Sugarcane ScHAT1 gene, protein and application

Through the research and application of the sugarcane ScHAT1 gene, its expression level is regulated, and the problems of disease resistance, salt resistance and drought resistance in the sugarcane industry are solved, and the resistance of plants and E. coli are improved.

CN119859645BActive Publication Date: 2025-08-19SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510325119.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-19
Publication Date
2025-08-19
Estimated Expiration
2045-03-19

AI Technical Summary

Technical Problem

The sugarcane industry is facing problems such as sputum, salt stress and drought stress, and the existing technology is difficult to effectively improve its disease resistance, salt resistance and drought resistance.

Method used

By studying and utilizing sugarcane ScHAT1 gene and protein, constructing by PCR amplification, cloning and recombinant vectors, the ScHAT1 gene was introduced into plants and E. coli, and its expression was regulated to improve disease resistance, salt resistance and drought resistance.

Benefits of technology

It has successfully improved the disease resistance of sugarcane and tobacco, enhanced the salt stress and drought stress tolerance of E. coli, and provided theoretical basis and practical guidance for sugarcane breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119859645B_ABST
    Figure CN119859645B_ABST
Patent Text Reader

Abstract

The present invention provides a sugarcane ScHAT1 Genes, proteins and applications thereof, belonging to the field of biotechnology, and specifically disclosing sugarcane ScHAT1 The application of genes in disease resistance, salt resistance and drought resistance. ScHAT1 Preliminary research has been conducted on responses to biotic and abiotic stresses, laying a solid foundation for in-depth research on the function and mechanism of action of this gene in the process of sugarcane responding to pathogen stress and abiotic stress.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, relates to plant genetically modified biotechnology breeding, and particularly relates to a sugarcane ScHAT1 Genes, proteins and applications. Background Art

[0002] sugar cane( Saccharum spp. Sugarcane is one of the most important sugar crops in the world. It belongs to the monocotyledonous grass family C4 plant and is widely used in the production of sugar, ethanol, biofuel and fiber products. The sugarcane industry is not only related to national sugar security, but also has an important impact on agricultural economic development. However, sugarcane production faces a variety of disease threats, including the whip powder fungus ( Sporisorium scitamineum ) is one of the most destructive diseases worldwide. It can severely reduce sugarcane yield and sugar content, shorten ratoon life, increase production costs, and even lead to crop failure in severe cases, becoming a major bottleneck restricting the development of the sugarcane industry. Since the planting of the highly susceptible Taiwan sugarcane variety New Taiwan Sugar 22, the prevalence of smut has intensified in my country's major sugarcane-producing areas. In recent years, the main cultivated varieties Guitang 42 and Liucheng 05-136 have also shown high susceptibility to the disease, making the need to cultivate disease-resistant varieties even more urgent. Breeding disease-resistant varieties is the most cost-effective strategy for controlling smut, and the discovery and identification of disease-resistance-related proteins and genes is key to achieving this goal.

[0003] Post-translational modification (PTM) of proteins is widely involved in biological processes such as gene expression regulation, DNA damage repair, cell division, and signal transduction. Acetylation, a key PTM, directly influences chromatin structure and gene transcription. In eukaryotes, histone acetyltransferases (HATs) and histone deacetylases (HDACs) catalyze acetylation and deacetylation, respectively. Acetylation of histones reduces their positive charge, weakening their binding to DNA and promoting nucleosome disassembly, thereby promoting gene transcription and being crucial for biological growth and development. HATs play a key regulatory role in plant responses to abiotic stresses (such as light, temperature, and salt) and biotic diseases. For example, in Arabidopsis thaliana, AtHAC1 regulates flowering by epigenetically modifying upstream factors of Flowering Locus C (FLC), and its absence leads to developmental defects such as delayed flowering. In addition, GCN5 maintains the position of root stem cells by regulating the expression of PLETHORA (PLT) genes and promotes the division and proliferation of root transition amplification cells to maintain the normal development of root meristem. OsHAG702 、 OsHAG703and OsHAM701 The expression of HAT family members in wheat indicates that HAT plays an important role in abiotic stress response. TaHAG1 Through with TaNACL Interaction, regulation TaG1 and TaPSBR1 to enhance heat tolerance and improve tolerance to heat stress. TaHAG1 By regulating transduction genes TaPAD4 The expression of HATs promotes the accumulation of salicylic acid (SA) and reactive oxygen species (ROS), thereby enhancing wheat resistance to powdery mildew (Blumeria graminis, Bgt). These studies indicate that HATs play an important regulatory role in plant responses to abiotic stresses (such as light, temperature, and salt) and biotic diseases. Summary of the Invention

[0004] In view of the above problems, the present invention provides a sugarcane ScHAT1 Genes, proteins and applications.

[0005] A kind of sugarcane ScHAT1 gene, the ScHAT1 The coding sequence of the gene and ScHAT1 The open reading frame of the gene is SEQ ID NO: 1, and its open reading frame (ORF) is 1332 bp; ScHAT1 The gene coding sequence and its upstream and downstream sequences are shown in SEQ ID NO: 3;

[0006] ScHAT1 The gene is associated with at least one of disease resistance, salt resistance and drought resistance.

[0007] A ScHAT1 protein with disease resistance, wherein the ScHAT1 protein is ScHAT1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 2.

[0008] A primer pair, the primer pair is used for PCR amplification of the above ScHAT1 gene, the primer pair comprising:

[0009] ScHAT1 -F:5'- GGTCCCACAAGTCATCCG -3';

[0010] ScHAT1 -R:5'- GGTTATGGTTCTTTCGCTTT -3';

[0011] Specifically, the PCR amplification is performed using sugarcane cDNA as a template; ScHAT1The cDNA sequence of the gene is shown in SEQ ID NO: 4;

[0012] Among them, the reaction system of PCR amplification is:

[0013]

[0014] The reaction procedure for PCR amplification is:

[0015] .

[0016] A kind of ScHAT1 A plasmid containing a gene ScHAT1 The plasmid of the gene was constructed using the above ScHAT1 The gene is obtained by connecting it to a cloning vector;

[0017] Said inclusion ScHAT1 The plasmid of the gene is pEASY-Blunt Zero- ScHAT1 plasmid.

