SV molecular marker related to tuberization concentration ratio of cassava and application of SV molecular marker

Abstract

The invention provides an SV molecular marker related to the tuberization concentration ratio of cassava and application, and belongs to the technical field of molecular biology, the SV molecular marker is Chr173020236830202617 and is used for predicting the tuberization concentration ratio of cassava; a primer group for amplifying the SV molecular marker comprises an upstream primer, a downstream primer, an upstream primer, a downstream primer and a downstream primer, wherein the sequence of the upstream primer is 5 '-AACAAGAAACAACTGTGCAT-3'; the sequence of the downstream primer is 5 '-CTGCCACTTGGCTCATCT-3', and the sequence of the downstream primer is 5 '- The primer group is used for preparing the kit; the primer group or the kit is used for carrying out PCR amplification on the DNA of the cassava to be detected so as to predict the tuberization concentration ratio of the cassava. The SV molecular marker provided by the invention can accurately and efficiently predict the tuberization concentration ratio of cassava without planting and waiting for cassava adult plants, so that the breeding selection efficiency is greatly improved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and relates to an SV molecular marker related to cassava tuber concentration and an application thereof, which solves the problems of long breeding time and high breeding cost for new cassava varieties related to tuber concentration index in the prior art. Background Art

[0002] Cassava, also known as sweet potato, tree sweet potato, and wood root, is a tropical and subtropical perennial shrub crop that is widely cultivated in tropical and subtropical regions around the world. Cassava tubers are large and rich in starch. They have a rough and rustic appearance. The tubers are of various shapes and rough skin, but the internal starch content is extremely high, the texture is fine, the powder is white, and the taste is soft. It is an important food and industrial raw material, and is known as the "king of starch", "treasure of tropical crops", and "energy crop". Mature cassava tubers are rich in starch, and their starch particles are large and high in purity. They have excellent processing properties and important edible and industrial value. Therefore, the development of cassava production will greatly promote the development of related industries such as food processing, bioenergy, papermaking, textiles, and feed, which is of great significance.

[0003] Cassava tuber concentration refers to the concentration of cassava tubers on the plant. This trait is of great significance in the cultivation and utilization of cassava. Cassava varieties with high tuber concentration usually have tubers that are more concentrated, which is convenient for management and harvesting, and helps to improve the stability of yield. Concentrated tubers can more effectively utilize nutrients and water in the soil, reduce competition, and thus increase overall yield. Concentrated tubers are convenient for mechanized harvesting, reducing labor costs and labor intensity. Mechanized harvesting can improve harvesting efficiency, reduce losses during the harvesting process, and improve overall economic benefits.

[0004] In traditional cassava molecular breeding, farmers or breeders mainly select individual plants with excellent traits and fix the excellent traits through hybridization or backcrossing. At present, if you want to obtain cassava varieties with high tuber concentration, you need to wait for the plants to mature and investigate the distribution of tubers to screen excellent plants. This breeding method takes a long time and has high breeding costs. Summary of the invention

[0005] In view of the above problems, the present invention provides an SV molecular marker related to cassava tuber concentration and its application.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is: An SV molecular marker related to cassava tuber concentration, the SV molecular marker is a large fragment deletion occurring at bases 30202368 to 30202617 of chromosome 17 (Chr17) of the cassava genome, the sequence deletion length is 250 bp, named Chr17_30202368_30202617, and the sequence is shown in SEQ ID NO: 1; The proportion of cassava populations carrying the SV molecular marker whose tuber concentration was dispersed was lower than that of cassava populations lacking the SV molecular marker (i.e., a large deletion of bases 30202368 to 30202617 on chromosome 17). The tuber concentration trait of cassava carrying SV molecular markers showed concentrated; The tuber concentration of cassava lacking this SV molecular marker was dispersed.

[0007] An application of the above-mentioned SV molecular marker related to the tuber concentration of cassava, the application is to predict the tuber concentration of cassava by detecting whether the cassava carries the SV molecular marker.

[0008] A primer set for amplifying the above-mentioned SV molecular marker related to the tuber concentration of cassava, wherein the primer set is a set of primers designed upstream and downstream of the above-mentioned SV molecular marker, that is, the upstream primer is designed based on the sequence upstream of nucleotide 30202368 of chromosome 17 of the cassava genome, and the downstream primer is designed based on the sequence downstream of nucleotide 30202617 of chromosome 17 of the cassava genome, comprising: The sequence of the upstream primer was 5′-AACAAGAAACAAACTGTGCAT-3′; The sequence of the downstream primer was 5'-CTGCCACTTGGCTCATCT-3'.

[0009] A kit comprising the above primer set.

[0010] Furthermore, the kit includes conventional reagents for PCR amplification.

[0011] Furthermore, the kit includes: 2× Rapid Taq Master Mix and ddH2O.

