Rice nitrogen response transcription factor osnrtf2 gene and the protein and application thereof

Abstract

The application belongs to the field of plant genetic engineering, and particularly relates to a rice nitrogen response transcription factor OsNRTF2 gene and a protein encoded by the gene and application thereof. The application provides a rice nitrogen response transcription factor gene OsNRTF2, wherein the nucleotide sequence of the OsNRTF2 gene is shown in Seq ID No. 1. The application also simultaneously provides the use of the gene OsNRTF2, at least any one of the following: regulating rice yield and nitrogen use efficiency. The application provides important guidance for cultivating new rice varieties with high nitrogen efficiency, and has important significance for guaranteeing food security.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically relating to the rice nitrogen-responsive transcription factor OsNRTF2 gene and its encoded protein and its applications. Background Technology

[0002] Rice is one of the most important food crops and a model plant for monocotyledonous plant research. Nitrogen, a macronutrient, is essential for plant growth and development, and a sufficient nitrogen supply is crucial for crop yield. Increasing nitrogen fertilizer application can significantly improve rice yield, but excessive use not only increases the burden on the crop but also causes serious environmental pollution. Therefore, improving nitrogen use efficiency in rice, and reducing nitrogen fertilizer use while maintaining rice yield, is of great significance for green agricultural production.

[0003] Crop nitrogen use involves nitrogen absorption, translocation, and assimilation. Currently, a series of genes related to nitrogen absorption, translocation, assimilation, and retranslocation have been cloned and analyzed in crops such as rice, including nitrate transporter NRT1s and NRT2s family genes, ammonium transporter AMT family genes, nitrate reductase encoding genes NRs, and glutamine synthase GS family genes (Jiang et al., 2018; Li et al., 2021). Knocking out or overexpressing these related genes using gene editing technology can significantly affect crop nitrogen use efficiency and yield-related agronomic traits.

[0004] In addition to the genes mentioned above, transcription factors that can recognize promoter-specific motifs upstream of target genes and activate or inhibit the expression of downstream target genes also play a crucial role in crop nitrogen use. For example, the GRF-type transcription factor OsGRF4 protein in rice can directly activate the expression of genes related to nitrogen uptake and assimilation, promoting nitrogen uptake, assimilation, and transport, thereby increasing rice yield and nitrogen fertilizer use efficiency (Li, et al. 2018). The TCP-type transcription factor OsTCP19 is key to determining nitrogen response and tillering in rice, and its expression level is negatively correlated with the number of tillers. The 29 bp indel in the OsTCP19 promoter region is a key natural variation determining the number of tillers in different rice varieties under low nitrogen levels (Liu, et al. 2021). MYB-type transcription factors are one of the largest families of plant transcription factors, playing a vital role in plant growth and development, hormone signal transduction, and plant responses to biotic and abiotic factors. At least 155 MYB transcription factors were identified in the rice genome using bioinformatics methods (Katiyar, et al. 2012). 130 rice MYB transcription factors were also collected from the Plant Transcription Factor Database (http: / / planttfdb.gao-lab.org / ). Among them, OsMYB305 encodes a transcription activator; nitrogen deficiency induces OsMYB305 expression in roots; overexpression of OsMYB305 enhances nitrogen uptake and assimilation, improves rice growth under low-nitrogen conditions, and increases tiller number, aboveground dry weight, and total nitrogen concentration (Wang, et al. 2020). Rice MYB61 is a transcription factor that regulates cellulose synthesis; its gene expression is induced by low nitrogen and regulated by OsGRF4. Natural variation in OsMYB61 between indica and japonica rice subspecies leads to higher nitrogen use efficiency in indica rice (Gao, et al. 2020). OsNRTF2 is predicted to be a MYB-type transcription factor, but its biological function has not yet been reported.

