Application of circular RNA Hsacirc0006332 in diagnosis and treatment of esophageal squamous cell carcinoma

Abstract

The invention discloses application of circular RNA (Ribonucleic Acid) Hsacirc0006332 in diagnosis and treatment of esophageal squamous cell carcinoma, and belongs to the field of biological medicines. The application comprises the application of a reagent capable of detecting the Hsacirc0006332 or the expression quantity of the Hsacirc0006332 in preparation of a kit for diagnosing the esophageal squamous cell carcinoma, and the nucleotide sequence of the Hsacirc0006332 is SEQ ID NO. 1. The invention further discloses application of the component capable of inhibiting or blocking expression of the Hsacirc0006332 in preparation of a medicine for treating esophageal squamous cell carcinoma. The expression level of Hsacirc0006332 specific siRNAs in esophageal squamous cell carcinoma cells is changed through molecular biology means such as construction of Hsacirc0006332 specific siRNAs, and it is revealed that interference on Hsacirc000632 expression can significantly inhibit proliferation, invasion and migration of esophageal squamous cell carcinoma cells and promote tumor cell biological phenotypes such as cancer cell apoptosis. Therefore, the Hsacirc0006332 can be used as a therapeutic target to be applied to preparation, screening or treatment of esophageal squamous cell carcinoma or inhibition of esophageal squamous cell carcinoma migration invasion, and a new therapeutic method is provided for intervention or treatment of esophageal squamous cell carcinoma.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of circular RNA Hsa_circ_0006332 in the diagnosis and treatment of esophageal squamous cell carcinoma. Background Art

[0002] Esophageal cancer is one of the common digestive tract malignancies with high morbidity and mortality rates that occur in the esophageal mucosal epithelium. According to the 2020 global cancer statistics, esophageal cancer is one of the top ten common cancers in the world, with an incidence rate ranking 8th among malignant tumors and a mortality rate ranking 6th. With the deepening of scientific research on esophageal cancer and the development of medical technology, although there have been new progress and breakthroughs in the diagnosis and treatment of esophageal cancer, such as from thoracotomy to minimally invasive technology to immunotherapy combined with radiotherapy and chemotherapy, the reliability and authenticity of its efficacy benefits are still under further study, but the 5-year survival rate of patients is still less than 15%. Therefore, this requires in-depth exploration of the biological mechanisms and influencing factors of esophageal cell carcinogenesis, invasion, metastasis and apoptosis, and on this basis, to find substances that can regulate the occurrence, invasion, metastasis and apoptosis of esophageal cell carcinoma, and to design targeted anti-esophageal cancer drugs based on this target, so as to provide more options for targeted treatment of esophageal cancer patients, so as to achieve the purpose of improving the survival time and level of esophageal cancer patients.

[0003] Circular RNA (circRNA) is a type of non-coding RNA with a unique continuous covalently closed circular structure without a 5' cap or a 3' polyA tail. Due to the special structure, it is not easily degraded by RNA exonucleases and RNAses. As a result, circRNA can be concentrated in the cytoplasm to play a biological role. Therefore, it is more stable and meaningful as a disease biomarker than linear RNA. With the development of high-throughput RNA sequencing technology and epigenetics, the structure, function and tissue specificity of circRNA have gradually been discovered. More and more experimental evidence shows that circRNA is closely related to the progression of tumors. It has also attracted widespread attention from scientific researchers in early tumor diagnosis, prognosis prediction of different tumor types and specific targeted therapy. For example, artificially modified or engineered circular RNA with coding function and tumor-specific function can be used as an anticancer drug to achieve sufficient therapeutic effect at a small dose in the human body, filling the gap of targeted therapy for patients who need high protein level treatment and non-specific mRNA treatment. However, the current research on the role and influence of circRNA in the occurrence and development of esophageal cell carcinoma is not thorough enough. It is of great significance to further understand the occurrence and development mechanism of esophageal squamous cell carcinoma, explore new molecular targets for the treatment of esophageal squamous cell carcinoma, promote "circular RNA therapy" into the IND (Investigational New Drug) stage, and bring new treatment options to cancer patients around the world. Summary of the invention

[0004] The purpose of the present invention is to propose the application of circular RNA Hsa_circ_0006332 in the diagnosis and treatment of esophageal squamous cell carcinoma, mainly to solve the problems of single drug treatment and poor treatment effect of esophageal squamous cell carcinoma.

