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, or 900 nM.

[0049] The present invention provides a method for preparing the nucleic acid drug for treating hepatocellular carcinoma, comprising the following steps:

[0050] Mixing a mother solution of siRNA targeting IGF1R mRNA and a cell transfection solution to obtain a first material;

[0051] Adding DNCA, CLD and DSPE-PEG to the first material in sequence, and mixing the obtained second material with the cell transfection solution to obtain a third material;

[0052] The third material is subjected to ultrasonic treatment to obtain a nucleic acid drug.

[0053] In the present invention, the concentration of the mother solution of the siRNA targeting IGF1R mRNA is preferably 0.05mM to 10mM, and can be 0.1mM, 0.5mM, 1mM, 1.5mM, 2mM, 3mM, 4mM, 5mM, 6mM, 7mM, 8mM, 9mM. The solvent of the mother solution is preferably RNase-free water. The mixed volume of the siRNA mother solution targeting IGF1R mRNA and the cell transfection solution is preferably 2:1.

[0054] In the present invention, when DNCA, CLD and DSPE-PEG are added to the first material in sequence, it is preferably added close to the liquid surface. The concentration of the mother solution of the DNCA or CLD is preferably 1mM to 100mM, which can be 2mM, 4mM, 6mM, 8mM, 10mM, 12mM, 15mM, 20mM, 25mM, 30mM, 35mM, 40mM, 60mM, 80mM, 90mM. The concentration of the mother solution of the DSPE-PEG is preferably 0.1mM to 50mM, more preferably 0.5mM, 1mM, 2mM, 5mM, 8mM, 10mM, 20mM, 25mM, 30mM, 35mM, 40mM, 45mM. The solvent of the mother solution of the DNCA or CLD is preferably ethanol. The mother solution of the DSPE-PEG is preferably dissolved in ethanol.

[0055] In the present invention, the temperature of the ultrasound is preferably 45 to 55° C., and may be 50° C. The power of the ultrasound is preferably 90 to 110 Hz, and may be 100 Hz. The time of the ultrasound is preferably 10 to 20 min, and may be 15 min. After the ultrasound treatment, the nucleic acid drug obtained is a spherical nanoparticle, and preferably has a particle size of 260 to 300 nm.

[0056] The present invention provides the use of the nucleic acid delivery vector and the siRNA drug delivery system in preparing drugs for preventing and / or treating hepatocellular carcinoma.

[0057] In one embodiment of the present invention, the uptake of the nucleic acid drug by liver cancer cells was evaluated. Compared with the unencapsulated siIGF1R-b2 administration group, the positive conversion rate of the siRNA drug delivery system in HepG-2 and Huh-7 cells can be increased to more than 93%, indicating that the siRNA drug delivery system can efficiently and uniformly enter HepG-2 and Huh-7 cells, thereby improving the targeting efficiency of siRNA.

[0058] In another embodiment of the present invention, compared with the siIGF1R-b2 group, the nucleic acid drug of siIGF1R-b2 significantly enhanced the ability to induce early and late cell apoptosis. The nucleic acid drug of siIGF1R-b2 promotes apoptosis of cancer cells by silencing IGF1R mRNA.

[0059] In another embodiment of the present invention, animal experiments showed that compared with the siIGF1R-b2 administration group which could not be targeted and rapidly metabolized, the nucleic acid drug of siIGF1R-b2 was localized in the tumor site and had almost no metabolism at 9h, 24h, and 48h after injection.

[0060] In another embodiment of the present invention, animal experiments show that the nucleic acid drug siIGF1R-b2 not only has a good hepatocellular carcinoma growth inhibitory effect and achieves anti-tumor efficacy, but also has good drug safety and will not cause obvious liver and kidney damage.

[0061] The following is a detailed description of a nucleic acid drug preparation for treating hepatocellular carcinoma provided by the present invention, as well as its preparation method and application, in conjunction with the embodiments. However, they should not be construed as limiting the scope of protection of the present invention.

[0062] Example 1

[0063] siRNA sequences targeting IGF1R mRNA.

[0064] First, go to the website ( https: / / asia.ensembl.org / Homo_sapiens / Info / Index ) retrieved the IGF1R mRNA gene sequence and designed according to the following principles:

[0065] 1. Determine the target sequence region: The best region is 50-100bp downstream of the start codon.

[0066] 2. Control the length of siRNA: the length of siRNA should be between 19-25.

[0067] 3. siRNA specificity check: Ensure that the siRNA has no more than 78% of the same bases in the total sequence outside the target sequence.

[0068] 4. siRNA base optimization: Control the G / C content of siRNA to about 30%-50%, and the tenth base is preferably A / U. Design siRNA sequences through the websites http: / / rnaidesigner.thermofisher.com / rnaiexpress / design.do, http: / / sidirect2.rnai.jp; http: / / biodev.extra.cea.fr / DSIR / DSIR.html; https: / / blast.ncbi.nlm.nih.gov / Blast.cgi ) were used for BLAST to obtain the final 5 siRNA sequences, as shown in Table 1.

[0069] Table 1 Five designed siRNA sequences

[0070]

[0071] Each siRNA sequence and the targeted IGF1R transcript IGF1R_217 (NM_000875.5) mRNA CDS region, NC is the IGF1R non-targeting siRNA sequence.

