SARS-CoV-2 pseudovirus vector construction and verification method

Abstract

The invention relates to the technical field of virus detection, in particular to an SARS-CoV-2 pseudovirus vector construction and verification method which comprises the following steps: selecting target genes based on novel coronavirus, connecting nucleotide sequences of the target genes in series, and cloning the nucleotide sequences to a lentivirus packaging expression vector to obtain plasmids; transforming the plasmid and a second-generation lentivirus packaging plasmid into an escherichia coli cloned strain, carrying out enlarged culture, and extracting an endotoxin-free plasmid; co-transfecting cells with the endotoxin-free plasmids, and collecting pseudovirus particles containing target gene RNA (Ribonucleic Acid) from supernate of the transfected cells; precipitating pseudovirus particles, discarding supernate, and resuspending and concentrating by using a virus dissolving solution; according to the method, a standard curve is drawn for a target gene, RNA extraction, reverse transcription and fluorescent quantitative PCR are performed on pseudovirus particles, the titer of the pseudovirus is calculated through the standard curve, the pseudovirus is obtained, the pseudovirus is not infectious, but the genome of the pseudovirus is similar to that of a real virus, so that the method can be safely used in a laboratory, and the biological safety risk in operation is reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of virus detection, and in particular to a method for constructing and verifying a SARS-CoV-2 pseudovirus vector. Background Art

[0002] At present, the detection method of the new coronavirus (SARS-CoV-2) mainly relies on nucleic acid detection, especially real-time fluorescence quantitative PCR (RT-qPCR). This detection method uses specific gene sequences of the virus as targets, such as the N gene, E gene and ORF1a / b gene, for amplification and detection. Existing nucleic acid detection technology has high sensitivity and specificity and has been widely used in the diagnosis of new coronavirus worldwide.

[0003] However, in actual applications of existing detection methods for the new coronavirus (SARS-CoV-2), real virus samples are highly contagious and laboratory operations pose high biosafety risks. Summary of the invention

[0004] The purpose of the present invention is to provide a SARS-CoV-2 pseudovirus vector construction and verification method, aiming to solve the problem that real novel coronavirus samples are highly contagious and there is a high biosafety risk in laboratory operations for the detection of novel coronavirus.

[0005] To achieve the above object, the present invention provides a method for constructing and verifying a SARS-CoV-2 pseudovirus vector, comprising the following steps:

[0006] Three target genes were selected based on the novel coronavirus, the nucleotide sequences of the three target genes were concatenated, and cloned into a lentiviral packaging expression vector to obtain a plasmid;

[0007] Transforming the plasmid and the second-generation lentiviral packaging plasmid into an Escherichia coli cloning strain, expanding the culture, and extracting the endotoxin-free plasmid;

[0008] Co-transfecting cells with the endotoxin-free plasmid based on a nominal ratio, and collecting pseudoviral particles containing target gene RNA from the supernatant of the transfected cells 96 hours later;

[0009] The pseudovirus particles are precipitated using polyethylene glycol 8000 solution, the cell supernatant is discarded, and then the virus lysate is used to resuspend and concentrate;

[0010] Based on the endotoxin-free plasmid, standard curves are drawn for the three target genes respectively, RNA extraction, reverse transcription and fluorescence quantitative PCR are performed on the pseudovirus particles, and the pseudovirus titer is calculated according to the standard curve to obtain the pseudovirus.

[0011] Among them, the new coronavirus selected three target genes including N gene, E gene and ORF1a / b gene.

[0012] The specific method of transforming the plasmid and the second-generation lentiviral packaging plasmid into Escherichia coli cloning strain, expanding the culture, and extracting the endotoxin-free plasmid is:

[0013] Take out the E. coli Trans10 clone strain from the -80℃ ultra-low temperature freezer, put it on ice to melt, add 1μL of plasmid, use a pipette to gently pipette to mix, and place it on ice for 30 minutes;

[0014] Heat shock at 42°C for 45 s, transfer to an ice bath for 2 min;

[0015] Add 500 μL of LB medium without antibiotics and culture at 37°C with stirring at 220 rpm for 30 min;

[0016] In the clean bench, take 50 μL of bacterial solution and drop it onto the LB plate. Use a coating stick to spread it evenly and put the plate into a 37°C incubator. After the bacterial solution is dry, invert it and culture it overnight.