[0005] The present invention analyzed the differential expression of circRNA in cancer tissue and adjacent tissue samples of esophageal squamous cell carcinoma patients and determined that Hsa_circ_0063865 has the potential to be a molecular target for the treatment of esophageal squamous cell carcinoma. The expression of the molecular target in cancer tissue samples of esophageal squamous cell carcinoma was significantly higher than that in adjacent tissues, and the difference was statistically significant. It can be used as a molecular marker for early diagnosis and treatment of esophageal squamous cell carcinoma.

[0006] Therefore, the use of Hsa_circ_0006332 as a target includes but is not limited to the preparation, screening and treatment of drugs for esophageal squamous cell carcinoma.

[0007] The first aspect of the present invention relates to the use of a reagent capable of detecting Hsa_circ_0006332 or its expression level in the preparation of a kit for diagnosing esophageal squamous cell carcinoma, wherein the nucleotide sequence of Hsa_circ_0006332 is SEQ ID NO.1.

[0008] Optionally, the reagent includes a specific primer capable of recognizing circular RNA Hsa_circ_0006332.

[0009] Optionally, the specific primers include circ-0006332-F and circ-0006332-R, and the nucleotide sequences are SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0010] The second aspect of the present invention relates to a kit for diagnosing esophageal squamous cell carcinoma, comprising a reagent capable of detecting Hsa_circ_0006332 or its expression level, wherein the Hsa_circ_0006332 sequence is SEQ ID NO.1.

[0011] The third aspect of the present invention relates to the use of a component capable of inhibiting or blocking the expression of Hsa_circ_0006332 or a component capable of binding to the expression product of Hsa_circ_0006332 to render it ineffective, in the preparation of a drug for the treatment of esophageal squamous cell carcinoma, wherein the Hsa_circ_0006332 sequence is SEQ ID NO.1.

[0012] Optionally, the component capable of inhibiting or blocking the expression of Hsa_circ_0006332 includes siRNA that interferes with the expression of Hsa_circ_0006332.

[0013] Optionally, the siRNA includes si-Hsa_circ_0006332-F and si-Hsa_circ_0006332-R, and the nucleotide sequences are SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0014] The third aspect of the present invention relates to a drug for treating esophageal squamous cell carcinoma, comprising a component capable of inhibiting or blocking the expression of Hsa_circ_0006332 or a component capable of binding to the expression product of Hsa_circ_0006332 to render it ineffective.

[0015] Optionally, a pharmaceutically acceptable excipient or carrier is also included.

[0016] The fourth aspect of the present invention relates to the use of a reagent capable of detecting Hsa_circ_0006332 or its expression level in screening potential drug ingredients for treating esophageal squamous cell carcinoma, wherein the Hsa_circ_0006332 sequence is SEQ ID NO.1.

[0017] Regarding the application in screening potential drug ingredients for the treatment of esophageal squamous cell carcinoma, specifically including the application of Hsa_circ_0006332 as the central target in the research and development of early diagnosis of esophageal squamous cell carcinoma, the early diagnosis method includes minimally invasive liquid biopsy to identify Hsa circ 0006332 expression.

[0018] The drug that inhibits or blocks the expression of Hsa_circ_0006332 can be a gene drug or a chemical drug.