[0072] Example 2

[0073] Preparation method of pharmaceutical preparation 1

[0074] 1. Materials and methods:

[0075] (1) The five small interfering RNA siIGF1R drugs targeting IGF1R mRNA prepared in Example 1 were prepared into a stock solution with a concentration of 0.05 mM using RNase-free water, and the nucleoside lipid material DNCA and the cationic lipid material CLD were prepared into a stock solution with a concentration of 1 mM using ethanol;

[0076] The structural formulas of DNCA and CLD are as follows:

[0077]

[0078] Among them, R1 is

[0079] (2) Add the stock solution of small interfering RNA drug to the centrifuge tube, and then add half the volume of GenOpti solution;

[0080] (3) Add the ethanol stock solutions of nucleoside lipid material DNCA and cationic lipid material CLD in sequence close to the liquid surface;

[0081] (4) Fill up the remaining volume with GenOpti solution;

[0082] (5) Ultrasonication at 50°C and 100 Hz for 15 min.

[0083] The molar ratio of the nucleoside lipid material, the cationic lipid material and the small interfering RNA is 21:31.5:1.

[0084] The loading concentration of each small interfering RNA was 250 nM.

[0085] Example 3

[0086] Preparation method of pharmaceutical preparation 2

[0087] 1. Materials and methods:

[0088] (1) The five small interfering RNA siIGF1R drugs targeting IGF1R mRNA prepared in Example 1 were prepared into a stock solution with a concentration of 0.05 mM using RNase-free water, the nucleoside lipid material DNCA and the cationic lipid material CLD were prepared into a stock solution with a concentration of 1 mM using ethanol, and the auxiliary lipid material DSPE-PEG was prepared into a stock solution with a concentration of 0.1 mM using ethanol;

[0089] The structural formulas of DNCA, CLD and DSPE-PEG are as follows:

[0090]

[0091] Among them, R1 is R2 is C16H33.

[0092] (2) Add the stock solution of small interfering RNA drug to the centrifuge tube, and then add half the volume of GenOpti solution;

[0093] (3) Add the ethanol stock solutions of nucleoside lipid material DNCA, cationic lipid material CLD, and auxiliary lipid material DSPE-PEG in sequence close to the liquid surface;

[0094] (4) Fill up the remaining volume with GenOpti solution;

[0095] (5) Ultrasound at 50°C and 100 Hz for 15 min.

[0096] The molar ratio of the nucleoside lipid material, the cationic lipid material and the small interfering RNA is 21:31.5:1.

[0097] The dosage of the auxiliary lipid material is 0.25% of the total molar number of the nucleoside lipid material and the cationic lipid material.

[0098] The loading concentration of each small interfering RNA was 250 nM.

[0099] Example 4

[0100] Preparation method of pharmaceutical preparation 3

[0101] 1. Materials and methods:

[0102] (1) The five small interfering RNA siIGF1R drugs targeting IGF1R mRNA prepared in Example 1 were prepared into a stock solution with a concentration of 0.05 mM using RNase-free water, the nucleoside lipid material DNCA and the cationic lipid material CLD were prepared into a stock solution with a concentration of 1 mM using ethanol, and the auxiliary lipid material DSPE-PEG was prepared into a stock solution with a concentration of 0.1 mM using ethanol;

[0103] The structural formulas of DNCA, CLD and DSPE-PEG are as follows:

[0104]

[0105] Among them, R1 is R2 is C16H33.

[0106] (2) Add the stock solution of small interfering RNA drug to the centrifuge tube, and then add half the volume of GenOpti solution;

[0107] (3) Add the ethanol stock solutions of nucleoside lipid material DNCA, cationic lipid material CLD, and auxiliary lipid material DSPE-PEG in sequence close to the liquid surface;

[0108] (4) Fill up the remaining volume with GenOpti solution;

[0109] (5) Ultrasound at 50°C and 100 Hz for 15 min.

[0110] The molar ratio of the nucleoside lipid material, the cationic lipid material and the small interfering RNA is 21:31.5:1.

[0111] The dosage of the auxiliary lipid material is 0.5% of the total molar number of the nucleoside lipid material and the cationic lipid material.

[0112] The loading concentration of each small interfering RNA was 250 nM.

[0113] Example 5

[0114] Preparation method of pharmaceutical preparation 4

[0115] 1. Materials and methods:

[0116] (1) The five small interfering RNA siIGF1R drugs targeting IGF1R mRNA prepared in Example 1 were prepared into a stock solution with a concentration of 0.05 mM using RNase-free water, the nucleoside lipid material DNCA and the cationic lipid material CLD were prepared into a stock solution with a concentration of 1 mM using ethanol, and the auxiliary lipid material DSPE-PEG was prepared into a stock solution with a concentration of 0.1 mM using ethanol;

[0117] The structural formulas of DNCA, CLD and DSPE-PEG are as follows:

[0118]

[0119] Among them, R1 is R2 is C 16 H 33。

[0120] (2) Add the stock solution of small interfering RNA drug to the centrifuge tube, and then add half the volume of GenOpti solution;

[0121] (3) Add the ethanol stock solutions of nucleoside lipid material DNCA, cationic lipid material CLD, and auxiliary lipid material DSPE-PEG in sequence close to the liquid surface;

[0122] (4) Fill up the remaining volume with GenOpti solution;

[0123] (5) Ultrasound at 50°C and 100 Hz for 15 min.

[0124] The molar ratio of the nucleoside lipid material, the cationic lipid material and the small interfering RNA is 21:31.5:1.

[0125] The dosage of the auxiliary lipid material is 0.75% of the total molar number of the nucleoside lipid material and the cationic lipid material.

[0126] The loading concentration of each small interfering RNA was 250 nM.

[0127] Example 6

[0128] Mix (nucleoside lipid material DNCA and cationic lipid material CLD) was used to encapsulate five siRNAs targeting IGF1R mRNA to form siRNA lipid complexes (denoted as siRNA / Mix) to evaluate the silencing activity of the target gene in Huh-7 and HepG-2 cells.