[0005] The relevant references are as follows:

[0006] Jiang Zhimin, Wang Wei, Chu Chengcai (2018) Research progress and prospect of efficient nitrogen utilization in plants. Life Sciences 30: 1060-1071 Li Shan, Huang Yunzhi, Liu Xueying, Fu Xiangdong (2021) Research progress of genetic improvement of crop nitrogen fertilizer utilization efficiency. Genetics 43: 629-641;

[0007] Barman HN(2021)CRISPR-Cas9-Mediated Genome Editing in Rice:ASystematic Protocol for Single-and Multi-Target Vector Construction.CRISPR-Cas Methods:Volume 2 179-205;

[0008] Chen J,Zhang Y,Tan Y,Zhang M,Zhu L,Xu G,Fan X(2016)Agronomicnitrogen-use efficiency of rice can be increased by driving OsNRT2.1expression with the OsNAR2.1 promoter.Plant Biotechnology Journal 14:1705-1715;

[0009] Gao Y,Xu Z,Zhang L,Li S,Wang S,Yang H,Liu X,Zeng D,Liu Q,Qian Q(2020)MYB61is regulated by GRF4 and promotes nitrogen utilization and biomassproduction in rice.Nature communications 11:5219;

[0010] Katiyar A,Smita S,Lenka SK,Rajwanshi R,Chinnusamy V,Bansal KC(2012)Genome-wide classification and expression analysis of MYB transcriptionfactor families in rice and Arabidopsis.BMC genomics 13:544;

[0011] Li S,Tian Y,Wu K,Ye Y,Yu J,Zhang J,Liu Q,Hu M,Li H,Tong Y(2018)Modulating plant growth–metabolism coordination for sustainableagriculture.Nature 560:595-600;

[0012] Liu Y,Wang H,Jiang Z,Wang W,Xu R,Wang Q,Zhang Z,Li A,Liang Y,Ou S(2021)Genomic basis of geographical adaptation to soil nitrogen inrice.Nature 590:600-605;

[0013] Wang D,Xu T,Yin Z,Wu W,Geng H,Li L,Yang M,Cai H,Lian X(2020)Overexpression of OsMYB305 in rice enhances the nitrogen uptake under low-nitrogen condition.Frontiers in plant science 11:369;

[0014] Wen Y,Wu K,Chai B,Fang Y,Hu P,Tan Y,Wang Y,Wu H,Wang J,Zhu L(2023)NLG1,encoding a mitochondrial membrane protein,controls leaf and graindevelopment in rice.BMC Plant Biology 23:418;

[0015] Xiong M, Chu L, Li Q, Yu J, Yang Y, Zhou P, Zhou Y, Zhang C, Fan X, Zhao D (2021) Brassinosteroid and gibberellin coordinate rice seed germination and embryo growth by regulating glutelin mobilization. The Crop Journal 9:1039-1048. Summary of the Invention

[0016] The technical problem to be solved by this invention is to provide the rice nitrogen-responsive transcription factor gene OsNRTF2 and its encoded protein and its applications.

[0017] To address the aforementioned technical problems, this invention provides the rice nitrogen-responsive transcription factor gene OsNRTF2, the nucleotide sequence of which is shown in Seq ID No. 1.

[0018] As an improvement to the OsNRTF2 gene of the present invention: the cDNA and CDS nucleotide sequences of the OsNRTF2 gene are shown in Seq ID No.2 and Seq ID No.3, respectively.

[0019] The present invention also provides the protein encoded by the above-mentioned gene OsNRTF2, the amino acid sequence of which is shown in Seq ID No.4.

[0020] The present invention also provides a knockout vector containing the above-mentioned gene OsNRTF2: based on pC1300-Cas9-SK5G, the editing target sequence CGGCGTACCCTGGTCCGAA or CCGGGTCCTGGGACGATAA located in the exon of gene OsNRTF2 is inserted between the AarI-AarI restriction sites of the base vector.

[0021] The present invention also provides an overexpression vector containing the above-mentioned gene OsNRTF2, which is obtained by inserting the CDS sequence (excluding the stop codon) described in Seq ID No. 3 between the SacI restriction sites of the base vector, using pUbi-GFP as the base vector.

[0022] The present invention also provides host cells containing the above-mentioned genes, including Escherichia coli cells and Agrobacterium cells.

[0023] The present invention also provides the use of the gene OsNRTF2, at least one of the following: regulating rice yield and nitrogen use efficiency.

[0024] As an improvement to the use of the gene OsNRTF2 of the present invention, the present invention also provides a method for regulating rice yield and nitrogen use efficiency: transforming a knockout vector or an overexpression vector into monocotyledonous plant (e.g., rice) cells, and then cultivating the transformed monocotyledonous plant cells into plants.

