Indel molecular marker related to oleic acid content character of cotton grain, specific primer and application of Indel molecular marker

Abstract

The invention discloses an Indel molecular marker related to the oleic acid content character of cotton grains, a specific primer and application of the Indel molecular marker and the specific primer, and belongs to the technical field of plant genetic engineering. The Indel molecular marker is located on a GhK3 gene of a D13 chromosome of a cotton genome, and insertion or deletion of a nucleotide sequence as shown in SEQ ID NO.1 exists at 792bp of a GhK3 gene promoter. According to the invention, a P1 haplotype (GhK3-792-del) and a P2 haplotype (GhK3-792-ins) are obtained through difference analysis of promoter sequences of GhK3 genes of cotton inbred lines with different grain oleic acid contents, and the two haplotypes are further subjected to correlation analysis with the grain oleic acid contents. The oleic acid content in the P2 haplotype cotton seeds is obviously higher than that in the P1 haplotype cotton seeds.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to Indel molecular markers related to cotton seed oleic acid content traits, specific primers and applications thereof. Background Art

[0002] Cotton is an important cash crop in the world and plays an important role in my country's national economy. Cottonseed is the main byproduct of commercial cotton, accounting for about 60% of the total cottonseed production. The oil content of cottonseed accounts for 15.0% to 48.7%. Cottonseed oil contains a large amount of fatty acids necessary for the human body, among which oleic acid is one of the main components of cottonseed fatty acids, which can reduce cholesterol in the blood and prevent cholesterol from depositing on the blood vessel walls, which is beneficial to the cardiovascular and cerebrovascular system. Therefore, increasing the oleic acid content of seeds is of great significance to ensuring future food safety. The exploration and utilization of molecular markers related to the oleic acid content of seeds is of great practicality for screening high oleic acid germplasm in seeds and applying it to breeding.

[0003] Genome-wide association study (GWAS) is a method of combining the genetic variation polymorphism of multiple individuals in the whole genome with the diversity of target trait phenotypes, which can directly identify gene loci or marker loci that are closely related to phenotypic variation and have specific functions. If molecular markers related to cotton seed oleic acid content can be developed, it will be of great significance to cotton breeding and improve cotton breeding efficiency. Summary of the invention

[0004] The purpose of the present invention is to provide an Indel molecular marker, a specific primer and an application thereof related to the oleic acid content trait of cotton seeds, so as to solve the problems existing in the above-mentioned prior art. The Indel marker provided by the present invention is significantly correlated with the oleic acid content of cotton seeds. If the InDel marker is an insertion type, the oleic acid content in the cotton seeds is low; if the InDel marker is a deletion type, the oleic acid content in the cotton seeds is high. The Indel marker can be used for molecular assisted breeding of cotton and identification of high-quality planting resources, thereby accelerating the creation of high oleic acid enriched materials in cotton seeds and the process of breeding new varieties.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] One of the technical solutions of the present invention is an Indel molecular marker related to the oleic acid content trait of cotton seeds. The Indel molecular marker is located on the GhK3 gene of chromosome D13 of the cotton genome, and there is an insertion or deletion of the nucleotide sequence shown in SEQ ID NO.1 at 792bp of the GhK3 gene promoter.

[0007] The second technical solution of the present invention is a specific primer set for detecting the Indel molecular marker, comprising an upstream primer as shown in SEQ ID NO.4 and a downstream primer as shown in SEQ ID NO.5.

[0008] The third technical solution of the present invention is a kit, comprising the specific primer set.

[0009] A fourth technical solution of the present invention is the use of the Indel molecular marker, the specific primer set or the kit in identifying the oleic acid content of cotton seeds.

[0010] A fifth technical solution of the present invention is a method for identifying the oleic acid content of cotton seeds, which uses the specific primer set or the kit to detect the genotype of the Indel molecular marker of the cotton sample to be tested, and the oleic acid content of the seeds of individuals with the inserted genotype is significantly lower than that of individuals with the deleted genotype.

[0011] A sixth technical solution of the present invention is the use of the Indel molecular marker, the specific primer set or the kit in breeding for traits related to oleic acid content in cotton seeds.

[0012] A seventh technical solution of the present invention is a method for detecting the Indel molecular marker, comprising the following steps:

[0013] (1) Extracting DNA from cotton samples to be tested;

[0014] (2) using the extracted DNA as a template, and performing amplification using the specific primer set or the kit to obtain an amplified product;

[0015] (3) Identifying the genotype of the amplified product.

