Scylla paramamosain eyes absent-2 gene editing method and application

Abstract

The invention relates to the technical field of scylla paramamosain, in particular to a method for editing an eyes absent-2 gene of scylla paramamosain and application of the method for editing the eyes absent-2 gene of scylla paramamosain. According to the application, sgRNA (Ribonucleic Acid), as shown in SEQ ID NO: 1, of a targeted eyes absent-2 gene is synthesized, then the sgRNA is combined with Cas9 protein to obtain an RNP (Ribonucleic Acid) compound, the RNP compound is introduced into a fertilized egg of scylla paramamosain in a single cell stage by adopting a microinjection mode, and after incubation, a target gene mutated scylla paramamosain F0 generation can be obtained. According to the application, the gene editing of the scylla paramamosain is efficiently realized, and an effective technical means is provided for the breeding and gene function research of the scylla paramamosain.

Description

Technical Field

[0001] The present application relates to the technical field of Scylla paramamosain, and specifically to a method and application of gene editing of eyes absent-2 in Scylla paramamosain. Background Art

[0002] Scylla paramamosain belongs to the Crustacea, Decapoda, Portunidae, and Scylla genus in taxonomy. It is widely distributed in the southeastern coast of China, the Indian Ocean, and the western Pacific Ocean. Because of its good taste, high nutritional value, and fast growth rate, it has a huge consumer market and has become an important marine aquaculture crab in my country. Since my country took the lead in breaking through the artificial breeding technology of blue crabs in the 1980s, its breeding scale has increased significantly. According to the "China Fisheries Statistical Yearbook 2024", in 2023, my country's blue crab production was close to 220,000 tons, while my country's annual consumption of blue crabs was about 500,000 tons, and this consumption gap mainly relied on foreign imports. The lack of production capacity caused by the shortage of seedlings is currently a major bottleneck in the development of my country's blue crab industry. Therefore, conducting research on the gene function of blue crabs and developing molecular breeding technology are of great value to the development of the blue crab industry. However, research on blue crab molecular breeding has been slow, and the reason is the lack of gene function research technology suitable for blue crabs.

[0003] CRISPR / Cas9 gene editing technology is a molecular biological technology that has emerged in recent years for the study of gene function. It can delete or insert DNA sequences at the genome level, ultimately clarifying gene functions and obtaining corresponding gene mutants. Therefore, the development of this gene editing technology in blue crabs is not only conducive to understanding the mechanism of gene function in the life activities of blue crabs, but also provides an important technical means for the development of new blue crab strains and the breeding of blue crab varieties. Summary of the invention

[0004] This application targets the eyes absent-2 gene of the mud crab (NC_087164.1 (17539317..17623131)), designs a target site sgRNA sequence in the first exon of the gene, and then compounds it with the Cas9 protein to obtain an RNP complex. The RNP complex is introduced into the fertilized eggs of the mud crab in the single-cell stage by microinjection. After hatching, the mud crab F0 generation with target gene mutations can be obtained, and the homozygous eyes absent-2 gene mutation can be obtained by continuing to breed and cultivate for multiple generations. This application efficiently realizes the editing of the eyes absent-2 gene of the mud crab, and provides an effective technical means for the breeding of mud crabs and the study of gene functions.

[0005] In a first aspect, the embodiments disclose an sgRNA targeting the eyes absent-2 gene of Scylla paramamosain, whose nucleotide sequence is shown in SEQ ID NO:1.

[0006] In an embodiment of the first aspect, the sgRNA targets the first exon of the eyes absent-2 gene.

[0007] In the second aspect, the embodiments disclose a Scylla paramamosain eyes absent-2 gene editing composition, which includes the sgRNA and Cas9 protein described in the first aspect.

[0008] In the third aspect, the embodiments disclose a Scylla paramamosain eyes absent-2 gene editing kit, which includes the sgRNA and Cas9 protein described in the first aspect.

[0009] In a fourth aspect, an embodiment discloses a method for editing the eyes absent-2 gene of Scylla paramamosain, which comprises injecting the RNP complex formed by the sgRNA and Cas9 protein as shown in SEQ ID NO: 1 into the fertilized eggs of the Scylla paramamosain in the single-cell stage.

[0010] In an embodiment of the fourth aspect, the injection concentration of the sgRNA is 250 ng / μL, and the final injection concentration of the Cas9 protein is 500 ng / μL.

[0011] In an embodiment of the fourth aspect, mutants are screened from progeny of the mud crab.

[0012] In the fifth aspect, the embodiments disclose the use of the sgRNA described in the first aspect in cultivating mutant strains of Scylla pseudoburrowing.

[0013] The blue crab fertilized egg tank mold used in this application is independently designed, and its length and width are both 300 μm. It can prepare 300 μm agarose egg tanks, which are suitable for blue crab cell fertilized eggs and ensure the stability of the fertilized eggs during microinjection.