[0025] As an improvement to the method of regulating rice yield and nitrogen use efficiency of the present invention:

[0026] Transforming rice cells with the knockout vector pC1300-Cas9-SK5G-OsNRTF2 yielded knockout mutants, which significantly increased rice yield and nitrogen use efficiency.

[0027] Transforming rice cells with the overexpression vector pUbi-OsNRTF2-GFP significantly reduced the yield and nitrogen use efficiency of the transgenic rice.

[0028] The technical solution provided by this invention is as follows:

[0029] The rice nitrogen-responsive transcription factor gene OsNRTF2 of the present invention has the sequences shown in (a) and (b):

[0030] (a) The genomic nucleotide sequence shown in Seq ID No. 1;

[0031] (b) The cDNA and CDS nucleotide sequences shown in Seq ID No. 2 and Seq ID No. 3;

[0032] The Nipponbare genome nucleotide sequence shown in Seq ID No. 1 contains 1393 nucleotides, the Nipponbare cDNA sequence shown in Seq ID No. 2 contains 1143 nucleotides, and the Nipponbare CDS sequence shown in Seq ID No. 3 contains 522 nucleotides (including the terminator TGA).

[0033] Another object of the present invention is to provide a protein encoded by the above-mentioned gene having the sequence shown in (A):

[0034] (A) The amino acid sequence shown in Seq ID No. 4;

[0035] The protein represented by Seq ID No. 4 belongs to the MYB class of transcription factors and has 173 amino acids.

[0036] The present invention also aims to provide a knockout and overexpression vector containing the rice nitrogen-responsive transcription factor gene OsNRTF2, wherein the knockout vector is... Figure 2As shown in Figure A, pC1300-Cas9-SK5G, after gene editing, resulted in a single-base deletion mutation, causing premature termination of OsNRTF2 protein translation in OsNRTF2-KO1 and OsNRTF2-KO2 plants, as shown in Seq ID No. 5 and Seq ID No. 6, leading to the deletion of OsNRTF2-KO1 and OsNRTF2-KO2 proteins; the overexpression vector was... Figure 2 As shown in B, the pUbi-GFP vector can enhance the expression of OsNRTF2. The present invention also aims to provide host cells containing the aforementioned rice gene OsNRTF2, wherein the host cells are Escherichia coli cells, Agrobacterium cells, or plant cells.

[0037] The present invention also includes the use of the above-mentioned OsNRTF2 gene to regulate rice yield and nitrogen use efficiency, including transforming rice cells with a knockout and overexpression vector constructed with the nucleotide sequence shown above-mentioned OsNRTF2, and then cultivating the transformed rice cells into plants.

[0038] The specific technical steps for implementing this invention are as follows:

[0039] I. Screening of candidate genes

[0040] Under hydroponic conditions, seedlings of conventional indica rice varieties Yuefeng B, Xiangzao 143, Zhengui Ai 1, and Zaogui 1 were treated with different nitrogen (NH4NO3) concentrations for one week. RNA-seq sequencing was performed on aboveground and belowground samples of the seedlings to screen for genes that responded to nitrogen gradient regulation in all four indica rice varieties. The results showed that the expression of OsNRTF2 in both the aboveground and belowground parts of all four indica rice varieties decreased with increasing nitrogen concentration. Figure 1 This suggests that OsNRTF2 may regulate nitrogen use in rice.

[0041] II. Functional analysis of the OsNRTF2 gene

[0042] Using transgenic technology, this invention obtained gene knockout and overexpression plants of the OsNRTF2 gene. Figure 2 Compared to wild-type Nipponbare (WT), the two knockout lines, OsNRTF2-KO1 and OsNRTF2-KO2, showed significantly improved per-plant yield and nitrogen use efficiency. Figure 3 The two overexpression lines, OsNRTF2-OE1 and OsNRTF2-OE2, showed significantly reduced yield and nitrogen use efficiency per plant. This result demonstrates that OsNRTF2 negatively regulates rice yield and nitrogen use.

[0043] This invention provides the application of gene editing to knock out or negatively regulate the OsNRTF2 gene in improving crop yield and nitrogen use efficiency in one or more ways. The gene-edited knockout lines showed significantly increased rice yield and nitrogen use efficiency. This invention provides important guidance for breeding new nitrogen-efficient rice varieties and is of great significance for ensuring food security.