[0018] A kind of ScHAT1 A recombinant vector of a gene, comprising ScHAT1 The recombinant vector of the gene is a ScHAT1 The PCR amplification product of the gene or ScHAT1 The plasmid of the gene was obtained by ligating it with the pDONR-207 vector, the subcellular localization vector pFAST-R05-GFP, the pGBKT7 vector, the plant expression vector pEarleyGate203, or the prokaryotic vector pEZYHb;

[0019] described ScHAT1 The coding sequence of the gene is shown in SEQ ID NO: 1.

[0020] A kind of ScHAT1 strain containing a gene ScHAT1 The strain containing the gene ScHAT1 Agrobacterium containing genes ScHAT1 Yeast containing genes ScHAT1 Gene of Escherichia coli;

[0021] Said inclusion ScHAT1 The Agrobacterium tumefaciens gene is the one mentioned above containing ScHAT1 The recombinant vector of the gene is transformed into Agrobacterium to obtain;

[0022] The method comprising transforming into Agrobacterium ScHAT1 The recombinant vector of the gene is a ScHAT1 The PCR amplification product of the gene or ScHAT1The plasmid of the gene was obtained by ligating it with the pDONR-207 vector, the subcellular localization vector pFAST-R05-GFP, or the plant expression vector pEarleyGate203;

[0023] Said inclusion ScHAT1 The yeast of the gene is used to ScHAT1 The recombinant vector of the gene is transformed into yeast;

[0024] The method comprising transforming into yeast ScHAT1 The recombinant vector of the gene is a ScHAT1 The PCR amplification product of the gene or ScHAT1 The plasmid of the gene was connected with the pGBKT7 vector to obtain.

[0025] Said inclusion ScHAT1 The Escherichia coli containing the gene is used ScHAT1 The recombinant vector of the gene or the above-mentioned ScHAT1 The plasmid of the gene was transformed into Escherichia coli to obtain;

[0026] The said transformed into Escherichia coli comprises ScHAT1 The recombinant vector of the gene is a ScHAT1 The PCR amplification product of the gene or ScHAT1 The plasmid of the gene was connected with the prokaryotic expression vector pEZYHb to obtain.

[0027] One of the above ScHAT1 The application of genes in improving disease resistance is to ScHAT1 The gene is used in sugarcane or tobacco to improve disease resistance; specifically, the application is to reduce ScHAT1 Gene expression to improve disease resistance.

[0028] One of the above ScHAT1 The application of genes in salt resistance and / or drought resistance is to ScHAT1 Genes are used in sugarcane to improve salt and / or drought resistance; specifically, the application is to overexpress in sugarcane ScHAT1 genes to improve salt and / or drought tolerance;

[0029] The application is to ScHAT1 The gene is used in Escherichia coli to improve salt resistance and / or drought resistance; specifically, the application is to overexpress in Escherichia coli ScHAT1 Genes to improve salt and / or drought tolerance.

[0030] A method for breeding plants with disease resistance by reducing the ScHAT1 Gene expression levels to obtain disease-resistant sugarcane;

[0031] By reducing tobacco ScHAT1 Gene expression levels to obtain tobacco with disease resistance;

[0032] described ScHAT1 The coding sequence of the gene is shown in SEQ ID NO: 1.

[0033] A method for breeding salt- and / or drought-resistant sugarcane by overexpressing ScHAT1 Gene expression levels to obtain sugarcane with salt and / or drought resistance;

[0034] By overexpressing Escherichia coli ScHAT1 Gene expression levels to obtain Escherichia coli with salt and / or drought resistance;

[0035] described ScHAT1 The coding sequence of the gene is shown in SEQ ID NO: 1.

[0036] Sugarcane of the present invention ScHAT1 The beneficial effects of genes, proteins and applications are:

[0037] HAT genes play an important role in the interaction between plants and pathogens. ScHAT1 The preliminary research on the response to biotic and abiotic stresses has laid a solid foundation for in-depth study of the function and mechanism of this gene in the sugarcane response to pathogenic and abiotic stresses.

[0038] The present invention is carried out by ScHAT1 Research on genes helps to understand the mechanisms of sugarcane's disease resistance, salt resistance, and drought resistance, and provides a theoretical basis and reference for inducing plants to have disease resistance, salt resistance, and drought resistance using genetic engineering techniques.

[0039] The present invention is constructed by ScHAT1 Plant expression recombinant vector and containing ScHAT1 Agrobacterium tumefaciens successfully ScHAT1 The gene was introduced into heterologous Nicotiana benthamiana and analyzed ScHAT1 The disease resistance function of the gene in Nicotiana benthamiana; the results showed that by reducing ScHAT1 Gene expression can improve disease resistance; therefore, the present invention discloses ScHAT1 The gene has important application value not only in improving the disease resistance of native sugarcane, but also in heterologous Nicotiana benthamiana.

[0040] The present invention is constructed by ScHAT1 Genetic analysis of Escherichia coli ScHAT1 The gene has salt and drought resistance functions in Escherichia coli; the results showed that overexpressionScHAT1 Can improve the salt stress and drought stress tolerance of Escherichia coli, that is, overexpression ScHAT1 Can improve salt resistance and drought resistance; Therefore, the present invention discloses ScHAT1 Genes not only have important application value in improving disease resistance, but can also be used to improve salt resistance and drought resistance;

[0041] The present invention is carried out by ScHAT1 Gene research found ScHAT1 The gene was expressed in different tissues of sugarcane, with the highest expression in sugarcane leaves, followed by sugarcane peel, indicating that ScHAT1 The gene is constitutively expressed in sugarcane. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 In Example 1 of the present invention ScHAT1 Gene expression profiles; Figure 1 Figure A in the figure is ScHAT1 Figure B shows the expression level of genes in different tissues of sugarcane; Figure B shows the expression level of genes in the resistant variety (YT93-159) and the susceptible variety (Xintaitang No. 22) under the stress of smut fungus. ScHAT1 Gene expression changes; Figure C is ScHAT1 Gene expression diagram under salicylic acid stress; Figure D is ScHAT1 Gene expression diagram under jasmonic acid stress; among them, the internal reference gene is GAPDH The Duncan new multiple range method was used to calculate the significant difference of the data (p-value < 0.05), and the data were expressed in lowercase letters. All data points are mean ± standard error (n = 3).