[0019] Beneficial Effects

[0020] This application reveals the differential expression of Hsa_circ_0006332 in esophageal squamous cell carcinoma and cancer tissue, and verifies its function in esophageal squamous cell carcinoma cells by preparing Hsa_circ_0006332-specific siRNA. This application significantly inhibits the proliferation, invasion and migration of esophageal squamous cell carcinoma and promotes apoptosis of cancer cells by knocking down Hsa_circ_0006332. It is a very important molecular target for the treatment of esophageal squamous cell carcinoma, and provides a new and effective treatment method for the treatment of tumor patients, reducing the treatment cost of patients and improving their survival rate, with good prospects for drug development. In addition, the expression level of Hsa_circ_0006332 in cancer tissues of patients with esophageal squamous cell carcinoma is significantly higher than that in adjacent tissues, and the difference is statistically significant, so the expression level of Hsa_circ_0006332 may also have the potential to be a diagnostic indicator for esophageal squamous cell carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of the biological formation and structure of Hsa_circ_0006332;

[0022] Figure 2 The differential expression level of Hsa_circ_0006332 between esophageal squamous cell carcinoma tissue and adjacent tissue;

[0023] Figure 3 This is the siRNA knockdown effect diagram of Hsa_circ_0006332;

[0024] Figure 4 This is the result diagram of Hsa_circ_0006332 intracellular and extracellular stability;

[0025] Figure 5This is the result of the CCK8 and EDU experiment of Hsa_circ_0006332 siRNA regulating cell proliferation;

[0026] Figure 6 This is the result of Hsa_circ_0006332 siRNA regulating cell invasion and migration. DETAILED DESCRIPTION

[0027] The present invention is described in detail below in conjunction with specific operation examples. It can be understood that the examples are only for explaining the present invention rather than limiting the present invention. However, any changes or substitutions described in the present invention are within the protection scope of the present invention.

[0028] The sequences involved in the embodiments of the present application include:

[0029] 1. Hsa_circ_0006332|chr22:42331129_42333998_+

[0030] SEQ ID NO.1:

[0031]

[0032] 2. SEQ ID NO.2 and SEQ ID NO.3

[0033] Hsa_circ_0006332-specific primers

[0034] The nucleotide sequence of circ-0006332-F is CTTGAGCGAGTCCAAAGACTG (SEQ ID NO.2), and the nucleotide sequence of circ-0006332-R is AGTTGGTCAGAAGACTTCCCT (SEQ ID NO.3)

[0035] 3. The nucleotide sequence of si-Hsa_circ_0006332-F is CGACCCUGAUGCUUGGUGUG

[0036] The nucleotide sequence of si-Hsa_circ_0006332-R is ACACCAAGCAUCAGGGUCGCA

[0037] 4. The nucleotide sequence of MYBL2-F is CTTGAGCGAGTCCAAAGACTG (SEQ ID NO.6)

[0038] The nucleotide sequence of MYBL2-R is AGTTGGTCAGAAGACTTCCCT (SEQ ID NO. 7)

[0039] Example 1: RT-QPCR technology was used to prove that the expression level of Hsa_circ_0006332 in esophageal squamous cell carcinoma tissue was significantly higher than that in adjacent tissues;

[0040] 1. RNA Extraction from Esophageal Squamous Cell Carcinoma Tissue Samples

[0041] 1) After approval by the Medical Ethics Committee of Southeast University and informed consent from patients / family members, 13 patients diagnosed with esophageal squamous cell carcinoma from the First People's Hospital of Huai'an City, Jiangsu Province were selected, and a total of 13 cancer tissues and corresponding adjacent tissues were collected;

[0042] 2) Select 0.1cm 3 The tissue was minced with scissors and placed in a 1.5 mL EP tube. 1 mL Trizol and 3 grinding steel beads were added and ground at 70 Hz for 10 min (the grinding box was precooled in advance). The subsequent extraction was performed according to the conventional extraction steps of Trizol reagent.

[0043] 3) Take 1 μL of RNA sample and use a UV spectrophotometer to detect its concentration and purity. The A260 / A280 ratio of the obtained RNA sample is between 1.8 and 2.0.

[0044] 2. Reverse transcription of RNA into cDNA

[0045] MMLV reverse transcriptase was used for reverse transcription. The reverse transcription reaction system and conditions were as follows:

[0046] RNA 1 μg Random primer 1μL Enzyme-free water Make up to 15 μL

[0047] React at 70°C for 10 min and place on ice for 2 min.