[0129] 1. Materials and methods:

[0130] Five small interfering RNAs (siRNAs) targeting IGF1R mRNA, including siIGF1R-a, siIGF1R-b, siIGF1R-c, siIGF1R-d, and siIGF1R-e, were ordered from Bio-Engineering (Shanghai) Co., Ltd. and General Biotech (Anhui) Co., Ltd.

[0131] 1.1RT-qPCR experiment: Huh-7 was cultured at 1.2×10 5 cells / well were plated in 12-well plates, and HepG-2 cells were plated at 1.0×10 5 cells / well were plated in a 12-well plate, 900 μL of culture medium per well, and transfection was performed after culturing at 37°C for 16-24 hours. Each preparation was prepared according to the drug preparation method 1 in Example 2 (omitting the addition of the auxiliary lipid material DSPE-PEG), and the concentration of small interfering RNA siIGF1R-a, siIGF1R-b, siIGF1R-c, siIGF1R-d, and NC in the preparation was 250 nM (i.e., the final concentration of administration was 25 nM), the preparation volume was 100 μL, and the administration was dripped.

[0132] 24 hours after administration, total RNA was extracted by Trizol method. 500 μL / well of Trizol was added to the cells of 12-well plate and mixed, and the mixture was transferred to 1.5 mL RNase-Free EP tube after standing at room temperature for 5 min. 100 μL of chloroform was added and vortexed to mix, and then centrifuged at 12000g for 15 min at 4°C. 200 μL of aqueous supernatant was aspirated, and 200 μL of isopropanol was added. After vortexing, the mixture was stood on ice for 15 min, and centrifuged at 12000g for 15 min at 4°C. The supernatant was discarded, and RNA precipitate was visible at the bottom of the tube. Subsequently, 1 mL of freshly prepared pre-cooled 70% ethanol was added to each tube, and the precipitate was gently washed. The mixture was centrifuged at 12000g for 15 min at 4°C, and the supernatant was discarded. The precipitate was dried to near dryness, and dissolved in DEPC water, and stored at 4°C for use or at -80°C.

[0133] After quantification using Nanodrop, add 1 μg of total RNA to a 0.2 mL RNase-Free EP tube, add 10 μL of enzyme-free water, put it into a PCR instrument, and heat at 70°C for 10 min. Take it out and centrifuge it briefly, and place it at 4°C.

[0134] Prepare the reverse transcription reaction solution according to Table 2:

[0135] Table 2 Reverse transcription reaction solution preparation table

[0136] Element Volume (μL) / tube <![CDATA[MgCl2]]> 4.0 10×Buffer 2.0 dNTP 2.0 Rnasin 0.5 Reverse transcriptase AMV 0.65 Random Primers 1.0

[0137] Add reaction solution to each tube of RNA, put into PCR instrument, 42℃, 15min, 95℃, 5min, 4℃ 5min. The obtained cDNA is stored at 4℃ for later use or at -80℃.

[0138] 20 μL of the above cDNA was diluted 5 times with 80 μL of enzyme-free water and the reaction system and reaction procedure in Table 3 were followed. The reaction solution was prepared in a tube or a dedicated 96-well plate for real-time quantitative PCR.

[0139] Table 3. Preparation of real-time quantitative PCR reaction solution

[0140] Element Volume (μL) / tube GoTaqqPCRMasterMix 10 template 2.0 Forward primer (10 μM) 1.0 Reverse primer (10 μM) 1.0 <![CDATA[ddH2O]]> Refill to 20

[0141] PCR program: 95°C, 10 min; 95°C for 15 s, 58°C for 1 min, 40 cycles.

[0142] The forward primer of IGF1R mRNA was GGGACATAAACACCAGGAACAACG G (5′-3′, SEQ ID NO: 13), and the reverse primer was GTG CCAGGT TAT GAT GAT GCGATT CT (5′-3′, SEQ ID NO: 14). The forward primer of internal reference (β-actin) was CCAACC GCGAGAAGATGA (5′-3′, SEQ ID NO: 15), and the reverse primer was CCAGAG GCGTACAGG GATAG (5′-3′, SEQ ID NO: 16).

[0143] 2. Results

[0144] The silencing effect of siRNA on IGF1R mRNA in HepG-2 and Huh-7 cells by siRNA delivery through the mixed lipid material of nucleoside lipid DNCA and cationic lipid CLD was studied. Figure 1 It can be observed that the natural sequence siIGF1R-b has the best silencing effect on IGF1R mRNA.

[0145] Example 7

[0146] The natural sequence siIGF1R-b was chemically modified and its silencing activity on the target gene was evaluated.

[0147] 1. Materials and methods:

[0148] The natural small interfering RNA nucleic acid sequences were ordered from General Biotechnology (Anhui) Co., Ltd.

[0149] The chemically modified siIGF1R-b was artificially synthesized according to the following chemical modification method, and then its silencing activity on the target gene was detected according to the drug preparation method 1 of Example 2 (omitting the addition of the auxiliary lipid material DSPE-PEG).

[0150] The chemical modification of the sense strand of siIGF1R-b1 to siIGF1R-b5 is as follows: in the direction of 5′ to 3′, the nucleotides at positions 7, 9, 10, and 11 of the sense strand are 2′-F modified nucleotides, the nucleotides at positions 20 and 21 of the sense strand are 2′-deoxyribose modified thymidylic acid, and the remaining positions of the sense strand are 2′-methoxy modified nucleotides. Positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 of the sense strand are linked by thiophosphates, and the remaining adjacent nucleotides are linked by phosphate groups. The chemical modification of the antisense strand of siIGF1R-a is as follows: in the direction of 5′ to 3′, the nucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2′-fluorine modified nucleotides, the nucleotides at positions 22 and 23 of the antisense strand are 2′-deoxyribose modified thymidylic acid, and the remaining positions of the antisense strand are 2′-methoxy modified nucleotides. The antisense strand is linked by thiophosphate between positions 1 and 2, between positions 2 and 3, between positions 21 and 22, and between positions 22 and 23, and the remaining adjacent nucleotides are linked by phosphate groups.