[0017] Pick a single colony of suitable size and smooth edges from the plate and place it in a 5 mL LB medium tube. Culture it at 37°C with agitation at 180 rpm for 12 h.

[0018] A high-purity plasmid extraction kit was used to extract high-purity plasmid to obtain endotoxin-free plasmid. The purity and form of the endotoxin-free plasmid were detected by agarose gel electrophoresis. After the detection, the endotoxin-free plasmid was stored at -20°C for future use.

[0019] The specific method of using polyethylene glycol 8000 solution to precipitate the pseudovirus particles, discarding the cell supernatant, and resuspending and concentrating with virus dissolving solution is as follows:

[0020] Weigh 8.766 g of NaCl and 50 g of polyethylene glycol and dissolve them in 200 ml of ultrapure water, and heat-kill them at 121 degrees Celsius for 30 minutes, and store them at 4 degrees Celsius for later use to obtain a polyethylene glycol 8000 solution;

[0021] Collect the cell supernatant and filter the cell supernatant using a 0.45 μm filter;

[0022] For every 30 ml of filtered virus initial solution, add 7.5 ml of the polyethylene glycol 8000 solution, mix once every 20 to 30 minutes, for a total of 3 to 5 times, and place the mixture in an environment of 4°C overnight;

[0023] The mixed solution was centrifuged at 4000 g for 20 min at 4°C.

[0024] Aspirate the supernatant, let the tube stand for 1 to 2 minutes, and aspirate the remaining liquid;

[0025] Add an appropriate amount of lentivirus dissolution solution to dissolve the lentivirus precipitate;

[0026] The concentrated virus suspension was divided into 50 μl portions, stored in finished tubes, and quickly frozen with crushed dry ice and stored at -80°C.

[0027] The pseudovirus finally obtains a titer of >10^8 copies / mL.

[0028] The present invention discloses a method for constructing and verifying a SARS-CoV-2 pseudovirus vector. The method comprises the following steps: selecting three target genes based on the novel coronavirus, connecting the nucleotide sequences of the three target genes in series, and cloning the nucleotide sequences into a lentivirus packaging expression vector to obtain a plasmid; transforming the plasmid and the second-generation lentivirus packaging plasmid into an Escherichia coli cloning strain, expanding the culture, and extracting an endotoxin-free plasmid; co-transfecting the endotoxin-free plasmid into cells based on a rated ratio, and collecting pseudovirus particles containing target gene RNA from the supernatant of the transfected cells after 96 hours; precipitating the pseudovirus particles using a polyethylene glycol 8000 solution, discarding the cell supernatant, and resuspending and concentrating the particles using a virus dissolving solution; drawing standard curves for the three target genes based on the endotoxin-free plasmid, performing RNA extraction, reverse transcription, and fluorescence quantitative PCR on the pseudovirus particles, and calculating the pseudovirus titer using the standard curve to obtain the pseudovirus. The method screens and confirms SAR S-CoV-2 detection target gene; construct an expression plasmid with the detection target gene; transfect HEK293T cells through a lentiviral packaging system; collect the supernatant after cell culture to obtain a pseudovirus containing the target gene; purify and concentrate the pseudovirus; perform pseudovirus titer detection by fluorescent quantitative PCR. Since the pseudovirus is not contagious, but its genome is similar to that of the real virus, this method can be safely used in the laboratory, reducing the biosafety risk in the operation and is safe. RNA pseudovirus standards can be used as quality control products to evaluate the efficiency and accuracy of steps such as nucleic acid extraction, reverse transcription and amplification, to ensure the accuracy and reliability of the detection method; by regularly using standards, changes in the detection process can be monitored to ensure the stability and consistency of the test results; the problem that real new coronavirus samples are highly contagious and that laboratory operations for the detection of new coronaviruses pose a high biosafety risk is solved. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0030] Figure 1 This is a gel electrophoresis diagram of a high-purity plasmid, where M is a molecular weight marker, 1 is pCDH-CMV-NEORF1a / b-EF 1-copGFP, 2 is pMD2.G, and 3 is psPAX.

[0031] Figure 2 This is the standard plasmid amplification diagram of the N gene.

[0032] Figure 3 It is the standard curve graph of N gene.