[0016] Based on the above technical solution, the present invention has the following technical effects:

[0017] The present invention obtains P1 haplotype (GhK3-792-del) and P2 haplotype (GhK3-792-ins) through differential analysis of promoter sequences of GhK3 genes of cotton inbred lines with different high / low oleic acid contents in seeds, further associates the two haplotypes with the oleic acid content in seeds, and finds that the oleic acid content in P2 haplotype cotton seeds is significantly higher than that in P1 haplotype cotton seeds. InDel markers are developed based on the two haplotypes, and the bands of the InDel markers are clearly distinguishable after electrophoresis detection. The band types of cotton varieties with different high / low oleic acid contents in seeds are obviously different and easy to distinguish. The detection method is simple and can be used for cotton molecular assisted breeding and identification of high-quality planting resources, thereby accelerating the creation of high-oleic acid enriched materials in cotton seeds and the process of breeding new varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1 Figure 2 is the oleic acid content of the NAM population and the whole genome association analysis. a is the distribution histogram of the oleic acid content of the NAM population, and b is the Manhattan plot of the oleic acid content of the NAM population.

[0020] Figure 2 The figure shows the LD block and haplotype analysis of oleic acid content. a is a local enlarged schematic diagram of the oleic acid significant interval, b is the LD block diagram of the oleic acid significant interval, c is the gene distribution diagram within the oleic acid significant interval, d is the haplotype analysis diagram of the oleic acid significant interval, and e is the oleic acid content diagram of the haplotype material.

[0021] Figure 3 The expression analysis diagram of GhK3 gene in cotton inbred line N10 and cotton inbred line N12. Among them, a is the oleic acid content diagram of cotton extreme materials, and b is the expression diagram of cotton extreme materials.

[0022] Figure 4 This is a comparison chart of the promoter sequence differences of the GhK3 gene between cotton inbred lines N10 and N12.

[0023] Figure 5 This is a diagram of the transcription factor binding site analysis of the 103 bp base pair InDel inserted into the promoter of the GhK3 gene.

[0024] Figure 6 Agarose gel electrophoresis is a phenotyping diagram. Among them, a is the gel electrophoresis phenotyping diagram of the full-length promoter, and b is the gel electrophoresis phenotyping diagram of the InDel marker.

[0025] Figure 7 Schematic diagram to verify the significant difference in oleic acid content in group typing. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0032] The embodiment of the present invention provides an Indel molecular marker related to the oleic acid content trait of cotton seeds. The Indel molecular marker is located on the GhK3 gene of chromosome D13 of the cotton genome, and an insertion or deletion of the nucleotide sequence shown in SEQ ID NO.1 exists at 792 bp of the GhK3 gene promoter.

[0033] The embodiment of the present invention also provides a specific primer set for detecting the Indel molecular marker, including an upstream primer as shown in SEQ ID NO.4 and a downstream primer as shown in SEQ ID NO.5.

[0034] The embodiment of the present invention further provides a kit, comprising the specific primer set.

[0035] The embodiment of the present invention also provides the use of the Indel molecular marker, the specific primer set or the kit in identifying the oleic acid content of cotton seeds.

[0036] The embodiment of the present invention also provides a method for identifying the oleic acid content of cotton seeds, using the specific primer set or the kit to detect the genotype of the Indel molecular marker of the cotton sample to be tested, and the oleic acid content of the seeds of individuals with the inserted genotype is significantly lower than that of individuals with the deleted genotype.

[0037] The embodiment of the present invention also provides the use of the Indel molecular marker, the specific primer set or the kit in breeding for traits related to oleic acid content in cotton seeds.

[0038] The embodiment of the present invention also provides a method for detecting the Indel molecular marker, comprising the following steps:

[0039] (1) Extracting DNA from cotton samples to be tested;

[0040] (2) using the extracted DNA as a template, and performing amplification using the specific primer set or the kit to obtain an amplified product;

[0041] (3) Identifying the genotype of the amplified product.

[0042] The present invention found that there is a variation in the promoter region of the GhK3 gene, which is significantly associated with the oleic acid content. Based on further research on the GhK3 gene, an Indel marker related to the oleic acid content of cottonseed was mined and obtained, and its application.

[0043] Example 1

[0044] 1 Screening of candidate genes

[0045] The present invention detects the oleic acid content in the seed materials of 1279 cotton recombinant inbred line populations, wherein the population is formed by hybridization and self-pollination of domestic excellent cotton materials Jinke 178, Zhongzhimian 3, and Lumianyan 28 as female parents and 5 Aizi cottons (Acala1517-77BR, AcalaSJ-3, Acala1517-75, Acala40, and Acala1517-95) as male parents, and the oleic acid content in the seeds is found to be 14.35%-21% (such as Figure 1The results show that 1279 different cotton inbred lines were deeply resequenced, and the grain oleic acid content data of four environments (Shihezi and Anyang, Xinjiang in 2017 and 2018) and the best linear unbiased prediction value (BLUP) were combined. Through genome-wide association analysis, it was found that the most significant polymorphic site (SNP) in multiple environments (Shihezi and Anyang, Xinjiang in 2017 and 2018) was located at position 1666730 of chromosome D13. There were 144 SNPs in this interval of 0.1Mb ​​(1.6-1.7Mb) that were related to grain oleic acid content (as shown in Figure 1). Figure 1 (as shown in b).