[0151] The chemical modification of the antisense strand of siIGF1R-b1 is as follows: from 5' to 3', the nucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2'-fluorine-modified nucleotides, the nucleotides at positions 22 and 23 of the antisense strand are 2'-deoxyribose-modified thymidylic acid, and the remaining positions of the antisense strand are 2'-methoxy-modified nucleotides. Positions 1 and 2, positions 2 and 3, positions 21 and 22, and positions 22 and 23 of the antisense strand are linked by thiophosphates, and the remaining adjacent nucleotides are linked by phosphate groups.

[0152] The chemical modification of the antisense strand of siIGF1R-b2 is as follows: from 5' to 3', the nucleotides at positions 2, 6, 8, 9, 14, and 16 of the antisense strand are 2'-fluorine-modified nucleotides, the nucleotides at positions 22 and 23 of the antisense strand are 2'-deoxyribose-modified thymidylic acid, and the remaining positions of the antisense strand are 2'-methoxy-modified nucleotides. Positions 1 and 2, positions 2 and 3, positions 21 and 22, and positions 22 and 23 of the antisense strand are linked by thiophosphates, and the remaining adjacent nucleotides are linked by phosphate groups.

[0153] The chemical modification of the antisense strand of siIGF1R-b3 is as follows: from 5' to 3', the nucleotides at positions 2, 6, 8, 9, 10, 14, and 16 of the antisense strand are 2'-fluorine-modified nucleotides, the nucleotides at positions 22 and 23 of the antisense strand are 2'-deoxyribose-modified thymidylic acid, and the remaining positions of the antisense strand are 2'-methoxy-modified nucleotides. Positions 1 and 2, positions 2 and 3, positions 21 and 22, and positions 22 and 23 of the antisense strand are linked by thiophosphates, and the remaining adjacent nucleotides are linked by phosphate groups.

[0154] The chemical modification of the antisense strand of siIGF1R-b4 is as follows: from 5' to 3', the nucleotides at positions 2, 4, 5, 6, 8, 10, 14, 16, and 18 of the antisense strand are 2'-fluorine-modified nucleotides, the nucleotides at positions 22 and 23 of the antisense strand are 2'-deoxyribose-modified thymidylic acid, and the remaining positions of the antisense strand are 2'-methoxy-modified nucleotides. Positions 1 and 2, positions 2 and 3, positions 21 and 22, and positions 22 and 23 of the antisense strand are linked by thiophosphates, and the remaining adjacent nucleotides are linked by phosphate groups.

[0155] The chemical modification of the antisense strand of siIGF1R-b5 is as follows: from 5' to 3', the nucleotides at positions 2, 6, 9, 14, and 16 of the antisense strand are 2'-fluorine-modified nucleotides, the nucleotides at positions 22 and 23 of the antisense strand are 2'-deoxyribose-modified thymidylic acid, and the remaining positions of the antisense strand are 2'-methoxy-modified nucleotides. Positions 1 and 2, positions 2 and 3, positions 21 and 22, and positions 22 and 23 of the antisense strand are connected by thiophosphates, and the remaining adjacent nucleotides are connected by phosphate groups. The specific sequence is shown in Table 4.

[0156] Table 4 Sequences of siIGF1R-b with different chemical modifications

[0157] name Sequence 5′→3′ siIGF1R-b1 AS: UsGsAAUCAUCUUGCUCAGGCUUsTsT (SEQ ID NO: 17) siIGF1R-b2 AS: UsGsAAUCAUCUUGCUCAGGCUUsTsT (SEQ ID NO: 18) siIGF1R-b3 AS: UsGsAAUCAUCUUGCUCAGGCUUsTsT (SEQ ID NO: 19) siIGF1R-b4 AS: UsGsAAUCAUCUUGCUCAGGCUUsTsT (SEQ ID NO: 20) siIGF1R-b5 AS: UsGsAAUCAUCUUGCUCAGGCUUsTsT (SEQ ID NO: 21) siIGF1R1~siIGF1R5 SS: AsAsGCCUGAGCAAGAUGAUUCAsTsT (SEQ ID NO: 22)

[0158] RT-qPCR experiments were performed on chemically modified small interfering RNA (siIGF1R-b1~siIGF1R-b5). Figure 2 It can be seen that the modified sequence siIGF1R-b2 has the best silencing effect on the target gene IGF1R mRNA, and siIGF1R-b2 was used in subsequent experiments.

[0159] Example 8

[0160] Characterization of siIGF1R-b2 nucleic acid drug incorporated with DSPE-PEG

[0161] 1. Materials and Methods

[0162] According to the drug preparation methods 1, 2, 3, and 4 of Examples 2 to 5, siIGF1R-b2 nucleic acid drugs containing different amounts of DSPE-PEG were prepared, the concentration of siIGF1R-b2 in each group of preparations was 250 nM, the final concentration of administration was 25 nM, the volume of the solution was 900 μL, and DSPE-PEG was 0%, 0.25%, 0.5%, and 0.75% of the total molar amount of the mixed lipid material, respectively.

[0163] The average hydrated particle size, polydispersity index (PDI) and surface potential (Zeta potential) of the preparation were measured using a Malvern Zetasizer Nano-ZS laser scattering particle size analyzer, and the data were analyzed and processed using ELS-8000 software. The in vitro drug release rate of the preparation particles was obtained by transferring 2 mL of siIGF1R-b2 / Mix / PEG into a dialysis bag (Spectrumlabs; 25 kDa cutoff molecular weight), clamping the two parts of the dialysis bag, and then completely immersing it in 50 mL of PBS, placing the entire device on a magnetic heating stirrer (37°C, 200 rpm), taking 5 μL of buffer at each predetermined time point, and quantifying it using a ThermoNanoDrop 2000C UV spectrophotometer. The cumulative drug release rate was calculated according to Formula I.