[0033] Figure 4 This is the standard plasmid amplification diagram of the E gene.

[0034] Figure 5 This is the standard curve graph of the E gene.

[0035] Figure 6 Amplification diagram of the ORFab gene standard plasmid.

[0036] Figure 7 ORFab gene standard curve graph.

[0037] Figure 8 Amplification curve of pseudovirus nucleic acid before concentration.

[0038] Fig. 9 Amplification curve of pseudovirus nucleic acid after concentration.

[0039] Fig.10 It is a flow chart of a method for constructing and verifying a SARS-CoV-2 pseudovirus vector provided by the present invention.

[0040] Fig.11 It is a flow chart of the specific method of transforming the plasmid and the second-generation lentiviral packaging plasmid into Escherichia coli cloning strain, expanding the culture, and extracting the endotoxin-free plasmid.

[0041] Fig.12 The flowchart is a specific method of using polyethylene glycol 8000 solution to precipitate the pseudovirus particles, discarding the cell supernatant, and then using virus dissolving solution to resuspend and concentrate. DETAILED DESCRIPTION

[0042] Embodiments of the present invention are described in detail below, examples of which are shown in the accompanying drawings, wherein the same or similar reference numerals throughout represent the same or similar elements or elements having the same or similar functions. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, and should not be construed as limiting the present invention.

[0043] The present invention provides a method for constructing and verifying a SARS-CoV-2 pseudovirus vector, and the reagents and equipment used are as follows:

[0044] Main reagents:

[0045] Plasmid construction

[0046] Transl0 cloning strain (Beijing Quanshijin), pCDH-CMV-MCS-EF1-copGFP plasmid (SystemBioscience, US), high-purity plasmid mini-extraction kit (Beijing Tiangen).

[0047] Virus packaging and cell culture

[0048] psPAX2 (Invitrogen, US), pMD2.G (Invitrogen, US), HEK293T cells (Gibco, US), DMEM basal medium (Gibco, US), fetal bovine serum (Gibco, US), penicillin-streptomycin solution (100X) (Shanghai Biotech), Lipo8000 TM Transfection reagent (Shanghai Biotech).

[0049] Virus purification and concentration

[0050] NaCl (Shanghai McLean), PEG8000 (Sigma, US), HEPES (Shanghai McLean), NaHHCO3 (Shanghai McLean), glycerol (Shanghai Bioengineering), BSA (Sigma, US).

[0051] Virus titer detection

[0052] Virus genome extraction kit (Beijing Tiangen), III1st Strand cDNA SynthesisSuperMix for qPCR (gDNA digester plus) (Shanghai Yisheng), qPCR SYBR Green MasterMix (No Rox) (Shanghai Yisheng).

[0053] Main experimental instruments

[0054] Ultra-low temperature refrigerator (Zhongke Meiling), shaking incubator (Shanghai Zhichu), clean workbench (Beijing Hadonglian), desktop high-speed refrigerated centrifuge (Sichuan Shuke), electronic balance (Shanghai Shunyu Hengping), pH meter, fluorescent quantitative polymerase chain reaction (PCR) detection system (Hangzhou Biori), horizontal electrophoresis instrument (Beijing Wex).

[0055] See also Figures 1 to 12 The present invention provides a method for constructing and verifying a SARS-CoV-2 pseudovirus vector, comprising the following steps:

[0056] S1 selects three target genes based on the novel coronavirus, concatenates the nucleotide sequences of the three target genes, and clones them into a lentiviral packaging expression vector to obtain a plasmid;

[0057] In an embodiment of the present invention, the novel coronavirus selects three target genes including N gene, E gene and ORF1a / b gene.

[0058] The target genes selected for detection are N gene, E gene and ORFla / b. The N gene (nucleocapsid protein gene) is highly expressed during viral replication, has a high RNA copy number, and is easy to detect. The ORFla / b gene encodes non-structural proteins, which are involved in viral replication and transcription and also have a high expression level. The E gene encodes envelope protein. Although the expression level may be relatively low, it is a very stable gene and has been shown to have good detection effects in early tests. These genes are highly conserved regions in the SARS-CoV-2 viral genome, which means that they vary less between different virus strains, which helps to improve the accuracy and sensitivity of the detection and avoid missed detection. Using multiple genes as detection targets can reduce the possibility of false negative results. If a target is not detected due to mutation, other targets can still provide positive signals, thereby improving the reliability of the detection. The nucleic acid sequences of the N gene, E gene, and ORFla / b are as follows:

[0059] ORF1a / b sequence (the underlined segment is the target amplification sequence)

[0060] ATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGA CCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGT CTCCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAA TCGTTTTtAAACGGGTTTCCGGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTG TTGTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTACCAACATGAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACAT

[0061] E Gene (the underlined segment is the target amplification sequence)

[0062] ATGTACTCA TTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTC GTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGC TTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAA

[0063] N Gene (the underlined segment is the target amplification sequence)

[0064] ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTA G GGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACC AGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAA CCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGG AACGTGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAA GAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTCAGGCCTAA

[0065] The N gene, E gene and ORF1a / b of the novel coronavirus were synthesized from Beijing Qingke Biotechnology Co., Ltd.

[0066] The target fragment was cloned into the pCDH-CMV-MCS-EF1-copGFP vector through the BamHI and NotI sites, and the correctness of the plasmid was verified by sequencing.

[0067] S2 transforming the plasmid and the second-generation lentiviral packaging plasmid into an Escherichia coli cloning strain, expanding the culture, and extracting the endotoxin-free plasmid;

[0068] Specific method:

[0069] S21 Take out the E. coli Trans10 clone strain from the -80℃ ultra-low temperature freezer, put it on ice to melt, add 1μL of plasmid, use a pipette to gently pipette to mix, and place it on ice for 30 minutes;

[0070] In the embodiment of the present invention, the melting takes about 2-5 minutes.

[0071] S2 was heat-shocked at 42°C for 45 s and transferred to an ice bath for 2 min;

[0072] S23 was added with 500 μL of LB medium without antibiotics and cultured at 37°C with stirring at 220 rpm for 30 min;

[0073] S24 In the clean bench, take 50 μL of bacterial solution and drop it onto the LB plate. Use a coating stick to spread it evenly and put the plate into a 37°C incubator. After the bacterial solution is dry, invert it and culture it overnight.

[0074] S25: Pick a single colony of suitable size and smooth edges from the plate and place it in a 5 mL LB medium tube. Incubate at 37°C with agitation at 180 rpm for 12 h.

[0075] S26 uses a high-purity plasmid extraction kit to extract high-purity plasmid to obtain endotoxin-free plasmid, and agarose gel electrophoresis is used to detect the purity and form of the endotoxin-free plasmid. After the detection, the endotoxin-free plasmid is placed at -20°C for use.

[0076] S3 co-transfecting cells with the endotoxin-free plasmid based on a rated ratio, and collecting pseudoviral particles containing target gene RNA from the supernatant of the transfected cells 96 hours later;

[0077] In an embodiment of the present invention, including cell culture and transfection, cell recovery and culture include the following steps:

[0078] 1. Take out the HEK293T cells from the liquid nitrogen tank, immerse them in a 37°C water bath and shake until the ice in the cryotubes is completely melted;

[0079] 2. Centrifuge at 500 g for 5 min to remove the freezing solution;

[0080] 3. Add 1 mL of complete culture medium (90% DMEM + 10% FBS) to resuspend the cells;

[0081] 4. Transfer the cells to a 10 cm cell culture dish;

[0082] 5. Add complete culture medium to 10 mL and culture in a 37°C, 5% CO2 incubator.

[0083] Plasmid transfection includes the following steps:

[0084] 1. When preparing for transfection, control the cell density at 70%-80%;

[0085] 2. Replace the culture medium of the cells to be transfected with fresh culture medium;

[0086] 3. Take a clean centrifuge tube and add 750 μL of DMEM culture medium without antibiotics and serum, add 15 μg (psPAX2: pMD2.G: pCDH-CMV-NEORF1a / b-EF1-copGFP = 4:3:1) high-purity plasmid, and mix it by gently blowing with a gun;

[0087] 4. Add 4μl Lipo8000 TM Transfection reagent, gently blow and mix with a gun;

[0088] 5. According to 10cm cell culture dish 750μl Lipo8000 TM The amount of transfection reagent-DNA mixture is evenly added to the entire dish, and then gently mixed;

[0089] 6. After continuing to culture for about 96 hours, collect the cell supernatant.