[0012] A method for identifying the tuber concentration of cassava, the method comprising using the above primer set to perform PCR amplification on the DNA of the cassava to be tested to predict the tuber concentration of the cassava; Alternatively, the above kit is used to perform PCR amplification on the DNA of the cassava to be tested to predict the tuber concentration of the cassava.

[0013] Furthermore, predicting the tuber concentration of cassava is to sequence the PCR amplification product to determine whether it carries the SV molecular marker to predict the tuber concentration of cassava; When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, the length is 543 bp, and the 149th to 398th bases of the sequence from the 5' end (i.e. the front end of the sequence) are SV molecular marker fragments, and the product to be tested carries the SV molecular marker, then the cassava tuber concentration trait to be tested is concentrated.

[0014] Otherwise, the cassava to be tested lacks the SV molecular marker, that is, a large fragment deletion occurs in bases 30202368 to 30202617 of chromosome 17 in the sample genome, and the length of the PCR amplification product is 293 bp, then the tuber concentration of the cassava to be tested is dispersed.

[0015] Furthermore, the tuber concentration of cassava is predicted by performing electrophoresis detection on the PCR amplification products and interpreting the electrophoresis detection results to predict the tuber concentration of cassava; When only a 543 bp band appears in the electrophoresis detection result, the cassava to be tested carries the SV molecular marker, and the tuber concentration trait of the cassava to be tested is concentrated; When only a 293 bp band appears in the electrophoresis detection result, the cassava to be tested lacks the SV molecular marker, and the tuber concentration of the cassava to be tested is dispersed.

[0016] Furthermore, the PCR amplification system includes: 2× Rapid Taq Master Mix 12.5 μL, the upstream primer 1 μL with a concentration of 10 μM, the downstream primer 1 μL with a concentration of 10 μM, the DNA template of cassava to be tested 1 μL and ddH2O 9.5 μL; The reaction program of PCR amplification was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, for 35 cycles; and 72°C for 5 min.

[0017] The beneficial effects of the SV molecular markers related to cassava tuber concentration and the application of the present invention are: The present invention develops an SV molecular marker related to the tuber concentration of cassava, which can accurately and efficiently predict the tuber concentration status in a cassava population without planting and waiting for the cassava to mature, greatly improving the selection efficiency of cassava breeding, and can efficiently assist in the breeding selection of cassava, with extremely high economic value; The present invention develops an SV molecular marker related to the tuber concentration of cassava, and establishes a method for accurately and quickly identifying the tuber concentration of cassava, which provides a more effective theoretical and practical basis for molecular marker-assisted breeding of new cassava varieties with high tuber concentration; using this molecular marker-assisted breeding technology can speed up the investigation of cassava tuber concentration, facilitate the screening of excellent plants, shorten the breeding cycle, and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is a Manhattan plot of the genome-wide chromosome association analysis positioning of 337 cassava tuber concentration trait data in Example 1 of the present invention; Figure 2 It is the typing test result of tuber concentration of 256 cassavas in Example 5 of the present invention; wherein, REF represents cassava carrying SV molecular markers, and n=53 represents a sample size of 53; DEL represents cassava lacking SV molecular markers, and n=203 represents a sample size of 203. DETAILED DESCRIPTION

[0019] The technical solutions in the embodiments of the present invention are described clearly and completely below. In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention can also be implemented in other ways different from those described herein, and those skilled in the art can make similar generalizations without violating the connotation of the present invention, so the present invention is not limited by the specific embodiments disclosed below. The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0020] Example 1 Obtaining SV molecular markers related to cassava tuber concentration The genome resequencing data of 337 cassava samples grown in Danzhou City, Hainan Province, China (109.5°E, 19.5°N) were collected. The quality-controlled sequencing data were aligned to the cassava reference gene to obtain the cassava whole-genome SV molecular marker map. The whole-genome association analysis was performed in combination with the cassava phenotypic data. The results are as follows Figure 1 As shown, it can be seen that there is an SV molecular marker on the cassava genome that is significantly associated with the cassava tuber concentration trait ( Figure 1 (where the arrow points).

[0021] The SV molecular marker related to the tuber concentration of cassava is a large fragment deletion occurring at bases 30202368 to 30202617 of chromosome 17 (Chr17) of the cassava genome. The sequence deletion is 250 bp in length and is named Chr17_30202368_30202617. The sequence is shown in SEQ ID NO: 1.

[0022] Using the SV molecular marker, cassava breeding materials were tested. The proportion of dispersed tuber concentration in the cassava population carrying the SV molecular marker was lower than that in the cassava population lacking the SV molecular marker (i.e., a large fragment deletion occurred at bases 30202368 to 30202617 of chromosome 17). In other words, the tuber concentration trait of cassava carrying the SV molecular marker is concentrated, while the tuber concentration of cassava lacking the SV molecular marker is dispersed.