[0043] Figure 2 is a diagram of the conserved domain of the ScHAT1 protein in Example 3 of the present invention;

[0044] Figure 3 This is a diagram comparing the homologous sequences of the ScHAT1 protein in Example 3 of the present invention with those in other species;

[0045] Figure 4 is a phylogenetic tree of the ScHAT1 protein in Example 3 of the present invention and homologous sequences in other species;

[0046] Figure 5 The recombinant plasmid pDONR-207- ScHAT1 Carrier map;

[0047] Figure 6 The recombinant plasmid pFAST-R05- ScHAT1 -GFP vector map;

[0048] Figure 7 The subcellular localization of the ScHAT protein in Nicotiana benthamiana leaves in Example 3 of the present invention;

[0049] Figure 8 The recombinant plasmid pGBKT7- ScHAT1 Carrier map;

[0050] Figure 9 The sugarcane in Example 4 of the present invention ScHAT1 Analysis of gene transcription self-activation activity; the left picture shows the screening results on the SD / -Leu / -Trp with Agar screening plate; the right picture shows the screening results on the SD / -Ade / -His / -Leu / -Trp with Agar screening plate; Figure 10 -1 , 10 -2 , 10 -3 , 10 -4 Different concentrations of pGBKT7-Lam+pGADT7-T, pGBKT7-53+pGADT7-T and pGBKT7- ScHAT1 +pGADT7; DDO represents leucine and tryptophan auxotrophic medium (i.e., SD / -Leu / -Trp with Agar medium); QDO represents leucine, tryptophan, histidine, and adenine auxotrophic medium (i.e., SD / -Ade / -His / -Leu / -Trp with Agar medium);

[0051] Figure 10 The recombinant plasmid pEarleyGate203- ScHAT1 Carrier map;

[0052] Figure 11 In Example 5 of the present invention ScHAT1 Transient expression profile of genes in Nicotiana benthamiana leaves; Figure 11 Figure A in the middle is pEarleyGate 203- ScHAT1 Schematic diagram of the recombinant vector. Figure B shows the disease phenotype and DAB staining of tobacco leaves inoculated with Ralstonia solanacearum on day 0 and day 8. Figure C shows the expression of seven immune-related marker genes in tobacco leaves inoculated with Ralstonia solanacearum on day 0 and day 8. The internal reference gene is NbEF-1α Gene, all data points represent mean ± standard error (n = 3), lowercase letters indicate significant differences calculated using Duncan's new multiple range method (p-value < 0.05);

[0053] Figure 12 The recombinant plasmid pEZYHb- [[ID= Carrier map;

[0054] ​ The prokaryotic expression of the ScHAT1 protein in Example 6 of the present invention and its plate stress verification under abiotic factor treatment; ​ Figure A is the SDS-PAGE test result. In Figure A, M represents protein marker, 1 represents uninduced E. coli BL21 empty bacteria, 2 represents uninduced pEZYHb-BL21 empty bacteria, 3 represents uninduced pEZYHb- ​ -BL21 recombinant strain, 4 to 7 represent pEZYHb-induced for 2, 4, 6, and 8 hours, respectively. ​ -BL21 recombinant strain, 8 represents the empty E. coli BL21 bacteria induced for 12 hours, 9 represents the empty pEZYHb-BL21 bacteria induced for 12 hours, 10; pEZYHb- ​ -BL21 recombinant strain; Figure B shows sugarcane under different abiotic stresses (NaCl and D-Mannitol). ​ Stress tolerance of genes in E. coli cells; Figure B shows 10 -3 , 10 -4 Indicates that the bacterial solution concentration is diluted 10 -3 and 10 -4 Each concentration point was replicated 4 times. DETAILED DESCRIPTION

[0055] The technical solutions in the embodiments of the present invention are described clearly and completely below. Many specific details are set forth in the following description to facilitate a full understanding of the present invention. However, the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without departing from the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below. The present invention is further described in detail below in conjunction with specific embodiments to facilitate understanding by those skilled in the art.

[0056] In the examples disclosed below, if specific techniques or conditions are not specified, the experiments were performed according to those described in literature in the field (e.g., Molecular Cloning: A Laboratory Manual, 3rd edition, by Sambrook et al., translated by Huang Peitang et al., Science Press) or according to the product instructions. Reagents used without manufacturer's information are commercially available.

[0057] Plant materials: A smut-resistant sugarcane variety (YT93-159), a smut-susceptible sugarcane variety (Xintaitang 22), and wild-type Nicotiana benthamiana were provided by the Fujian Key Laboratory of Sugarcane Biology and Genetic Breeding, Ministry of Agriculture and Rural Affairs, Fujian Agriculture and Forestry University. Wild-type Nicotiana benthamiana (WT) was grown in an incubator at 25°C under a 16 h / 8 h light / dark cycle.

[0058] Vectors: pEASY®-Blunt Zero, pDONR-207, pFAST-R05-GFP, pGADT7, pGBKT7, pEarleyGate203, and pEZYHb.

[0059] Strains: Escherichia coli strain DH5α, yeast strain Y2Hgold, Agrobacterium strain GV3101 and Escherichia coli strain BL21 (DE3).