[0048]

[0049]

[0050] React at 37°C for 60 min, 90°C for 10 min, and maintain at 4°C.

[0051] 3. cDNA fluorescence quantitative PCR:

[0052] According to the Hsa_circ_0006332 structure and linker sequence (results see Figure 1 ) Design specific primers: the nucleotide sequence of circ-0006332-F is CTTGAGCGAGTCCAAAGACTG (SEQ ID NO.2); the nucleotide sequence of circ-0006332-R is AGTTGGTCAGAAGACTTCCCT (SEQ ID NO.3);

[0053] Reaction system:

[0054] cDNA 1μL SYBR Green Mix 5μL Plus Solution 1μL Upstream and downstream primers 0.6μL each Enzyme-free water Make up to 10 μL

[0055] Reaction conditions: preheat at 94°C for 5 min, 94°C for 30 s, 60°C for 30 s, and react for 40 cycles. Collect fluorescence at 60°C in each cycle, heat from 60°C to 95°C, collect fluorescence, and calculate the melting curve.

[0056] 4. Data processing and analysis

[0057] The expression level of Hsa_circ_0006332 in the sample to be tested was calculated by comparing its Ct value with the internal reference β-actin Ct value method to obtain ΔCt. The larger the ΔCt value, the lower the actual expression level. The statistical analysis method was analyzed by T test, and P<0.05 was considered statistically significant.

[0058] 5. Experimental results and analysis

[0059] In this cohort of patients with esophageal squamous cell carcinoma, the expression level of Hsa_circ_0006332 in cancer tissues was significantly higher than that in adjacent tissues, and the difference was statistically significant (see Figure 2), indicating that Hsa_circ_0006332, as an oncogene, may be an important molecular target for the treatment or diagnosis of esophageal squamous cell carcinoma.

[0060] Example 2 Construction of Hsa_circ_0063865-specific siRNA to verify its effect on biological phenotype

[0061] 1) Construction of Hsa_circ_0006332 low-expression cell model: Based on the Hsa_circ_0006332 structure and linker sequence (results see Figure 1 ) to design its specific siRNA: the nucleotide sequence of si-Hsa_circ_0006332-F is CGACCCUGAUGCUUGGUGUG (SEQ ID NO.4) and the nucleotide sequence of si-Hsa_circ_0006332-R is ACACCAAGCAUCAGGGUCGCA (SEQ ID NO.5). 4 109 cells / well were seeded in a 6-well plate and the cells were placed in a 5% CO 2 Culture in a cell culture incubator for 24 hours. Dilute Si-6332, Si-NC and transfection reagent with 1640 medium at a ratio of 1:20, mix gently and react for 5 minutes. Gently mix Si-6332 and Si-NC with transfection reagent at a ratio of 1:1 and react for 15 minutes. Add the transfection complex to an appropriate amount of 1640 complete medium without double antibody and mix gently. Add 500 μL of 1640 containing transfection complex to each well of the six-well plate, and place the cells at 37°C in 5% CO 2 After 6 h of culture in the cell culture incubator, the culture medium was replaced with 1640 complete medium containing 10% FBS and cultured for another 18 h. qRT-PCR was used to detect the expression of hsa_circ_0006332 and evaluate the interference effect of siRNA. Figure 3 shown.

[0062] 2) Linear RNA ablation / RNase R experiment: Extract the above Si-6332 and Si-NC cell RNA and prepare the following reaction system in a sterile microcentrifuge tube:

[0063]

[0064] The linear RNA was digested at 37°C for 30 min and incubated at 70°C for 10 min to inactivate the enzyme. Then, according to the structure and linker sequence of the parent gene MYBL2 of Hsa_circ_0006332 (results in Figure 1) designed specific primers: the nucleotide sequence of MYBL2-F was CTTGAGCGAGTCCAAAGACTG (SE Q ID NO.6); the nucleotide sequence of MYBL2-R was AGTTGGTCAGAAGACTTCCCT (SE Q ID NO.7), and MYBL2, GAPDH and Hsa_circ_0006332 primers were used for qRT-PCR to detect RNA expression levels and identify circRNA.