[0090] S4: using polyethylene glycol 8000 solution to precipitate the pseudovirus particles, discarding the cell supernatant, and resuspending and concentrating the particles using virus lysate;

[0091] Specific method:

[0092] S41: weigh 8.766 g of NaCl and 50 g of polyethylene glycol, dissolve them in 200 ml of ultrapure water, and heat-kill them at 121 degrees Celsius for 30 minutes, and store them at 4 degrees Celsius for later use, to obtain a polyethylene glycol 8000 solution;

[0093] S42 collected the cell supernatant and filtered the cell supernatant using a 0.45 μm filter;

[0094] S43: Add 7.5 ml of the polyethylene glycol 8000 solution to every 30 ml of the filtered virus initial solution, mix once every 20 to 30 minutes, for a total of 3 to 5 times, and place the mixture in an environment of 4°C overnight;

[0095] S44, centrifuging the mixture at 4000 g for 20 min at 4°C;

[0096] S45 Aspirate the supernatant, let the tube stand for 1 to 2 minutes, and aspirate the remaining liquid;

[0097] S46 Add an appropriate amount of lentiviral dissolution solution to dissolve the lentiviral precipitate;

[0098] The concentrated virus suspension of S47 was divided into 50 μl aliquots, stored in finished tubes, and quickly frozen with crushed dry ice and stored at -80°C.

[0099] S5: based on the endotoxin-free plasmid, standard curves are drawn for the three target genes respectively, RNA extraction, reverse transcription and fluorescence quantitative PCR are performed on the pseudovirus particles, and the pseudovirus titer is calculated according to the standard curve to obtain the pseudovirus.

[0100] In the embodiment of the present invention, a standard curve is drawn

[0101] Determine the concentration of pCDH-CMV-NEORF1a / b-EF1-copGFP plasmid according to the formula:

[0102]

[0103] Among them, DNA length is the number of base pairs, cpoies is the copy number, and it represents the unit of plasmid concentration.

[0104] Calculate plasmid copy number;

[0105] The plasmid was diluted tenfold to prepare a standard plasmid sample with a copy number of 10^8-10^3 copies / μL;

[0106] The quantitative PCR primers in Table 1 were used for quantitative detection using the SYBR Green dye method, and a standard curve was drawn. The reaction system and reaction conditions are shown in Tables 2 and 3.

[0107] Table 1 Virus qPCR detection primers

[0108]

[0109] Table 2 Reaction system

[0110]

[0111]

[0112] Table 3 Reaction conditions

[0113]

[0114] The N gene copy number calculation formula is:

[0115]

[0116] The calculation formula of E gene copy number is:

[0117]

[0118] The calculation formula for ORF1a / b gene copy number is:

[0119]

[0120] Viral genome extraction and virus titer detection

[0121] 1. Take 200 μL of purified virus and use the viral genome DNA / RNA extraction kit (Beijing Tiangen) to extract the viral genome according to the instructions, and finally use 50 μL of elution buffer for elution;

[0122] 2. Take 1 μL of eluted genome and use III1st Strand cDNA Synthesis SuperMixfor qPCR (gDNA digester plus) (Shanghai Yisheng), reverse transcription was performed according to the instructions;

[0123] 3. Use the primers in Table 1 and perform quantitative PCR according to the conditions in Table 2 and Table 3;

[0124] 4. Substitute the obtained Ct value into the standard curve to calculate the number of reaction template copies. The final virus titer is calculated as follows:

[0125]

[0126] According to the N, E, and ORFab gene copy number calculation formula, the N gene copy number before concentration was approximately 741 copies / μL, the E gene copy number was approximately 895 copies / μL, the ORFab gene copy number was approximately 847 copies / μL, and the virus titer before concentration was approximately 4.14×106 copies / mL.

[0127] According to the N, E, and ORFab gene copy number calculation formula, after concentration, the N gene copy number was approximately 3.41×105copies / μL, the E gene copy number was approximately 6.21×105copies / μL, and the ORFab gene copy number was approximately 2.59×105copies / μL. The virus titer after concentration was approximately 2.03×109copies / mL.

[0128] The above disclosure is only a preferred embodiment of a SARS-CoV-2 pseudovirus vector construction and verification method of the present invention. Of course, this cannot be used to limit the scope of rights of the present invention. A person of ordinary skill in the art can understand that all or part of the processes of the above embodiments and equivalent changes made according to the claims of the present invention still fall within the scope of the invention.