[0046] By performing LD block analysis on this interval, the interval can be divided into three main blocks: block 1, block 2, and block 3. Among them, the most significant polymorphic site of oleic acid is located in block 2 (such as Figure 2 At the same time, using haplotype analysis, this interval was divided into four haplotypes (Hap.1, Hap.2, Hap.3 and Hap.4). The oleic acid content of Hap.1 was significantly higher than that of other Hap (such as Figure 2 Combining the above two analyses, the significant interval affecting the cottonseed oleic acid content was finally located at D13: 1.628Mb-1.674Mb (as shown in Figure 2 (as shown in c), this significant interval contains 4 genes: Gh_D13G019900, Gh_D13G020000, Gh_D13G020100 (GhK3), and Gh_D13G020200.

[0047] 2 Structural analysis of candidate genes

[0048] Through deep resequencing data of the cottonseed whole genome, analysis found that there was a 103bp base insertion or deletion at the 792bp position of the promoter of the GhK3 gene (E3ubiquitin-protein ligase MIR1) in block2 (as shown in SEQ ID NO.1).

[0049] SEQ ID NO. 1: AACAAAAGGTTATATTCTGCTATTGGTCCCTGTTCTTTGTGAA AATTGTGAATTTAAACCTTATACTTTTTAAATTGGTCAAATTTTGAAATTTTAACAT TGA.

[0050] This indel was significantly correlated with cotton seed oleic acid content (P = 1.84e-48; Figure 3As shown in a). The SNPs and Indels in this region have a strong linkage disequilibrium relationship, indicating that the oleic acid content in the grains is significantly associated with Indels. According to the analysis results, among the 1279 cotton inbred lines, those with Indel deletions are Hap.1 haplotypes (n=306), those with Indel insertions are Hap.2, Hap.3 and Hap.4 haplotypes (n=911), and 62 materials are heterozygous here. GhK3-N10 is a representative of the insertion-type Hap.2 haplotype, and the oleic acid content in the grains of the inbred line N10 is low (15.74%); GhK3-N12 is a representative of the deletion-type Hap.1 haplotype, and the oleic acid content in the grains of the inbred line N12 is high (19.17%).

[0051] Using two cotton materials with significant differences in oleic acid content (such as Figure 3 RNA was extracted from ovules at different stages (5DPA, 20DPA, 30DPA, and 35DPA) and reverse transcribed to obtain cDNA. The transcriptome data were used to analyze the four candidate genes in this interval. It was found that the expression levels of the gene GhK3 at 20DPA, 30DPA, and 35DPA showed significant differences as the ovule development period increased (as shown in Figure a). Figure 2 (as shown in b).

[0052] Sequence analysis of the promoter region of the GhK3 gene in the seeds of cotton inbred line N10 with low oleic acid content and cotton inbred line N12 with high oleic acid content was performed. Figure 4 The promoter sequence corresponding to the P1 haplotype is shown in SEQ ID NO.2, and the promoter sequence corresponding to the P2 haplotype is shown in SEQ ID NO.3.

[0053] SEQ ID NO.2: TCATCCATACCACTGTTAAACAAAAGGTTATATTCTGCTATTG GTCCCTGTTCTTTGTGAAAATTGTGAATTTAAACCTTATACTTTTTAAATTGGTCAA ATTTTGAAATTTTAACATTGACCCAAATAGTAACAATTAAATTCAATTACTA;

[0054] SEQ ID NO.3: ATTATTGTACTATGTGTACAGCTGTACTATGTGTACTATTCTTC AACT.

[0055] Further sequence analysis revealed that GhK3-792-ins contained binding sites for transcription factors such as CPP, EIL, TALE, TCP, and WRKY. In addition, GhK3-792-del contained binding sites for bZIP transcription factors (such as Figure 5 It is speculated that this region may be regulated by related transcription factors, thereby changing its promoter activity and further affecting the expression level of the GhK3 gene.

[0056] 3 Development of molecular markers based on candidate genes

[0057] Based on the conclusion obtained in step 2 above (the insertion / deletion of 103 bp base at the +792 bp position of the promoter of the GhK3 gene is extremely significantly correlated with the oleic acid content in cotton seeds), specific primers were designed for the sequence difference of the InDel (GhK3-792-ins / del) in the promoter sequence to develop an InDel marker. The specific primer sequences are shown in SEQ ID NO.4 and SEQ ID NO.5:

[0058] SEQ ID NO.4: GhK3-F:5'-CCCCACTCTTACCAAATTCT-3';

[0059] SEQ ID NO.5: GhK3-R:5'-TGGACTAAATCTACAGCTGTACACA-3'.