[0060] Main reagents: High-fidelity enzyme (2×Phanta Flash Master Mix, #P510), blue universal dye qPCR detection kit (ChamQ Blue Universal SYBR qPCR Master Mix, #Q312), Hifair® Ⅲ1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) (#11141ES60), and acetosyringone (AS, #60326ES03) were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.; MagZol™ Reagent (#R4801-01), agarose gel DNA recovery kit (#D2110-03), and plasmid extraction kit (#P1001-03C) were purchased from Guangzhou Meiji Biotechnology Co., Ltd.; Gateway™ BP Clonase™ II enzyme mixture (#11789020) and Gateway™ LR Clonase™ II enzyme mixture (#11791020), restriction enzymes FastDigestEcoRI (#FD0274), and FastDigest BamHI (#FD0054) were purchased from Thermo Fisher Scientific; 2-(N-morpholino)ethanesulfonic acid monohydrate (MES, #A610341) and magnesium chloride hexahydrate (MgCl2, #A610328) were purchased from Sangon Biotech (Shanghai) Co., Ltd.; SD / -Leu / -Trp with Agar (#PM2222), SD / -Leu / -Trp Broth (#PM2221), and SD / -Ade / -His / -Leu / -Trp with Agar (#PM2112) were purchased from Beijing Coolaibo Technology Co., Ltd.; 3,3'-Diaminobenzidine tetrahydrochloride (3,3'-Diaminobenzidine tetrahydrochloride) Tetrahydrochloride (DAB, #D807420) was purchased from Shanghai MacLean Biochemical Technology Co., Ltd.

[0061] All primers involved in the present invention were designed using SnapGene and Primer Premier 5 software and sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis.

[0062] Example 1 ​ Gene expression patterns

[0063] 1) Material handling

[0064] Sugarcane buds (YT93-159 and New Taiwan Sugar No. 22) were inoculated with Ustilago smut according to the method of Su Yachun et al. (Transcriptome and Proteome Studies of Sugarcane Response to Ustilago smut Infection and Discovery of Resistance-Related Genes). Bud samples were collected 0, 1, 2, 3, 4, and 5 days after inoculation. Specifically, healthy, 10-month-old plants were selected from the field, cut into single bud segments, and placed in a 32°C incubator for germination. After the buds grew to 2–3 cm, buds of uniform growth were selected and inoculated with a mixed spore suspension of Ustilago smut (5×10 6 Each time point was set up with 3 biological replicates, and 3 sugarcane buds were taken for each replicate. The treated samples were quickly frozen in liquid nitrogen and stored in a -80℃ refrigerator for future use. ​ Detection of gene expression.

[0065] 2) RNA extraction and RT-qPCR analysis

[0066] RNA was extracted from sugarcane and Nicotiana benthamiana plants using MagZol™ Reagent (#R4801-01) and then reverse transcribed into cDNA using the Hifair® Ⅲ 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) (#11141ES60) instructions. cDNA was then used as a template for subsequent gene expression assays.

[0067] Designed using Primer Premier 5 software ​ Specific quantitative primers (primer pair: Q- ​ -F / R), the internal reference gene of sugarcane is glyceraldehyde-3-phosphate dehydrogenase ( ​ ), (Primer pair: ​ -F / R), the internal reference gene of Nicotiana benthamiana is ​ (Primer pairs: ​ ) See Table 1 for details.

[0068] Table 1 Primers for RT-qPCR analysis and identification

[0069]

[0070] 3) Gene expression pattern analysis

[0071] Healthy plants of the mature sugarcane cultivar New Taiwan Sugar No. 22 were selected, and five tissues, including sugarcane buds, leaves, roots, pith and peel, were collected. RNA was extracted and then cDNA was synthesized to detect the tissue specificity of the target gene.

[0072] Using sugarcane cDNA samples at different time points after SA and MeJA treatment as templates, the expression of target genes under hormone stress was detected according to the method of Wang et al. (Identification and characterization of WAK gene family in saccharum and the negative roles of ScWAK1 under the pathogen stress).

[0073] The cDNA of sugarcane with different genotypes inoculated with Ustilago smut was used as template to detect the expression of target genes under Ustilago smut stress. ​ The gene expression was detected by referring to the instructions of the blue universal dye qPCR detection kit (ChamQ Blue UniversalSYBR qPCR Master Mix, #Q312). -ΔΔCt The data were processed using the GraphPad Prism 10 software.

[0074] The results of qRT-PCR analysis showed that ​ The relative expression level of the gene in the sugarcane leaves of Xintaitang No. 22 was the highest, about 13.7 times that in the sugarcane roots. The gene expression levels in the sugarcane peel, sugarcane pith, sugarcane buds and sugarcane roots were the second highest, and the differences among the four were not significant (see ​ Figure A in Figure 1), which shows ​ The gene is constitutively expressed in sugarcane Xintaitang No. 22. ​ The relative expression of the gene increased with the increase of infection time. At the seventh day of infection, its expression level was about 3.29 times that of the control. ​ The relative expression of the gene was down-regulated after infection and gradually returned to the initial level and increased slightly until the late infection period (see ​ Figure B). This shows ​ The gene may play a negative regulatory role in the infection process of black smut fungus, and its up-regulation promotes disease susceptibility. After treatment with salicylic acid (SA) and methyl jasmonate (JA), ​ The expression of the genes showed a similar pattern of first decreasing at 12 h, then increasing to 0.46 times the original level at 3 h after SA treatment compared with the control, and then returning to the initial level at 24 h. This suggests that the gene may be inhibited by SA and JA (see ​ C and D in Figure 5).

[0075] Example 2 ​Gene cloning

[0076] 1) Based on the genome annotation information of sugarcane cultivar R570, cloning primers were designed using SnapGene software ​ -F / R, see the table below.

[0077] Table 2 Cloning primers ​ -F / R

[0078]

[0079] 2) Using sugarcane leaf cDNA as template, PCR amplification was performed according to the instructions of high-fidelity enzyme (2×Phanta Flash Master Mix, #P510). ​ The cDNA sequence of the gene is shown in SEQ ID NO:4.

[0080] Table 3 PCR reaction system

[0081]

[0082] Table 4 PCR reaction procedure

[0083]

[0084] The ligation system was incubated at 25°C for 15 min.

[0085] 3) Detect the PCR product by electrophoresis on 1.5% agarose gel and recover the target band (i.e. ​ gene); among which, ​ The coding sequence of the gene and ​ The open reading frame of the gene is SEQ ID NO: 1, and its open reading frame (ORF) is 1332 bp; ​ The gene coding sequence and its upstream and downstream sequences are shown in SEQ ID NO: 3 (PCR amplification primers were designed based on the upstream and downstream sequences) ​ -F / R);

[0086] 4) Ligate the recovered product into the cloning vector pEASY®-Blunt Zero. Refer to the pEASY®-Blunt Zero Cloning Kit instructions for specific ligation methods.