[0065] 3) Actinomycin D detection: 20×10 4 109 cells were inoculated into 6-well plates and treated with actinomycin D. Three experimental groups were set at 0h, 6h and 12h. After reaching the corresponding time points, the cells were collected and total RNA was extracted. qRT-PCR was used to detect RNA expression levels and evaluate the stability of hsa_circ_0006332. The results are shown in the figure. Figure 4 shown.

[0066] 4) CCK8 detection of cell proliferation ability: 1×10 4 The cells were seeded into 96-well plates and placed in a 5% CO 2 The cells were cultured in a cell culture incubator for 24 h. 10 μL of drugs of different concentrations were added to each well for stimulation and incubated for 30 min. 10 μL of CCK-8 solution was added to each well and incubated at 37°C with 5% CO 2 Incubate in an incubator for 2 hours. Measure the absorbance at 450 nm with an enzyme-labeled instrument. Subtract the background OD value (blank group) from the OD value of each test well, and take the average ± SD of the OD values ​​of each replicate well to reflect the number of viable cells in each well.

[0067] 5) Cell proliferation ability EDU detection: 1×10 4 Cells were seeded into 96-well plates and incubated with EdU for 2 h when the cells reached 50% confluence. Subsequent steps were performed according to BeyoClick TM The wells were washed twice with PBS for 5 min each time. The washing PBS was discarded and 50 μL of new PBS was added to each well. The wells were observed and photographed under a microscope. Five fields of view were randomly selected from each well to be photographed and the number of red cells (proliferating cells) and blue cells (total cells) were calculated.

[0068] 6) Cell migration ability detection: Cell migration ability was detected using 8 μm pore size Transwell chambers. Cells in the exponential growth phase were obtained and digested with trypsin to prepare single cell suspensions. Each chamber was inoculated with 5×10 4Cells, add serum-free medium to the upper chamber to make up to 200 μL, and add 600 μL of complete medium containing 20% ​​FBS to the lower chamber. After routine culture for 24 hours, remove the chamber, use a gun tip to suck off the residual liquid, use a cotton swab to wipe off the cells that have not passed through the inner side of the chamber, soak it in methanol for 10 minutes, remove the chamber, and after the membrane is air-dried, use 0.1% crystal violet staining solution to stain at room temperature for 15 minutes, rinse with PBS, and put it back into the 24-well plate after natural air drying. Observe under a microscope, randomly select 5 fields of view in each chamber to take pictures, and count the number of cells that have passed through the membrane.

[0069] 7) Cell invasion ability detection: Take cells in logarithmic growth phase for plating, wait until the cell confluence is 70%, put -20℃ Matrigel in a 4℃ refrigerator to dissolve, and put Transwell chamber in a 4℃ refrigerator for precooling; dilute the matrix gel with serum-free medium at a ratio of 1:8, quickly add the diluted matrix gel to each chamber, add 50μL; put the chamber in a 37℃ incubator and heat for 1h to solidify the matrix gel, take out the chamber, and remove the unsolidified liquid on the upper layer; digest and collect the cells, prepare single cell suspension with serum-free medium, and add 5×10 5 / well, add cells to the inner chamber, and add 600μL complete culture medium containing 50% FBS to the lower chamber; after culturing for 24h, take out the chamber, wipe off the cells and matrix gel that have not penetrated the membrane with a cotton swab, fix with methanol and air-dry, and then stain with 0.1% crystal violet; observe under a microscope, randomly select 5 fields of view in each chamber to take pictures, and count the number of cells that have penetrated the membrane.

[0070] 8) The results showed that low expression of Hsa_circ_0006332 in EC109 inhibited cell proliferation ( Figure 5 ), migration ability and cell invasion ( Figure 6 ), and Hsa_circ_0006332 inhibitors can significantly inhibit tumor progression, which can be used as a new molecular target in drug development and esophageal cancer treatment.