[0060] DNA of two haploid cotton materials, namely, cotton inbred line N10 with low oleic acid content and cotton inbred line N12 with high oleic acid content in seeds, was extracted and used as templates for PCR amplification. PCR amplification was performed using designed promoter cloning primers and high-fidelity enzyme KOD FX neo to obtain different gene fragments.

[0061] The reaction system was: 2×KOD FX neo Mix 25 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, DNA template 1.6 μL and ddH 2 O 19.4 μL.

[0062] The PCR reaction program was as follows: step 1: 95°C for 3 min; step 2: 95°C for 15 sec, 56°C for 15 sec, 72°C for 60 sec, repeated for 35 cycles; step 3: 72°C for 5 min; step 4: stored at 12°C.

[0063] After the PCR reaction was completed, PCR detection was performed using 1.2% agarose gel electrophoresis. The results were as follows Figure 6As shown in a, the promoter band length of the P2 haplotype cloned from the N12 material is significantly smaller than the promoter band length of the P1 haplotype cloned from the N10 material, which is consistent with the sequencing analysis results that the promoter of the P1 haplotype is 2346 bp and the promoter of the P2 haplotype is 2242 bp.

[0064] The developed specific InDel markers such as SEQ ID NO.4 and SEQ ID NO.5 were used to detect the N10 and N12 materials. The results are as follows Figure 6 As shown in b, the length of the InDel marker band cloned in the N10 material is significantly greater than that of the InDel marker band cloned in the N12 material, which is consistent with the analysis result that the promoter of the P1 haplotype (GhK3-792-ins) is greater than the promoter of the P2 haplotype (GhK3-792-del). This specific InDel marker can be used to screen P1 and P2 haplotypes related to the oleic acid content in grains in breeding materials, and promote the breeding of cotton with high oleic acid content.

[0065] Example 2

[0066] Another 350 cotton materials consisting of 4 RIL populations were selected for InDel marker verification. The population used ZZ3 as the female parent and Acala1517-91, Acala4-42, ATX1, and B596 as the male parents. The four RIL populations formed after hybridization and self-pollination were named R1 (n=69), R2 (n=132), R3 (n=102), and R4 (n=47), respectively. The entire population and four subpopulations (R1, R2, R3, and R4) were typed using Indel markers, and the significance of the difference in oleic acid content between materials with different genotypes was analyzed.

[0067] The results showed that among the 350 materials, there were 198 GhK3-792-ins type materials and 152 GhK3-792-del type materials. The oleic acid content data of the two types of genotype materials were analyzed, and the results showed that the oleic acid content of the GhK3-792-del type population was significantly better than that of the GhK3-792-ins type population (Table 1), proving that the Indel marker has a significant effect in identifying the oleic acid content of cottonseed.

[0068] Table 1 Analysis of the significance of the validation data of Indel markers

[0069]

[0070] Note: *** indicates significant difference (p<0.005).

[0071] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. An Indel molecular marker related to cotton seed oleic acid content, characterized in that: The Indel molecular marker is located on the GhK3 gene of the D13 chromosome of the cotton genome, and there is an insertion or deletion of the nucleotide sequence shown in SEQ ID NO.1 at 792 bp of the GhK3 gene promoter.

2. A specific primer set for detecting the Indel molecular marker according to claim 1, characterized in that: It includes an upstream primer as shown in SEQ ID NO.4 and a downstream primer as shown in SEQ ID NO.

5.

3. A kit, characterized in that: The specific primer set according to claim 2 is included.

4. Use of the Indel molecular marker according to claim 1, the specific primer set according to claim 2 or the kit according to claim 3 in identifying the oleic acid content of cotton seeds.

5. A method for identifying the oleic acid content of cotton seeds, characterized in that: The specific primer set of claim 2 or the kit of claim 3 is used to detect the genotype of the Indel molecular marker of the cotton sample to be tested. The oleic acid content of the grains of the individuals with the inserted genotype is significantly lower than that of the individuals with the deleted genotype.

6. Use of the Indel molecular marker according to claim 1, the specific primer set according to claim 2 or the kit according to claim 3 in breeding for traits related to oleic acid content in cotton seeds.

7. A method for detecting the Indel molecular marker according to claim 1, characterized in that: The following steps are involved: (1) Extracting DNA from cotton samples to be tested; (2) using the extracted DNA as a template, and performing amplification using the specific primer set described in claim 2 or the kit described in claim 3 to obtain an amplified product; (3) Identifying the genotype of the amplified product.

Images