[0044] It should be emphasized that there are hundreds of MYB-type transcription factors in rice. The protein sequence identity of OsNRTF2 in this invention with the existing nitrogen use-related MYB transcription factors MYB61 and MYB305 is only 15.2% and 18.6%, respectively. Furthermore, unlike MYB61 and MYB305, which positively regulate nitrogen use, OsNRTF2 negatively regulates rice yield and nitrogen use efficiency. Therefore, the involvement of MYB61 and MYB305 in nitrogen use regulation does not provide any technical inspiration for this invention. Attached Figure Description

[0045] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0046] Figure 1 The response patterns of OsNRTF2 gene expression in four indica rice varieties to NH4NO3 gradient treatment.

[0047] Figure 2 Schematic diagram of the vector and identification of the transgenic molecule. (A) pC1300-Cas9-SK5G knockout vector; (B) pUbi-GFP overexpression vector; (C) Mutations in the edited target site sequence in OsNRTF2-KO1 and OsNRTF2-KO2 knockout plants; (D) Relative gene expression levels of the OsNRTF2 gene in wild-type Nipponbare (WT) and overexpression lines (OsNRTF2-OE1 and OsNRTF2-OE2). Data are expressed as mean ± standard deviation (SD).

[0048] Figure 3 Individual plant yield (A) and agronomic nitrogen use efficiency (B) are presented for wild-type Nipponbare (WT), OsNRTF2 knockout mutants (OsNRTF2-KO1 and OsNRTF2-KO2), and overexpression plants (OsNRTF2-OE1 and OsNRTF2-OE2). Data are expressed as mean ± standard error (SEM). * indicates a significant difference at the P < 0.05 level, and ** indicates a significant difference at the P < 0.01 level. Detailed Implementation

[0049] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0050] Example 1: Candidate gene identification

[0051] 1. Rice materials

[0052] Conventional indica rice varieties include Yuefeng B, Xiangzao 143, Zhengui Ai 1, and Zaogui 1.

[0053] Thoroughly wash the seeds of the above varieties with deionized water and soak them at 30℃ for 36 hours; wrap the seeds in a damp paper towel, place them in a resealable bag, and germinate them at 37℃ in the dark for 24 hours; select seeds with relatively uniform germination vigor and place them in a 96-well PCR plate with a perforated bottom, and culture them in 1 / 2 Yoshida hydroponic nutrient solution (i.e., Yoshida rice nutrient solution) for 2 days, then transfer them to complete Yoshida hydroponic nutrient solution for 7 days; using the nitrogen content of 1.43mM NH4NO3 in complete Yoshida hydroponic nutrient solution as the standard, set up 0N (0mM NH4NO3), 0.1N (0.143mM NH4NO3), and 1N (1.43mM NH4NO3) solutions. Rice seedlings were transferred to modified Yoshida hydroponic nutrient solutions with different nitrogen concentrations (NH4NO3 and 5N, 7.15 mM NH4NO3) and cultured for 7 days under four nitrogen gradients. Total RNA was extracted from the underground and aboveground parts of 12 randomly selected seedlings for each variety and nitrogen level treatment, and RNA-seq sequencing was performed. Throughout the culture process, the pH of the nutrient solution was maintained at approximately 5.8, and the nutrient solution was changed every two days.

[0054] 2. RNA-seq sequencing and candidate gene screening

[0055] High-throughput RNA-seq sequencing was performed using the Illumina NovaSeq platform from PersonalBio (http: / / www.personalbio.cn). Clean reads were aligned to the Minghui 63 reference genome (MH63RS, http: / / rice.hzau.edu.cn / rice_rs2 / ) using HTSeq software. Gene expression was quantified and normalized using HTSeq software and expressed as fragments per kilo bases per million fragments (FPKM). Based on gene expression values, genes that responded to nitrogen gradient regulation in all four indica rice varieties were screened. The results showed that the expression of OsNRTF2 in both the underground and aboveground parts of all four indica rice varieties decreased with increasing nitrogen concentration. Figure 1 ).