[0087] 5) Transform the ligation product into E. coli strain DH5α and spread on LB (Kan + 50 mg / L) plates;

[0088] 6) Culture overnight at 37°C incubator, pick colonies from the plate, identify them by PCR, select colonies with correct bands, and send them to Fuzhou Shangya Biotechnology Co., Ltd. for sequencing;

[0089] 7) Use a plasmid extraction kit to extract the plasmid from the colony with the correct sequencing. The resulting plasmid is pEASY-BluntZero- ​ The plasmid was stored at -20°C and used in subsequent experiments.

[0090] Example 3 ​ Gene sequence analysis and subcellular localization studies

[0091] 1) Bioinformatics analysis

[0092] Using sugarcane leaf cDNA as template, we cloned ​ In order to explore the CDS sequence of the gene ​ To determine the biological function of a gene, we first analyze its sequence characteristics. ​ The ORF of the gene is 1332 bp long and encodes 443 amino acids. The amino acid sequence of the ScHAT1 protein is shown in SEQ ID NO: 2. The protein has a molecular weight of 50.5 kDa and an isoelectric point of 7.21, suggesting that it is a neutral protein. Furthermore, the protein's instability coefficient and average hydrophobicity are 38.37 and -0.578, respectively. With an instability coefficient of less than 40 and an average hydrophobicity of less than 0, the ScHAT1 protein is presumed to be a stable, hydrophilic protein. Subcellular localization prediction results indicate that ScHAT1 is localized in the cell nucleus.

[0093] The domain structure of the ScHAT1 protein was predicted using the NCBI Conserved Domain Search online website (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi). Homologous sequences of candidate interacting proteins in other species were retrieved using the BLAST tool available on the NCBI website, and multiple sequence alignments were performed using DANMAN software. The subcellular localization of HAT proteins was predicted and analyzed using WoLF PSORT. A phylogenetic tree was constructed using Neighbor-Joining in MEGA11 software.

[0094] The results of conserved domain analysis showed that ScHAT1 protein has a PLN00104 domain at position 3~443aa (see ​The BLAST tool of NCBI retrieved that the amino acid sequence similarities of ScHAT1 with maize (Zea mays, NP_001105074.1), sorghum (Sorghum bicolor, XP_002463217.1), rice (Oryza brachyantha, XP_006657984.2), wheat (Triticum aestivum, XP_044455776.1), pineapple (Ananas comosus, XP_020100762.1) and Arabidopsis thaliana (Arabidopsis thaliana, NP_201266.1) were 99.77%, 99.1%, 96.88%, 94.58%, 97.69% and 89.12%, respectively (see ​ The phylogenetic tree of ScHAT1 protein and the above 7 proteins was constructed, and the results showed that it was clustered into the same cluster with the genes of maize and sorghum (see ​ ), indicating that they are more closely related and may have diverged later.

[0095] 2) Subcellular localization analysis

[0096] Use Primer 5 software to design Gateway entry vector primers pDONR-207- ​ (See Table 5). ​ The plasmid was used as a template for PCR amplification and purification, and the ​ The gene was connected to the pDONR-207 vector and transformed into DH5α. The positive recombinant plasmid pDONR-207- ​ (See ​ ). Then insert the entry vector pDONR-207- ​ LR reaction was carried out with the subcellular localization vector pFAST-R05-GFP to construct the overexpression recombinant vector pFAST-R05- ​ -GFP (see ​ The plant expression recombinant vector sequenced correctly by Fuzhou Shangya Biotechnology Co., Ltd. was transformed into Agrobacterium GV3101 for infection of Nicotiana benthamiana in the next step.

[0097] Table 5. List of Gateway entry vector primer sequences

[0098]

[0099] Table 6 BP reaction system

[0100]

[0101] The subcellular localization vector pFAST-R05-GFP (as a control group 35S::GFP) and the recombinant vector pFAST-R05- ​ -GFP (as the experimental group 35S:: ​ ::GFP) were transformed into Agrobacterium strain GV3101 and spread on LB resistance plates (spectinomycin 50 µg / mL and rifampicin 50 µg / mL). After culturing in a 28°C incubator for 2 days, single clones on the plates were picked and placed in 1 mL of LB liquid medium (spectinomycin 50 µg / mL and rifampicin 50 µg / mL) and cultured overnight. 200 µL of the positive bacterial solution tested by PCR was selected and added to a new 10 mL of LB liquid medium (spectinomycin 50 µg / mL and rifampicin 50 µg / mL), and cultured overnight in a 28°C shaker at 250 rpm. The bacteria were collected by centrifugation and washed twice with infection solution (10 mM MES, 10 mM MgCl2 and 200µM acetosyringone), and then the OD value of the bacterial solution was adjusted. 600 ≈0.6, use a 1mL sterile syringe to inject the back of the tobacco leaf. After incubation at room temperature for 2 days, cut 1cm 2 Slides were made from tobacco leaves and observed and photographed under a laser confocal microscope (Leica TCS SP8, Leica Microsystems (Shanghai) Trading Co., Ltd.).

[0102] The subcellular localization of ScHAT1 protein was observed using laser confocal microscopy. ​ , the control group 35S::GFP (green fluorescent protein gene followed by ​ No fluorescence was observed after Agrobacterium-mediated transformation and transient expression in Nicotiana benthamiana leaves, while in the experimental group 35S:: ​ ::GFP green fluorescence was observed in the nuclei of the lower epidermal cells of the leaves. Combined with the previous prediction results of the WoLF PSORT subcellular localization program, this result is consistent with the prediction results, indicating that the ScHAT1 protein is localized in the nucleus.

[0103] Example 4 Analysis of transcriptional autoactivation activity

[0104] To detect ​ Whether it has transcriptional self-activation activity, ​ Constructed into vector pGBKT7 to form expression vector pGBKT7- ​ , the specific construction method is as follows:

[0105] 1) Linearize the pGBKT7 vector using EcoRI and BamHI restriction sites.