[0164] Cumulative drug release rate (%) = amount of siIGF1R-b2 released in buffer solution / initial amount of siIGF1R-b2 × 100% Formula I.

[0165] The particle morphology of the preparations was observed using a transmission electron microscope (TEM, JEM-1400Plus, 120 kV, JEOL, Japan) after treating the samples with negative staining method.

[0166] 2. Results

[0167] like Figure 3 As shown in Figure A, as the proportion of DSPE-PEG added increases, the particle size of the nanoparticles gradually decreases. Without the addition of PEG, the particle size of the nanoparticles is about 450.8 nm. When 0.75% DSPE-PEG is added at a molar percentage, the particle size of the nanoparticles decreases to about 282.5 nm, and the PDI value decreases from 0.46 to 0.26, indicating that the nanoparticles at this time have better uniformity.

[0168] The Zeta potential of each group with different DSPE-PEG ratios was then tested. When 0% PEG was added, the potential of the nanoparticles was -11.53 mV. As the proportion of DSPE-PEG increased, the potential increased to varying degrees and gradually approached 0 mV. When 0.75% DSPE-PEG was added, the potential was -2.31 mV, close to neutral ( Figure 3 B), and from the particle size distribution histogram of adding 0.75% DSPE-PEG, it can be seen that ( Figure 3 In (C), the nanoparticles formed by adding DSPE-PEG at this ratio have a better particle size distribution.

[0169] Then, the in vitro drug release rate of siIGF1R-b2 nucleic acid drug (siIGF1R-b2, DNCA, and CLD were mixed at a molar ratio of 1:21:31.5, in which the molar percentage of DSPE-PEG to DNCA and CLD was 0.75%) was investigated at 37°C. The results are as follows: Figure 3 As shown in D, 50% can be released in about 50 hours, and more than 95% can be released in about 200 hours. The in vitro drug release curve of the preparation conforms to the first-order release equation Mt=115.63(1-e-0.0082t); From the scanning electron microscope, it can be seen that the preparation group with 0.75% DSPE-PEG added has a sphere of about 200nm.

[0170] In summary, the drug preparation prepared by the siIGF1R-b2 nucleic acid drug doped with DSPE-PEG (the molar ratio of siIGF1R-b2, DNCA, and CLD is 1:21:31.5, and the molar percentage of DSPE-PEG is 0.75%) has an ideal particle size, good particle size uniformity, and can form a good lipid nanosphere ( Figure 3 Middle E), the potential is close to neutral, and it also has good release in vitro.

[0171] Example 9

[0172] Uptake of siIGF1R-b2 lipid complex (siRNA / Mix) by HepG-2 and Huh-7 cells.

[0173] 1. Materials and Methods

[0174] The nucleic acid sequence of siIGF1R-b2 was ordered from General Biotechnology (Anhui) Co., Ltd.

[0175] Huh-7 and HepG-2 cells were cultured at 1.2×10 5 cells / well, 1.0×10 5 cells / well were plated in a 12-well plate, 900 μL of culture medium per well, and transfection was performed after culturing at 37°C for 16-24 hours. The siIGF1R-b2 lipid complexes were prepared according to the drug preparation method 1 of Example 2 (omitting the addition of the auxiliary lipid material DSPE-PEG), wherein the concentrations of siIGF1R-a, siIGF1R-b, siIGF1R-c, and siIGF1R-d were 250 nM, respectively (i.e., the final concentration of administration was 25 nM), the preparation volume was 100 μL, and the administration was performed dropwise.

[0176] After administration, the cells were incubated in the incubator in the dark for 4 h, the culture plate was removed, washed once with PBS, digested with 0.25% trypsin, and collected into a 1.5 mL EP tube. The cells were centrifuged at 1000 rpm for 3 min at 4°C, the supernatant was discarded, the cells were washed twice with PBS or serum-free medium, resuspended with an appropriate amount of serum-free medium, sieved, and the changes in cell fluorescence values ​​after administration were detected by CytoFLEX flow cytometer (BECKMAN COULTER).

[0177] 2. Results

[0178] Flow cytometry was used to investigate the uptake of siIGF1R-b2 lipid complexes by Huh-7 and HepG-2 cells 4 hours after administration. As shown in Figure 4A, there was no significant difference in the fluorescence values ​​of cells in the naked siIGF1R-b2 group and the Blank group, indicating that unencapsulated siRNA was difficult to enter the cells. After siIGF1R-b2 encapsulated by Mix mixed lipid material, it had strong fluorescence in both cells, and the cell uptake peak was single, indicating that under this formulation condition, siIGF1R-b2 could enter the cells in large quantities and with high homogeneity. Subsequently, the proportion of positive cells ( Figure 4 In B), the positive conversion rates of the Nake group in HepG-2 and Huh-7 cells were all below 5%, while the positive conversion rates of the siIGF1R-b2 lipid complex group in HepG-2 and Huh-7 cells could be increased to more than 93%, indicating that the siIGF1R-b2 lipid complex can efficiently and uniformly enter the HepG-2 and Huh-7 cells ( Figure 6 ).

[0179] Example 10

[0180] Effect of siIGF1R-b2 lipid complex (siRNA / Mix) on the apoptotic ability of Huh-7 and HepG-2 cells.

[0181] 1. Materials and methods:

[0182] The siIGF1R-b2 nucleic acid sequence was ordered from General Biotechnology (Anhui) Co., Ltd.