[0056] Example 2: Plant Transformation and Functional Analysis

[0057] I. Obtaining OsNRTF2 gene knockout mutants

[0058] 1. OsNRTF2 was knocked out using the pC1300-Cas9-SK5G gene editing vector provided and modified by Wang Kejian's research group at the China National Rice Research Institute. The sequences CGGCGTACCCTGGTCCGAA and CCGGGTCCTGGGACGATAA on the first exon of the OsNRTF2 gene were selected as editing target sites. Figure 2 A). The primer sequences for vector construction are as follows: Target site 1 forward primer OsNRTF2-sgRNA1-F: GGCATTATCGTCCCAGGACCCGG

[0059] Target site 1 reverse primer OsNRTF2-sgRNA1-R: AAACCCGGGTCCTGGGACGATAA

[0060] Target site 2 forward primer OsNRTF2-sgRNA2-F: GGCATTCGGACCAGGGTACGCCG

[0061] Target site 2 reverse primer OsNRTF2-sgRNA2-R: AAACCGGCGTACCCTGGTCCGAA

[0062] Target site identification primer pC1300-F: ACACTTTATGCTTCCGGCTC

[0063] Note: The pC1300-Cas9-SK5G gene editing vector is a modified version of pC1300-Cas9 (Barman 2021; Xiong, et al. 2021). The fragment containing the gRNA expression cassette of the original intermediate vector SK-gRNA, which was double-digested with KpnI-BglII, was pre-ligated into the pC1300-Cas9 vector double-digested with KpnI-BamHI. This is an existing technology.

[0064] 2. Steps for constructing the OsNRTF2 gene knockout vector:

[0065] Preparation of target adapter 1: Take 20 μl of each of 100 μM OsNRTF2-sgRNA1-F and OsNRTF2-sgRNA1-R primers, mix them, incubate in a water bath at 100℃ for 5 minutes, and cool to room temperature to form primer dimers.

[0066] Preparation of target adapter 2: Take 20 μl of each of 100 μM OsNRTF2-sgRNA2-F and OsNRTF2-sgRNA2-R primers, mix them, incubate in a water bath at 100℃ for 5 minutes, and cool to room temperature to form primer dimers.

[0067] Linearization of the expression vector: The pC1300-Cas9-SK5G gene editing vector was digested with the restriction endonuclease AarI (Ferment). The digestion reaction mixture consisted of: 1.5 μg pC1300-Cas9-SK5G plasmid; 5 μL 10×AarI buffer; 1 μL 50×oligonucleotide; 1 μL AarI restriction endonuclease; and ddH2O to a final volume of 50 μL. Digestion was carried out at 37°C for 6 hours, and the digested products were purified using a kit.

[0068] Ligation of target adapter 1 or target adapter 2 with the expression vector: The prepared target adapter 1 or target adapter 2 was ligated to the linearized pC1300-Cas9-SK5G gene editing vector using T4 ligase (NEB). Ligation reaction system: 20 ng linearized pC1300-Cas9-SK5G; 7 μL target adapter 1 / target adapter 2; 1 μL 10×T4 ligase buffer; 0.5 μL T4 ligase; ddH2O to a final volume of 10 μL. Ligation was carried out at 16°C for 1 hour.

[0069] The ligation reaction product was transferred into E. coli DH5α competent cells, and single colonies were picked for sequencing.

[0070] Single colonies containing the OsNRTF2 gene-specific target sequence were screened using primer pC1300-F sequencing, and plasmids were extracted to obtain the recombinant knockout vector pC1300-Cas9-SK5G-OsNRTF2.

[0071] 3. Using Agrobacterium-mediated rice callus infection, the pC1300-Cas9-SK5G-OsNRTF2 vector containing the OsNRTF2 specific target site was transformed into the rice variety Nipponbare. Using the DNA of the transgenic plant as a template, the sequences at both ends of the OsNRTF2 target site were amplified by PCR using knockout identification primers and then sequenced for identification.

[0072] The knockout identification primer sequences are as follows:

[0073] OsNRTF2-CRISPR-F:CGGCATGGATTTGTACGGC

[0074] OsNRTF2-CRISPR-R:GCTGGGAAGAGTTTGTTGGTTT

[0075] DNA was extracted from leaves of wild-type and gene-edited rice lines of Nipponbare using the CTAB method.