[0106] 2) Design pGBKT7 vector adapter primers using SnapGene software ​ -F / R (see Table 7);

[0107] 3) Using the pEASY-Blunt Zero- ​ The plasmid was used as a template, and the reaction system was set up according to the instructions of the ligase-independent single-fragment one-step cloning kit (ClonExpress II One Step Cloning Kit, #C112-01) (see Table 8), and the reaction was carried out at 37°C for 30 min;

[0108] 4) Transform the ligation product obtained above into Escherichia coli DH5α and culture on LB solid medium (kanamycin 50 mg / L) in a 37°C incubator overnight;

[0109] 5) Single clones were picked for PCR detection and sequencing analysis (Fuzhou Shangya Biotechnology Co., Ltd.);

[0110] 6) The bacterial suspension with the correct sequencing results was extracted according to the instructions of the plasmid extraction kit (#P1001-03C) to obtain the recombinant vector pGBKT7- ​ (See ​ ).

[0111] Table 7 pGBKT7 vector linker primers pGBKT7- ​ Sequence List

[0112]

[0113] Table 8 One-step cloning reaction system

[0114]

[0115] The constructed recombinant vector pGBKT7- ScHAT1 Yeast strain Y2Hgold (as the experimental group) was co-transformed with the pGADT7 empty plasmid and plated onto SD / -Leu / -Trp with Agar selection plates. The plates were cultured in a 28°C incubator for 3 days. Single colonies were picked and cultured in SD / -Leu / -Trp Broth liquid medium at 28°C with a shaker at 250 rpm overnight. 10 µL of the bacterial suspension was diluted in 90 µL of ddH2O and diluted tenfold in three steps, resulting in four yeast suspensions (10 -1 , 10 -2 , 10 -3 and 10 -410 µL of each bacterial suspension was placed on SD / -Leu / -Trp with Agar medium and SD / -Ade / -His / -Leu / -Trp with Agar medium. Incubate inverted at 28°C for 3 days and observe growth. A positive control consisted of pGBKT7-53 co-transformed with pGADT7-T into the Y2HGold yeast strain, and a negative control consisted of pGBKT7-Lamin co-transformed with pGADT7-T into the Y2HGold yeast strain.

[0116] SD / -Leu / -Trp with Agar medium recipe: Yeast Nitrogen Base (YNB) 6700 mg / L, glucose 20,000 mg / L, adenine sulfate 40 mg / L, L-arginine hydrochloride 20 mg / L, L-aspartic acid 100 mg / L, L-glutamic acid 100 mg / L, L-histidine 20 mg / L, L-lysine 30 mg / L, L-methionine 20 mg / L, L-phenylalanine 50 mg / L, L-serine 375 mg / L, L-threonine 200 mg / L, L-tyrosine 30 mg / L, L-valine 150 mg / L, uracil 20 mg / L, and agar 15 g / L.

[0117] SD / -Leu / -Trp Broth liquid medium formula: yeast nitrogen base (YNB) 6700 mg / L, glucose 20000 mg / L, adenine sulfate 40 mg / L, L-arginine hydrochloride 20 mg / L, L-aspartic acid 100 mg / L, L-glutamic acid 100 mg / L, L-histidine 20 mg / L, L-lysine 30 mg / L, L-methionine 20 mg / L, L-phenylalanine 50 mg / L, L-serine 375 mg / L, L-threonine 200 mg / L, L-tyrosine 30 mg / L, L-valine 150 mg / L, and uracil 20 mg / L.

[0118] SD / -Ade / -His / -Leu / -Trp with Agar medium formula: Yeast Nitrogen Base (YNB) 6700 mg / L, glucose 20,000 mg / L, L-arginine hydrochloride 20 mg / L, L-aspartic acid 100 mg / L, L-glutamic acid 100 mg / L, L-lysine 30 mg / L, L-methionine 20 mg / L, L-phenylalanine 50 mg / L, L-serine 375 mg / L, L-threonine 200 mg / L, L-tyrosine 30 mg / L, L-valine 150 mg / L, uracil 20 mg / L, and agar 15 g / L.

[0119] pGBKT7-53+pGADT7-T was used as the positive control, and pGBKT7-lamin+pGADT7-T was used as the negative control. ScHAT1 +pGADT7 were transformed into yeast strain Y2HGold, and all combinations grew normally on SD / -Leu / -Trp with Agar screening plates, indicating that they were successfully transformed into yeast strains (see Figure 9 On the SD / -Ade / -His / -Leu / -Trp with Agar screening plate, only the colonies in the positive control group grew normally, while no colonies grew in the negative group or the experimental group (see Figure 9 The above results show that ScHAT1 It does not have transcriptional autoactivation activity.

[0120] Example 5 ScHAT1 Genes that negatively regulate resistance to pathogens

[0121] The fusion expression vector pEarleyGate203- was constructed using the Gateway vector construction method. ScHAT1 (See Figure 10 ), specifically: referring to the instructions of Gateway™ LR Clonase™ II enzyme mixture (#11791020), the pDONR-207- ScHAT1 The plasmid was constructed into the plant expression vector pEarleyGate203 by LR reaction to obtain the recombinant plasmid pEarleyGate203- ScHAT1 The LR reaction system is shown in Table 9.

[0122] Table 9 LR reaction system

[0123]

[0124] Furthermore, using the Agrobacterium-mediated tobacco transient expression method (the method is the same as that in step 2 of Example 3), the transient overexpression vector pEarleyGate203 (i.e., the control group 35S:00) and the fusion expression vector pEarleyGate203- ScHAT1 (ie experimental group 35S: ScHAT1 ) were transiently overexpressed in tobacco leaves, and then the transient overexpression vector pEarleyGate203 (i.e. 35S:00) and the fusion expression vector pEarleyGate203- ScHAT1 (i.e. 35S: ScHAT1) of Nicotiana benthamiana plants were inoculated with tobacco solanacearum. At 0d and 8d after inoculation, the tobacco leaves were phenotypically observed and DAB stained for photographs. The specific steps of DAB staining are as follows: dissolve DAB powder at a ratio of 1:1000 (DAB powder: sterile water), soak the tobacco leaves in the DAB aqueous solution, let it stand for 8 hours under dark conditions, then decolorize with anhydrous ethanol, and take photos. Extract RNA from tobacco leaves at 0d and 8d after inoculation with solanacearum and synthesize cDNA. Afterwards, detect the SA marker gene ( NbPR1- A / C ), JA synthesis-related genes ( NbLOX1 and NbPR1b ), ET marker genes ( NbACO-like ), HR marker genes ( NbHSR515 ) and ROS scavenging-related genes ( NbGST1 and NbCAT1 ) expression levels, and the detection primers are shown in Table 10.