[0183] Huh-7 and HepG-2 cells were cultured at 1.2×10 5 cells / well, 1.0×10 5Cells / well were plated in a 12-well plate, 900 μL of culture medium per well, and transfection was performed after culturing at 37°C for 16-24 hours. The siIGF1R-b2 lipid complex was prepared according to the drug preparation method 1 in Example 2 (omitting the addition of the auxiliary lipid material DSPE-PEG), wherein the concentrations of siIGF1R-a, siIGF1R-b, siIGF1R-c, siIGF1R-d, and NC were 500 nM (i.e., the final concentration of administration was 50 nM), and the volume of the nucleic acid drug was 100 μL, and the administration was dripped. After incubation for 48 hours, the culture medium was discarded, the cell surface was rinsed with pre-cooled DMEM, EDTA-free trypsin was added to digest and collect the cells, and the cells were resuspended in 1×bindingbuffer after centrifugation, and 2 μL of AnnexinV-FITC and PI were added, and incubated in the dark for 15 minutes. A 0.45 μm mesh was used to disperse the cell clusters, and CytoFLEX (Beckman Coulter) was used to detect cell apoptosis.

[0184] 2. Results

[0185] After 48 hours of incubation, compared with the NC group, the siIGF1R-b2 lipid complex significantly enhanced the ability to induce early and late apoptosis of cells, among which the total apoptosis of Huh-7 and HepG-2 cells was increased from 3.1% and 9.5% to 32.5% and 21.6%, respectively. The siIGF1R-b2 lipid complex group had a greater effect on the early apoptosis of Huh-7 and HepG-2 cells. This is consistent with the results reported in the literature that inhibition of the IGF-1R signaling pathway can inactivate the phosphoinositide-3 kinase (PI-3K)-Akt and Ras-Raf-MAPK pathways and destroy the dependence of cancer cells on p53, thereby causing cell apoptosis ( Figure 5 ). siIGF1R-b2 lipid complex promotes apoptosis of cancer cells by reducing the expression of IGF1R mRNA.

[0186] Embodiment 11

[0187] The ability of siIGF1R-b2 lipid complex (siRNA / Mix) to regulate the cell cycle of Huh-7 and HepG-2 cells

[0188] 1. Materials and methods:

[0189] The nucleic acid sequence of siIGF1R-b2 was ordered from General Biotechnology (Anhui) Co., Ltd.

[0190] Huh-7 and HepG-2 cells were cultured at 1.2×10 5 cells / well, 1.0×10 5cells / well were plated in a 12-well plate, with 900 μL of culture medium per well, and transfection was performed after culturing at 37°C for 16-24 hours. The siIGF1R-b2 lipid complex was prepared according to the drug preparation method 1 in Example 2 (omitting the addition of the auxiliary lipid material DSPE-PEG), wherein the concentrations of siIGF1R-a, siIGF1R-b, siIGF1R-c, siIGF1R-d, and NC were 500 nM (i.e., the final concentration of administration was 50 nM), the preparation volume was 100 μL, and the administration was dripped. After incubation for 48 hours, the culture medium was discarded, the cell surface was rinsed with pre-cooled DMEM, EDTA-free trypsin was added to digest and collect the cells, resuspended in 1×bindingbuffer after centrifugation, PI 2 μL was added, and incubated in the dark for 15 minutes. A 0.45 μm mesh was used to disperse the cell clusters, and CytoFLEX (Beckman Coulter) was used to detect the cell cycle.

[0191] 2. Results

[0192] The siIGF1R-b2 lipid complex group caused Huh-7 and HepG-2 cell cycles to significantly arrest in the S phase. Compared with NC, the number of cells in the G0 / G1 phase of the total HepG-2 population decreased significantly, and the number of cells in the S phase increased significantly by 8.37%. Compared with NC, in the total Huh-7 population, not only the number of cells in the S phase increased, but also the number of cells in the G0 / G1 phase increased slightly, with an increase of 8% in the S phase and 3.42% in the G0 / G1 phase. Similarly, the number of cells in the G2 / M phase of Huh-7 cells decreased significantly. This experimental result shows that the siIGF1R-b2 lipid complex can effectively arrest the HepG-2 cell cycle in the S phase and the Huh-7 cell cycle in the S phase and the G0 / G1 phase.

[0193] Example 12

[0194] In vivo distribution and metabolism of nucleic acid drugs (siRNA / Mix / PEG) encapsulated with Cy5.5-siIGF1R-b2.

[0195] 1. Materials and methods:

[0196] Cy5.5-siIGF1R-b2 was ordered from General Biotechnology (Anhui) Co., Ltd.

[0197] Female BALB / c-nude mice aged 4-6 weeks were selected and inoculated with 5×10 6HepG-2 cells, on the 13th day after tumor inoculation, mice were randomly divided into Blank, Nake (Cy5.5-siIGF1R-b2), and nucleic acid drugs encapsulating Cy5.5-siIGF1R-b2 (Cy5.5-siIGF1R-b2: DNCA: CLD = 1:21:31.5, DSPE-PEG with a molar percentage of 0.75%, prepared according to the drug preparation method 4 in Example 5). Each group of preparations was injected into the mice through the tail vein, and the dosage of nucleic acid in each group was 0.8 mpk. At different time periods after administration, the mice were subjected to in vivo fluorescence imaging using a small animal in vivo imaging device (IVIS Spectrum). At the end of the experiment, the mice were anesthetized with isoflurane and killed by cervical dislocation, and the heart, lungs, liver, spleen, kidneys and tumors were taken for fluorescence imaging. The excitation wavelength during imaging was 675 nm, the emission wavelength was 720 nm, and the fluorescence quantification was performed using LivingImage software.