[0076] PCR reaction system for identifying mutant transgenic plants: 25 μL 2×Rapid Taq Master Mix (Nanjing Novizan Biotechnology Co., Ltd.); 2 μL DNA from transgenic plant leaves; 1 μL each of primers OsNRTF2-CRISPR-F and OsNRTF2-CRISPR-R at a concentration of 10 μM; 21 μL ddH2O.

[0077] PCR reaction procedure: (1) 95℃, 3 minutes; (2) 98℃, 15 seconds; (3) 58℃, 15 seconds; (4) 72℃, 10 seconds; (5) 72℃, 5 minutes; repeat steps (2)-(4) for 38 cycles.

[0078] By comparing with Nipponbare wild-type Seq ID No. 1, OsNRTF2 gene knockout mutants were obtained. The obtained gene knockout mutants OsNRTF2-KO1 and OsNRTF2-KO2 carry deletion mutations. Figure 2 C), The amino acid sequences of OsNRTF2 in the OsNRTF2-KO1 and OsNRTF2-KO2 gene knockout mutants are shown in Seq ID No. 5 and Seq ID No. 6, respectively.

[0079] II. Obtaining OsNRTF2 gene overexpression lines

[0080] 1. Total RNA extraction and RNA reverse transcription

[0081] Take 50-100 mg of Nipponbare rice seedling leaf samples, freeze them in liquid nitrogen and grind them into powder. Use the Novizan FastPure Universal Plant Total RNA Isolation Kit to extract total RNA according to the instructions.

[0082] Using Mona Bio's MonScript TM The RTllI Super Mix with dsDNase (Two-Step) kit was used to perform reverse transcription of RNA to obtain first-strand cDNA, following the instructions.

[0083] 2. Obtaining the target gene

[0084] Using cDNA synthesized by reverse transcription as a template, the CDS sequence (Seq ID No. 3, stop codon removed) of the Nipponbare OsNRTF2 gene was amplified by PCR using the high-success-rate PCR enzyme KOD FX (TOYOBO), and a recombination adapter for the target expression vector was added. The primer sequences involved are as follows:

[0085] OsNRTF2-F:gtgttatacttctgcaggagctcATGGATTTGTACGGCCGG

[0086] OsNRTF2-R:catggatccggtaccgagctcAGGGGTGGTGATGTCATG

[0087] PCR reaction system: 25 μL 2x PCR buffer for KOD FX; 10 μL 2 mM dNTPs; 1 μL cDNA template; 1.5 μL each of primers OsNRTF2-F and OsNRTF2-R at a concentration of 10 μM; 1 μL KOD FX; 10 μL ddH2O.

[0088] PCR reaction procedure: (1) 94℃, 2 minutes; (2) 98℃, 10 seconds; (3) 58℃, 30 seconds; (4) 68℃, 40 seconds; (5) 68℃, 5 minutes; repeat steps (2)-(4) for 35 cycles.

[0089] PCR products were purified using the Easy Gel Extraction & Clean-up Kit (EASDE) agarose gel extraction kit.

[0090] 3. Construction of overexpression recombination vectors

[0091] Linearization of the expression vector: The pUbi-GFP expression vector (Wen, et al. 2023) was digested with the restriction endonuclease SacI (NEB). Digestion reaction system: 1.5 μg pUbi-GFP plasmid; 10× rCutSmart... TM Buffer 5 μl; SacI restriction endonuclease 1 μl; ddH2O to 50 μl. Digest at 37℃ for 6 hours, and purify the digested product using the kit.

[0092] OsNRTF2 gene CDS sequence recombination and ligation with expression vector: Using the Novizan ClonExpress II One Step Cloning Kit, the OsNRTF2 CDS with recombination adapter (without stop codon) was recombinated and ligated with the linearized pUbi-GFP expression vector.

[0093] Recombination ligation reaction system: linearized pUbi-GFP 30 ng; OsNRTF2 CDS with recombination adapter (SeqID No. 3, stop codon removed) 100 ng; 5×CE II Buffer 2 μL; Exnase II 1 μL; ddH2O to 10 μL. Incubate at 37 °C for 30 min, then immediately cool on ice.