[0125] Table 10 Detection primer list

[0126]

[0127] Through the Agrobacterium-mediated transformation system, 35S:00 and 35S: ScHAT1 Transient overexpression in tobacco leaves. Two days after transient overexpression, tobacco leaves were inoculated with Ralstonia solanacearum and the phenotypic changes of tobacco leaves were observed. Overexpression of 35S:: ScHAT1 The phenotype and DAB staining degree of ScHAT1 in leaves were not significantly different from those in the control at 0 days after inoculation; 8 days after inoculation, the overexpression of 35S:: ScHAT1 The leaves showed obvious symptoms of wilting, wrinkling and whitening, while the control group showed almost no symptoms. DAB staining results showed that 35S:: ScHAT1 The leaves were also significantly darker in color than the control leaves (see Figure 11 Figure A in the figure).

[0128] RT-qPCR analysis results showed (see Figure 11 Figure B), SA pathway-related genes in leaves of the control group at the time of disease [[ID=2,8]]NbPR-A / C , JA pathway-related genes NbLOX1 and NbPR1b , ROS pathway-related genes NbGST1 and NbCAT1 , HR pathway-related genes NbHSR515 and ET pathway-related genes NbACO-like Compared with 0d, the expression of NbPR-A / C 、 NbGST1 and NbCAT1The gene expression levels were 3.92 times, 4.61 times and 2.88 times that of 0d respectively. ScHAT1 The expression levels of leaf-related genes are only those related to the ROS pathway NbGST1 and NbCAT1 Compared with 0d, there was an upregulation, and the upregulation degree was lower than that of the empty load. The remaining SA pathway related genes NbPR-A / C , JA pathway-related genes NbLOX1 and NbPR1b , HR pathway-related genes NbHSR515 and ET pathway-related genes NbACO-like Compared with the 0th day, the expression of ScHAT1 The gene may regulate through multiple pathways such as SA, JA, ROS, HR and ET, thereby enhancing the pathogen's infection to plants. ScHAT1 Gene expression can improve disease resistance.

[0129] Example 6 ScHAT1 Genes that enhance host cell tolerance to abiotic stress

[0130] The fusion expression vector pEZYHb- was constructed using the Gateway vector construction method. ScHAT1 (See Figure 12 ), specifically: referring to the instructions of Gateway™ LR Clonase™ II enzyme mixture (#11791020), the pDONR-207- ScHAT1 The plasmid was constructed into the prokaryotic vector pEZYHb by LR reaction to obtain the recombinant plasmid pEZYHb- ScHAT1 The LR reaction system is shown in Table 10. Then, pEZYHb- ScHAT1 The plasmid and the pEZYHb empty plasmid were transformed into Escherichia coli BL21 (TIANGEN, Beijing, China), respectively.

[0131] Take pEZYHb- ScHAT1 -BL21 bacterial solution, pEZYHb-BL21 bacterial solution (negative control), and BL21 bacterial solution (blank control) were propagated in 20 mL centrifuge tubes, and the OD 600At 0.6–0.7°C, 0.7 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) was added, and protein production was induced in a shaker at 16°C, 28°C, and 37°C. Samples were taken at 0, 2, 4, 6, 8, 10, and 12 hours. Negative and blank controls were sampled at 0 and 12 hours. All bacterial samples were centrifuged, loaded with loading buffer, and boiled at 100°C. Induction of the target protein was then observed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), stained with Coomassie Brilliant Blue, and destained.

[0132] After the target protein was induced, the spot experiment method was used to explore the effect of salt stress and drought stress on the protein. ScHAT1 Stress response of genes in E. coli. ScHAT1 -BL21 bacterial solution and pEZYHb-BL21 bacterial solution (negative control) were expanded to OD 600 When the concentration is about 0.6, add 0.7mM IPTG and incubate at 37℃ and 200rpm in a shaker. After induction for 6h, dilute the culture to the same concentration with LB medium (containing ampicillin resistance) and then continue to dilute to 10 -3 , 10 -4 , take 10 μL of bacterial solution and spot it on LB plates with different concentrations of NaCl and D-Mannitol, and culture it at 37℃ overnight.

[0133] Table 11 LR reaction system

[0134]

[0135] The successfully constructed prokaryotic expression vector pEZYHb- ScHAT1 Transformed into E. coli BL21 (DE3), SDS-PAGE detection results are shown in Figure 13 As shown in Figure A, the ScHAT1 recombinant protein was successfully induced and expressed. Because the prokaryotic expression vector carries a 6×His tag, the detected target protein is higher than the predicted theoretical molecular weight of 50.5 kDa. The sugarcane was tested under different abiotic stresses (NaCl and D-Mannitol). ScHAT1 Genes expressing stress tolerance in E. coli cells (see Figure 13 Figure B), recombinant cells pEZYHb- ScHAT1 -BL21 grew faster under NaCl and D-Mannitol stress than the control group, and the number of cell colonies was more than that of the empty-loaded cell colonies. -4The number of colonies at the bacterial solution concentration was very small, while the recombinant cells pEZYHb- ScHAT1 -BL21 can still grow normally. The results show that the recombinant cell pEZYHb- ScHAT1 -BL21 showed positive responses to NaCl and D-Mannitol stress, indicating that overexpression ScHAT1 Can improve the salt stress and drought stress tolerance of Escherichia coli, that is, overexpression ScHAT1 Can improve salt and drought resistance.

[0136] Because histone acetyltransferases dynamically regulate histone acetylation, acting as complexes to mediate plant organ development, hormone signaling coordination, and responses to biotic and abiotic stresses, while also participating in chromosome remodeling, DNA replication and repair, and cell cycle regulation, they form an epigenetic-environmental interaction network. Currently, research on the HAT gene family has been conducted in a variety of plants, with 12, 8, 7, 31, 32, and 6 HAT family genes identified in Arabidopsis, rice, grape, wheat, tomato, and lychee, respectively.