[0198] 2. Results

[0199] Cy5.5-siIGF1R-b2 and nucleic acid drugs loaded with Cy5.5-siIGF1R-b2 were injected into the tail vein at a dose of 0.8 mg / kg, and then the fluorescence value was detected at different time points using a small animal imaging device. Figure 7 As shown in the live imaging, the fluorescence intensity of the Nake group was higher than that of the nucleic acid drug group encapsulating Cy5.5-siIGF1R-b2 at 1 hour, and the fluorescence was distributed throughout the BALB / c nude mice; as time went on, the fluorescence of the Nake group decreased significantly, and there was almost no fluorescence accumulation in the tumor site after 24 hours, indicating that the unencapsulated siIGF1R-b2 was rapidly metabolized in the body and had no targeting. Live imaging of the nucleic acid drug group encapsulating Cy5.5-siIGF1R-b2 ( Figure 7 ) can be clearly seen that the fluorescence is mainly concentrated in the tumor site, and it is worth noting that the quantitative fluorescence value curve of the tumor site is flat during the entire detection period, with almost no decrease at 9h, 24h, and 48h.

[0200] Then, BALB / c nude mice were euthanized at 24h and 72h, and the main organs and tumors of each group were dissected for fluorescence imaging. Figure 8It can be seen intuitively that at 24 hours, the fluorescence of the Nake group was mainly concentrated in the liver, followed by the kidney, and there was a weak fluorescence in the lung tumor; at 72 hours, except for the weak fluorescence in the liver, there was no obvious fluorescence in other parts, indicating that the Nake group was mainly metabolized by the liver and quickly eliminated in the body. At 24 hours, the fluorescence of the nucleic acid drug group encapsulated Cy5.5-siIGF1R-b2 was strong in the liver, followed by the spleen and tumor, with a weak fluorescence signal in the lung, and no obvious fluorescence in other parts; by 72 hours, the fluorescence of the liver, spleen and lungs was rapidly metabolized, and the fluorescence gradually gathered in the tumor, making the fluorescence at the tumor the strongest. The ROE tool was used to measure and quantitatively analyze the fluorescence accumulation of major organs and tumors ( Fig. 9 ), at 72h in the encapsulation group, the fluorescence value of the tumor site exceeded that of the liver and reached the highest, accounting for 41% of the distribution percentage of each organ, which was nearly 20% higher than that at 24h (23%). As expected, the nucleic acid drug encapsulated with Cy5.5-siIGF1R-b2 can efficiently accumulate in the tumor site of HepG-2 nude mice. In general, the nucleic acid drug encapsulated with Cy5.5-siIGF1R-b2 has excellent tumor targeting and tumor accumulation ability.

[0201] Example 12

[0202] In vivo pharmacodynamics and safety of nucleic acid drugs (siRNA / Mix / PEG) encapsulating siIGF1R-b2.

[0203] 1. Materials and methods:

[0204] siIGF1R-b2 was ordered from General Biotechnology (Anhui) Co., Ltd.

[0205] 4-6 week old female BALB / c-nude mice were inoculated in the right axilla with 5×10 6 HepG-2 cells were used to construct an axillary hepatocellular carcinoma model. When the tumor grew to 50 mm 3 , and were randomly divided into 5 groups (6 mice in each group): Blank group (injected with normal saline), positive control group Donafenib, lipid material DNCA / CLD group (Mix), siIGF1R-b2 naked group and siIGF1R-b2-encapsulated nucleic acid drug group. The siIGF1R-b2 administration concentration in the latter two groups was the same, both 0.8 mpk. The nucleic acid drug group encapsulated with siIGF1R-b2 was prepared according to the method of Example 2, and the drug was injected into the tail vein twice a week (0.8 mpk). The Donafenib group was gavaged twice a day for a total of 26 times (5 mpk), and the tumor volume and mouse body weight changes were recorded every 2 days ( Fig.10A), on Day 14, after all treatments were completed, mice were euthanized, peripheral blood was taken from mice, and liver and kidney tissues were dissected and paraffin sections were made for pathological analysis of liver and kidney tissues, tumors were removed, weighed and photographed, and frozen sections of tumors were made, and immunofluorescence staining of IGF1R protein was performed. A portion of tumor tissue was cut and placed in an EP tube, 1 mL of Trizol was added, ground and mixed, and RT-qPCR experiments were performed (the operation was the same as in Example 3). After the liver and kidney tissues were fixed with 4% paraformaldehyde, they were trimmed, dehydrated, paraffin-embedded, sliced, HE-stained, sealed, and examined under a microscope. Hematoxylin staining solution is alkaline, which mainly makes the chromatin in the cell nucleus and the nucleic acid in the cytoplasm purple-blue; eosin is an acidic dye, which mainly makes the components in the cytoplasm and extracellular matrix red. The blood was placed in an EP tube at room temperature for more than one hour, centrifuged at 3500rpm for 10 minutes, and the serum was separated for blood biochemical index detection (ALT, AST, TBA, UREA, CREA) and inflammatory factor ELISA detection (IL-6, IL-1β, IFN-γ). Among the blood biochemical detection indicators, alanine aminotransferase ALT, aspartate aminotransferase AST, and total bilirubin TBIL represent liver damage. ALT is mainly distributed in the liver cytoplasm. Elevated ALT reflects damage to the liver cell membrane. AST is mainly distributed in the liver cytoplasm and liver cell mitochondria. When liver cells are severely damaged and mitochondria are endangered, AST will also enter the blood. When liver damage occurs, the metabolic efficiency of bilirubin is reduced, and TBA may increase. Urea and creatinine CREA represent kidney damage. When UREA and CREA increase at the same time, it indicates a significant decrease in renal function.