[0094] The product of the above recombination ligation reaction was transformed into E. coli DH5α competent cells, single colonies were picked and sequenced, and plasmids with correct sequencing results were extracted to obtain the recombinant overexpression vector pUbi-OsNRTF2-GFP.

[0095] 4. The recombinant overexpression vector pUbi-OsNRTF2-GFP was transformed into the rice variety Nipponbare using Agrobacterium-mediated rice callus infection. The cDNA from the leaves of the positive transgenic plants that survived the conventional hygromycin screening was used as a template. The OsNRTF2 overexpressing plants were screened by qRT-PCR using the Novizan Taq Pro Universal SYBR qPCR Master Mix kit.

[0096] The primer sequences for qRT-PCR identification are as follows:

[0097] qOsNRTF2-F:GGGTCCTGGGACGATAACGA

[0098] qOsNRTF2-R:CCGTACCTGTCCAACCCCTC

[0099] The qRT-PCR internal control primer sequences are as follows:

[0100] qActin-F:ATCAATCCTTGCATCTCTGAGC

[0101] qActin-R: TAGAGCACTTCCTGTGGACGAqRT-PCR reaction system: 7.5 μL 2×Taq ProUniversal SYBR qPCR Master Mix; 3 μL 10-fold diluted cDNA template; 0.3 μL each of 10 μM forward and reverse primers; 3.9 μL ddH2O.

[0102] qRT-PCR reaction procedure: (1) 95℃, 2 minutes; (2) 95℃, 10 seconds; (3) 60℃, 15 seconds; repeat steps (2)-(3) for 42 cycles.

[0103] According to 2 -ΔCT The relative expression levels of the target gene OsNRTF2 in wild-type and overexpressing plants were calculated and compared. For example... Figure 2 As shown in Figure D, the relative expression levels of OsNRTF2 in the OsNRTF2-OE1 and OsNRTF2-OE2 overexpression lines were 11.8 times and 13.8 times that of wild-type Nipponbare, respectively.

[0104] III. Field survey of yield per plant and agronomic nitrogen use efficiency of OsNRTF2 gene knockout mutants and overexpression lines

[0105] The yield per plant of OsNRTF2 gene knockout mutants and overexpression lines was determined in a transgenic nursery in Fuyang, Hangzhou. Agronomic nitrogen use efficiency is defined as the ratio of plant yield per unit area to nitrogen application rate (Chen, et al. 2016). The results showed that the single-plant yield and agronomic nitrogen use efficiency of the knockout mutants OsNRTF2-KO1 and OsNRTF2-KO2 were significantly increased. Figure 3 Compared to wild-type Nipponbare (A and 3B), the expression levels increased by 14.8% and 31.6%, respectively. Conversely, the overexpression lines of OsNRTF2-OE1 and OsNRTF2-OE2 showed significantly decreased yield per plant and agronomic nitrogen use efficiency. Figure 3 Compared to wild-type Nipponbare (A and 3B), the levels of nitrogen used were reduced by 26.2% and 38.3%, respectively. Given that OsNRTF2 gene expression is suppressed by nitrogen, these results suggest that OsNRTF2 negatively regulates nitrogen use efficiency and yield.

[0106] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. A method for improving rice yield and nitrogen use efficiency, characterized in that: Utilizing OsNRTF2 The gene knockout vector pC1300-Cas9-SK5G-OsNRTF2 was transformed into Nipponbare cells to obtain... OsNRTF2 Mutant plants with gene loss of function, wherein the mutant plants have increased rice yield and nitrogen use efficiency; OsNRTF2 The nucleotide sequence of the gene is shown in SEQ ID No. 1; the knockout vector pC1300-Cas9-SK5G-OsNRTF2 targets... OsNRTF2 The gene is constructed by inserting the sgRNA target sequence 5'-CCGGGTCCTGGGACGATAA-3' or 5'-CGGCGTACCCTGGTCCGAA-3' of the first exon of the gene between the AarI-AarI restriction sites of the basic vector pC1300-Cas9-SK5G.

2. The method according to claim 1, characterized in that: The vector pC1300-Cas9-SK5G-OsNRTF2 was knocked out. OsNRTF2 -KO1 or OsNRTF2 The amino acid sequences of OsNRTF2 in the -KO2 plant are shown in SEQ ID No. 5 or SEQ ID No. 6, respectively.

Images