[0071] It should be noted that the association between Hsa_circ_0006332 and esophageal squamous cell carcinoma was verified in the above examples of this application. The diagnosis described in the above examples can be to judge the possibility or risk of esophageal squamous cell carcinoma by the expression level of Hsa_circ_0006332 in the tissue sample; the prognosis level of esophageal squamous cell carcinoma in the patient can also be judged by the expression level of Hsa_circ_0006332 in the tissue, or it can be used to screen potential drugs for the treatment of esophageal squamous cell carcinoma.

[0072] The above examples reveal that inhibiting the expression of Hsa_circ_0006332 has an inhibitory effect on the proliferation and migration abilities of esophageal squamous cell carcinoma. However, those skilled in the art should be aware that in the actual preparation of the drug, in addition to the components that interfere with the expression of Hsa_circ_0006332 provided in this example, other pharmaceutically acceptable adjuvants may also be included. Furthermore, the components that interfere with the expression of Hsa_circ_0006332 in the drug are not limited to the siRNA proposed in this example, and may also be replaced by other technical means that can knock down or knock out, which should also be able to achieve the same purpose of this example.

[0073] However, it should be noted that this application does not imply that Hsa_circ_0006332 is used only as a single diagnostic indicator. In some embodiments, it can also be combined with known symptoms and other diagnostic markers in the prior art to diagnose esophageal squamous cell carcinoma to improve the accuracy and specificity of the diagnosis.

[0074] In the description of this specification, the description with reference to the terms "one embodiment", "example", "specific example", etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0075] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and these changes and improvements all fall within the scope of the present invention to be protected.

Claims

1. Use of a reagent capable of detecting Hsa_circ_0006332 or its expression amount in the preparation of a kit for diagnosing esophageal squamous cell carcinoma, wherein the nucleotide sequence of Hsa_circ_0006332 is SEQ ID NO.

1.

2. The kit for diagnosing esophageal squamous cell carcinoma according to claim 1, characterized in that: The reagents include specific primers capable of recognizing circular RNA Hsa_circ_0006332.

3. The kit for diagnosing esophageal squamous cell carcinoma according to claim 2, characterized in that: The specific primers include circ-0006332-F and circ-0006332-R, and the nucleotide sequences are SEQ ID NO.2 and SEQ ID NO.3, respectively.

4. A kit for diagnosing esophageal squamous cell carcinoma, characterized in that: It includes a reagent capable of detecting Hsa_circ_0006332 or its expression amount, and the Hsa_circ_0006332 sequence is SEQ ID NO.

1.

5. Use of a component capable of inhibiting or blocking the expression of Hsa_circ_0006332 or a component capable of binding to the expression product of Hsa_circ_0006332 to render it ineffective, in the preparation of a drug for the treatment of esophageal squamous cell carcinoma, wherein the Hsa_circ_0006332 sequence is SEQ ID NO.

1.

6. The use according to claim 5, characterized in that: The components capable of inhibiting or blocking the expression of Hsa_circ_0006332 include siRNA that interferes with the expression of Hsa_circ_0006332.

7. The use according to claim 6, characterized in that: The siRNA includes si-Hsa_circ_0006332-F and si-Hsa_circ_0006332-R, and the nucleotide sequences are SEQ ID NO.4 and SEQ ID NO.5, respectively.

8. A drug for treating esophageal squamous cell carcinoma, characterized in that: It includes components that can inhibit or block the expression of Hsa_circ_0006332 or components that can bind to the expression product of Hsa_circ_0006332 and render it ineffective.

9. The drug for treating esophageal squamous cell carcinoma according to claim 8, characterized in that: It also includes pharmaceutically acceptable excipients or carriers.

10. Use of a reagent capable of detecting Hsa_circ_0006332 or its expression level in screening potential drug ingredients for treating esophageal squamous cell carcinoma, wherein the Hsa_circ_0006332 sequence is SEQ ID NO.1.

Images