[0137] In the present invention, a ScHAT1The protein has a molecular weight of 50.5 kDa and contains a PLN00104 domain at positions 3–443 aa. The ScHAT1 protein shares the highest homology of 99.77% with the NP_001105074.1 protein in maize, but no HATs have been reported to participate in plant-pathogen interactions in maize. The ScHAT1 protein is localized to the nucleus, consistent with its nuclear localization in tomato and wheat HAT proteins, and consistent with its epigenetic regulatory function of mediating histone acetylation. Acetylation-modifying genes are widely reported to be involved in plant responses to biotic stresses. The cassava MeHAM1 gene interacts with the molecular chaperone DNAJA2 to regulate SA accumulation, positively modulating resistance to cassava wilt. In rice, OsHDT701 negatively regulates innate immunity by reducing histone H4 acetylation, thereby decreasing the transcription of pattern recognition receptors (PRRs) and defense-related genes. In the deletion mutant of AtHDA19 in Arabidopsis, the acetylation level increased, the SA content increased, the expression of related PR genes was promoted, and the disease resistance of the plant was improved. Other studies have shown that Arabidopsis AtHDA19 is upregulated after SA induction, and positively regulates the plant's resistance to Pseudomonas syringae through deacetylation. Arabidopsis acetyltransferase GCN5 inhibits the conduction of the JA signaling pathway by acetylation of Groucho / Tup1-like auxiliary inhibitor TOPLESS (TPL), thereby reducing its resistance to gray mold. Similarly, after the GhCaM7 gene in cotton mutated at the acetylation site, the JA content in the cotton was reduced, and the cotton was more susceptible to dahlia verticillium than the cotton expressing wild-type GhCaM7. The present invention ScHAT1 The gene was down-regulated after SA and JA treatments, and up-regulated in susceptible varieties after smut treatment, but had no significant changes in resistant varieties, indicating that ScHAT1 It may play a negative regulatory role in the plant's immune response. ScHAT1 The gene was overexpressed in Nicotiana benthamiana and inoculated with Ralstonia solanacearum. ScHAT1 The tobacco with the gene had more severe disease, and RT-qPCR analysis results showed that the expression of key genes in the SA / JA signaling pathway (NbPR-A / C, NbLOX1) was inhibited, indicating that ScHAT1 The gene may enhance the susceptibility of plants to pathogens by inhibiting plant SA and JA signal transduction pathways, i.e. ScHAT1 It may play the role of a negative regulatory factor in the response to biotic stress. In summary, it can be shown that reducing the expression of the ScHAT1 gene can improve disease resistance.

[0138] In addition, there are also extensive reports on the involvement of HAT in plant responses to abiotic stress. In rice, drought treatment can significantly increase the expression of OsHAG702, OsHAG703 and OsHAM701, and the acetylation levels on histones H3 and H4 are also upregulated, indicating that OsHATs are involved in the drought stress response of rice. Under drought stress, the expression levels of wheat TaHAG2, TaHAG3, TaHAC2 and TaHDT1 genes are higher in the drought-resistant variety BN207. This result indicates that the differential expression of these HAT genes may be the reason for the higher drought resistance of BN207. Similar results showed that HAT genes in millet, citrus and poplar are all induced by drought stress, and the expression of PtrHDA906 and PtrHAG3 in poplar is significantly induced by drought. In the present invention, the recombinant cell pEZYHb- ScHAT1 -BL21 grew faster under NaCl and D-Mannitol stress than the control group, and the number of cell colonies was more than that of the empty cell colonies, indicating that HAT may have a certain tolerance to salt stress and drought stress, and may be a positive response factor to salt stress and drought stress. ScHAT1 Can improve the salt stress and drought stress tolerance of Escherichia coli, that is, overexpression ScHAT1 Can improve salt and drought resistance.

[0139] In summary, HAT genes play an important role in the interaction between plants and pathogens. ScHAT1 Preliminary research has been conducted on responses to biotic and abiotic stresses, laying a solid foundation for in-depth research on the function and mechanism of action of this gene in the process of sugarcane responding to pathogen stress and abiotic stress.

[0140] All other parts not described in detail are prior art. Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. Those skilled in the art can also derive other embodiments based on this embodiment without inventiveness, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A kind of sugarcane ScHAT1 A gene characterized by described ScHAT1 The coding sequence of the gene is SEQ ID NO:

1.

2. A sugarcane ScHAT1 protein, characterized in that The ScHAT1 protein is the protein according to claim 1 ScHAT1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:

2.

3. A ScHAT1 A plasmid containing a gene, characterized in that Said inclusion ScHAT1 The plasmid of the gene is the one described in claim 1 ScHAT1 The gene was connected to a cloning vector.

4. A ScHAT1 A recombinant gene vector, characterized in that Said inclusion ScHAT1 The recombinant vector of the gene is a ScHAT1 The PCR amplification product of the gene or ScHAT1 The plasmid of the gene is connected to the vector to obtain; described ScHAT1 The coding sequence of the gene is shown in SEQ ID NO:

1.

5. A ScHAT1 A strain of genes, characterized in that Said inclusion ScHAT1 The strain containing the gene ScHAT1 Agrobacterium containing genes ScHAT1 Yeast containing genes ScHAT1 Gene of Escherichia coli; Said inclusion ScHAT1 The Agrobacterium containing the gene is used as claimed in claim 4 ScHAT1 The recombinant vector of the gene is transformed into Agrobacterium to obtain; Said inclusion ScHAT1 The yeast containing the gene is used as claimed in claim 4 ScHAT1 The recombinant vector of the gene is transformed into yeast; Said inclusion ScHAT1 The Escherichia coli containing the gene is used as claimed in claim 4 ScHAT1 The recombinant vector of the gene or the recombinant vector of claim 3 ScHAT1 The plasmid of the gene was transformed into Escherichia coli.

Citation Information

Patent Citations

  • Application of sugarcane SsJMJ11 gene in regulation and control of plant drought resistance

    CN118308406A

  • ScPsbP gene with disease resistance, protein and application

    CN119351422A