[0014] The sgRNA, gene editing composition, kit, method and application provided by the present invention use gene editing technology to inject the sgRNA of the eyes absent-2 gene as shown in SEQ ID NO: 1 and the RNP complex formed by the Cas9 protein into the fertilized eggs of the blue crab cells and culture the blue crab embryos in vitro to obtain the eyes absent-2 gene editing mutant crablets verified by sequencing. The method is accurate and reliable, and can provide an important reference for the subsequent development of new blue crab strains and blue crab breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is a design drawing of a fertilized egg carrier mold provided in an embodiment.

[0016] Figure 2 The nucleotide editing type of the eyes absent-2 gene mutant of the mud crab provided in the example. DETAILED DESCRIPTION

[0017] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0018] 1. Experimental Materials

[0019] Wild-type mud crabs were raised in Ninghai Research Center, East China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences. Embryos used for microinjection of mud crabs were obtained from artificial breeding and spawning of sexually mature male and female parents.

[0020] 2. Design of sgRNA

[0021] The sgRNA shown in SEQ ID NO: 1 was synthesized, and its specific sequence is as follows:

[0022] m U m C m UGCAGCGCAAGCCCUAGA GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCmUmUmUUU, among which the underline is the target sequence and “m” means methylation.

[0023] 3. Treatment of fertilized eggs

[0024] Prepare 2.5% agarose solution with enzyme-free water, and pour the unsolidified 2.5% agarose solution into the culture dish. Immediately place the square mud crab fertilized egg carrier mold with the three ridges facing downward into the culture dish and allow it to cool and solidify naturally.

[0025] 4. Processing of sgRNA and Cas protein

[0026] The chemically synthesized eyes absent-2 gene sgRNA and commercial Cas9 protein (UniProt, accession number Q99ZW2) were diluted to 500 ng / μL and 1000 ng / μL respectively with enzyme-free water, and mixed at a volume ratio of 1:1 to obtain final concentrations of 250 ng / μL and 500 ng / μL of sgRNA and Cas9 protein, respectively. The mixture was incubated at 25°C for 15 minutes to form RNPs.

[0027] 5. Microinjection

[0028] Handheld Figure 1 Use the curved handle on the top of the mud crab fertilized egg tank mold shown to pull it out of the solidified agarose gel. Rinse the agarose egg tank with seawater with a salinity of 28. After rinsing, ensure that there is seawater with a salinity of 28 in the tank. Use a pipette and a fine needle to arrange the mud crab 1-cell fertilized eggs in the agarose egg tank under a stereoscope. Use a microinjector to inject the eyesabsent-2 gene RNP in sequence according to the arrangement position, with an injection volume of 0.3nL. After the injection, the fertilized eggs are left to stand for 15 minutes and then transferred to the hatching bucket for artificial culture of mud crab embryos until they grow into crab larvae.

[0029] 6. Parent breeding

[0030] The mutated mud crab is cultivated into the parent F0 generation; continuing to breed and cultivate for many generations to obtain homozygous eyes absent-2 gene mutations will form a stable mutant strain.

[0031] 7. Offspring testing

[0032] Ten injected and grown crab larvae were randomly collected, and the genomic DNA of the swimming legs of the crab larvae was extracted using a marine animal tissue genome extraction kit.

[0033] Using genomic DNA as template, PCR was performed using PCR target verification primers F: 5'-TGTTGAAGGCTCAGACGCAT-3' (SEQID NO: 2) and R: 5'-CTCCCCAAAGGACCTGATCG-3' (SEQ ID NO: 3). The reaction system was: 2×Master Mix 10μL, 0.2μL of each of the two primers, 1μL of DNA template, and dd H2O to 20μL. The PCR cycle program was: initial 95℃ 3min, (98℃, 10s; 60℃, 30s; 72℃, 30s)×30; final 72℃ 10min.

[0034] The PCR products were sequenced and the sequencing results were compared with the wild-type eyes absent-2 gene sequence to identify five mutant crablets. Figure 2 shown.

[0035] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. The sgRNA targeting the eyes absent-2 gene of Scylla paramamosain, the nucleotide sequence of which is shown in SEQ ID NO:

1.

2. The sgRNA according to claim 1, which targets the first exon of the eyes absent-2 gene.

3. An editing composition for the eyes absent-2 gene of Scylla paramamosain, comprising the target sgRNA and Cas9 protein as described in claim 1 or 2.

4. An editing kit for the eyes absent-2 gene of Scylla paramamosain, comprising the target sgRNA and Cas9 protein as described in claim 1 or 2.

5. A method for editing the eyes absent-2 gene of Scylla paramamosain, which comprises injecting the RNP complex formed by the sgRNA shown in SEQ ID NO: 1 and the Cas9 protein into the fertilized eggs of the Scylla paramamosain in the single-cell stage.

6. The editing method according to claim 5, wherein the step of preparing the RNP complex comprises: 250 ng / μL of the sgRNA and 500 ng / μL of the Cas9 protein were mixed in equal volumes and incubated statically to obtain the RNP complex.

7. The editing method according to claim 5 or 6, wherein mutants are screened from the offspring of the mud crab.

8. Use of the sgRNA according to claim 1 or 2 in cultivating mutant strains of Scylla pseudoburrowing.

Images