[0206] 2. Results

[0207] The body weight of mice in each group increased slowly and steadily during the entire treatment period, indicating that each group had no obvious toxic side effects on mice. Fig.10 As shown in B and C, the tumors in the Blank group and the Mix group showed significant growth during the entire treatment period (tumor growth was about 6 times), indicating that the inhibitory effect on tumor growth was very small and it can be confirmed that the lipid material group Mix had almost no toxic side effects; the Nake group did not show significant inhibition on tumor growth, indicating that the unencapsulated siRNA was quickly metabolized and cleared in the body and could not effectively play its role. This result is consistent with the in vivo drug distribution results; the Donafenib group slightly inhibited tumor growth; the siIGF1R-b2 / Mix / PEG group had a rapid growth period on day 2. After two doses, the tumor was significantly inhibited until the end of the experiment, and the tumor volume at the end of the experiment was smaller than the tumor volume at the beginning of the experiment (less than 50mm 3 ), compared with the positive control Donafenib group, it showed the most effective tumor inhibition in terms of both tumor volume and tumor weight ( Fig.10 D), and from Fig.10 Figure C also confirmed the excellent anti-tumor effect of the nucleic acid drug group loaded with siIGF1R-b2, indicating that this group of preparations can effectively inhibit tumor growth. RT-qPCR was used to further analyze the changes in IGF1R mRNA in tumors of different groups. Fig.10 As shown in Figure F, the target IGF1R mRNA in the tumor tissue of mice in the Nake group was not significantly silenced, while the nucleic acid drug encapsulated with siIGF1R-b2 could significantly silence 84% of the target IGF1R mRNA.

[0208] In summary, the nucleic acid drug encapsulated with siIGF1R-b2 has a significant anti-tumor effect in the subcutaneous tumor model of hepatocellular carcinoma constructed with HepG-2 cells. We tested liver (alanine aminotransferase ALT, aspartate aminotransferase AST, total bilirubin TBIL) and kidney biomarkers (urea UREA, creatinine CREA) to determine whether there is hepato-renal toxicity. The mice in each group were in normal condition throughout the experimental period, with stable body weight and no statistical difference between the groups. The blood biochemistry results showed that there was no significant difference in the levels of ALT, AST, TBIL, UREA and CREA in the serum of the mice in each group ( Fig.11 ), indicating that the nucleic acid drug encapsulated with siIGF1R-b2 has good drug safety and does not cause significant liver and kidney damage.

[0209] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A nucleic acid delivery vector, characterized in that It includes a neutral cytidine lipid material DNCA with a structural formula such as Formula I, a cystine backbone cationic lipid material CLD with a structural formula such as Formula II, and an auxiliary lipid material 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol DSPE-PEG with a structural formula such as Formula III; In Formula I and Formula II, R1 is In formula III, R2 is C 16 H 33 .

2. The nucleic acid delivery vector according to claim 1, characterized in that The molar ratio of DNCA to CLD is 21:31.

5.

3. The nucleic acid delivery vector according to claim 1 or 2, characterized in that: The molar amount of the DSPE-PEG accounts for 0.25% to 0.75% of the total molar mass of the DNCA and CLD.

4. A siRNA drug delivery system for treating hepatocellular carcinoma, characterized in that: A method comprising the nucleic acid delivery vector according to any one of claims 1 to 3 and an siRNA targeting IGF1R mRNA encapsulated in the nucleic acid delivery vector; The molar ratio of DNCA to siRNA is 21:

1.

5. The siRNA drug delivery system according to claim 4, characterized in that The siRNA targeting IGF1R mRNA includes at least one of the following siRNAs: siIGF1R-a, siIGF1R-b, siIGF1R-c, siIGF1R-d and siIGF1R-e; The siIGF1R-a comprises a sense strand as shown in SEQ ID NO: 1 and an antisense strand as shown in SEQ ID NO: 2; The siIGF1R-b comprises a sense strand as shown in SEQ ID NO: 3 and an antisense strand as shown in SEQ ID NO: 4; The siIGF1R-c comprises a sense strand as shown in SEQ ID NO: 5 and an antisense strand as shown in SEQ ID NO: 6; The siIGF1R-d comprises a sense strand as shown in SEQ ID NO: 7 and an antisense strand as shown in SEQ ID NO: 8; The siIGF1R-e comprises a sense strand as shown in SEQ ID NO:9 and an antisense strand as shown in SEQ ID NO:

10.

6. The siRNA drug delivery system according to claim 1 or 5, characterized in that The siRNA targeting IGF1R mRNA includes chemically modified nucleotides and / or a phosphorothioate group connected between two adjacent nucleotides.

7. The siRNA drug delivery system according to claim 6, characterized in that: The chemical modifications in the chemically modified nucleotides include F modification, 2'-deoxyribose modification and 2'-methoxy modification.

8. A nucleic acid drug for treating hepatocellular carcinoma, characterized in that: The invention comprises the siRNA drug delivery system as described in any one of claims 4 to 7 and a cell transfection solution.

9. The method for preparing the nucleic acid drug for treating hepatocellular carcinoma according to claim 8, characterized in that: The following steps are involved: Mixing a mother solution of siRNA targeting IGF1R mRNA and a cell transfection solution to obtain a first material; Sequentially adding a neutral cytidine lipid material DNCA, a cystine backbone cationic lipid material CLD, and an auxiliary lipid material 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol DSPE-PEG to the first material, and mixing the obtained second material with the remaining cell transfection solution to obtain a third material; The third material is subjected to ultrasonic treatment to obtain a nucleic acid drug.

10. Use of the nucleic acid delivery vector according to any one of claims 1 to 3 or the siRNA drug delivery system according to any one of claims 4 to 7 in the preparation of a drug for preventing and / or treating hepatocellular carcinoma.

Images