Claims

1. A method for constructing and verifying a SARS-CoV-2 pseudovirus vector, characterized in that: The following steps are involved: Three target genes were selected based on the novel coronavirus, the nucleotide sequences of the three target genes were concatenated, and cloned into a lentiviral packaging expression vector to obtain a plasmid; Transforming the plasmid and the second-generation lentiviral packaging plasmid into an Escherichia coli cloning strain, expanding the culture, and extracting the endotoxin-free plasmid; Co-transfecting cells with the endotoxin-free plasmid based on a nominal ratio, and collecting pseudoviral particles containing target gene RNA from the supernatant of the transfected cells 96 hours later; The pseudovirus particles are precipitated using polyethylene glycol 8000 solution, the cell supernatant is discarded, and then the virus lysate is used to resuspend and concentrate; Based on the endotoxin-free plasmid, standard curves are drawn for the three target genes respectively, RNA extraction, reverse transcription and fluorescence quantitative PCR are performed on the pseudovirus particles, and the pseudovirus titer is calculated according to the standard curve to obtain the pseudovirus.

2. A method for constructing and verifying a SARS-CoV-2 pseudovirus vector as claimed in claim 1, characterized in that: The novel coronavirus selected three target genes including N gene, E gene and ORF1a / b gene.

3. A method for constructing and verifying a SARS-CoV-2 pseudovirus vector as claimed in claim 1, characterized in that: The specific method of transforming the plasmid and the second-generation lentiviral packaging plasmid into Escherichia coli cloning strain, expanding the culture, and extracting the endotoxin-free plasmid is: Take out the E. coli Transl0 clone strain from the -80℃ ultra-low temperature freezer, place it on ice to thaw, add 1μL of plasmid, use a pipette to gently pipette to mix, and place it on ice for 30 minutes; Heat shock at 42°C for 45 s, transfer to an ice bath for 2 min; Add 500 μL of LB medium without antibiotics and culture at 37°C with stirring at 220 rpm for 30 min; In the clean bench, take 50 μL of bacterial solution and drop it onto the LB plate. Use a coating stick to spread it evenly and put the plate into a 37°C incubator. After the bacterial solution is dry, invert it and culture it overnight. Pick a single colony of suitable size and smooth edges from the plate and place it in a 5 mL LB medium tube. Culture it at 37°C with agitation at 180 rpm for 12 h. A high-purity plasmid extraction kit was used to extract high-purity plasmid to obtain endotoxin-free plasmid. The purity and form of the endotoxin-free plasmid were detected by agarose gel electrophoresis. After the detection, the endotoxin-free plasmid was stored at -20°C for future use.

4. A method for constructing and verifying a SARS-CoV-2 pseudovirus vector as claimed in claim 1, It is characterized by: The specific method of using polyethylene glycol 8000 solution to precipitate the pseudovirus particles, discarding the cell supernatant, and using virus dissolving solution to resuspend and concentrate is: Weigh 8.766 g of NaCl and 50 g of polyethylene glycol and dissolve them in 200 ml of ultrapure water, and heat-kill them at 121 degrees Celsius for 30 minutes, and store them at 4 degrees Celsius for later use to obtain a polyethylene glycol 8000 solution; Collect the cell supernatant and filter the cell supernatant using a 0.45 μm filter; For every 30 ml of filtered virus initial solution, add 7.5 ml of the polyethylene glycol 8000 solution, mix once every 20 to 30 minutes, for a total of 3 to 5 times, and place the mixture in an environment of 4°C overnight; The mixed solution was centrifuged at 4000 g for 20 min at 4°C. Aspirate the supernatant, let the tube stand for 1 to 2 minutes, and aspirate the remaining liquid; Add an appropriate amount of lentivirus dissolution solution to dissolve the lentivirus precipitate; The concentrated virus suspension was divided into 50 μl portions, stored in finished tubes, and quickly frozen with crushed dry ice and stored at -80°C.

5. A method for constructing and verifying a SARS-CoV-2 pseudovirus vector as claimed in claim 1, characterized in that ； The pseudovirus finally obtained a titer of >10^8 copies / mL.

Images