[0023] Therefore, the use of this SV molecular marker can accurately and efficiently predict the tuber concentration of cassava without planting and waiting for the cassava to mature, greatly improving the selection efficiency of cassava breeding, and can effectively assist in cassava breeding selection, with extremely high economic value.

[0024] Example 2 Primer set and kit for identifying cassava tuber concentration Using the characteristics of the SV molecular marker related to cassava tuber concentration on the cassava genome in Example 1, a set of primers were designed upstream and downstream of the SV molecular marker, that is, the upstream primer was designed based on the sequence upstream of nucleotide 30202368 of chromosome 17 of the cassava genome, and the downstream primer was designed based on the sequence downstream of nucleotide 30202617 of chromosome 17 of the cassava genome.

[0025] The sequence of the upstream primer was 5′-AACAAGAAACAAACTGTGCAT-3′; The sequence of the downstream primer was 5′-CTGCCACTTGGCTCATCT-3′; Among them, the upstream primer is based on the sequence upstream of nucleotide 30202368 of chromosome 17 of the cassava genome: 5'-TTAACAAGAAACAAACTGTGCATATTGTTTTATATTTAGGAAATATGTTTTCATGTTTTTATGTACATATATAATTATATATACACGTTTTAAATTTTCATATTTTTTTATAATATTATAGATAATTTATATAAGAAATATTTAATATAA-3'; The downstream primer is based on the sequence of nucleotide 30202617 downstream of chromosome 17 of the cassava genome: 5'-TTAATAAAAATACTCTTTTTTTTTTCTAACAGAATAAATTGTTTTTTATTGCAAGATGGAGCGAATTGCAGCTTTTTTGCCGCATTTTCAAATATTATATTATAAAATTACCTAATTGTTTGGAATAAGATGAGCCAAGTGGCAGTTATG-3'.

[0026] When designing primers, in order to enhance the applicability and sensitivity of the primers, the designed primer length is between 18 and 25 bp, and the primers do not interfere with each other. The above two primers can be obtained by artificial synthesis.

[0027] This embodiment also provides a kit for identifying the concentration of cassava tubers, which includes the above primer set.

[0028] The kit also includes common reagents for PCR amplification, such as 2× Rapid Taq Master Mix and ddH2O.

[0029] The primer set designed by the present invention has strong specificity and can accurately amplify the sequence carrying / lacking the SV molecular marker of the present invention.

[0030] By using the primer set or the kit of the present invention, the tuber concentration of cassava can be accurately and efficiently predicted without planting and waiting for the cassava to mature.

[0031] Example 3 Method for Identifying Cassava Tuber Concentration This embodiment provides a method for identifying cassava tuber concentration, and the specific method comprises the following steps: S1, extracting the DNA of the cassava to be tested as a DNA template; S2, using the primer set in Example 2 to perform PCR amplification on the DNA template of cassava to be tested; The reaction system for PCR amplification was: 2× Rapid Taq Master Mix 12.5 μL, upstream primer 1 μL at a concentration of 10 μM, downstream primer 1 μL at a concentration of 10 μM, DNA template 1 μL, and ddH2O 9.5 μL. Mix (amplification buffer) was purchased from Novozyme Biotech Co., Ltd., and the primer set was commissioned to be synthesized by Beijing Aoke Dingsheng Biotechnology Co., Ltd.

[0032] The reaction program of PCR amplification was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, for 35 cycles; and 72°C for 5 min.

[0033] S3. Sequence the obtained PCR amplification product to determine whether it carries the SV molecular marker fragment.

[0034] When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, the length is 543 bp, and the 149th to 398th bases of the sequence from the 5' end (i.e. the front end of the sequence) are SV molecular marker fragments, and the product to be tested carries the SV molecular marker, then the cassava tuber concentration trait to be tested is concentrated.

[0035] Otherwise, the cassava to be tested lacks the SV molecular marker, that is, a large fragment deletion occurs in bases 30202368 to 30202617 of chromosome 17 in the sample genome, and the length of the PCR amplification product is 293 bp, then the tuber concentration of the cassava to be tested is dispersed.

[0036] Alternatively, the PCR amplification product is subjected to electrophoresis detection, and the electrophoresis detection result is interpreted; When only a 543 bp band appears in the electrophoresis detection result, the cassava to be tested carries the SV molecular marker, and the tuber concentration trait of the cassava to be tested is concentrated; When only a 293 bp band appears in the electrophoresis detection result, the cassava to be tested lacks the SV molecular marker, and the tuber concentration of the cassava to be tested is dispersed.

[0037] Among them, the tuber concentration trait is concentrated, which means that the tubers are mainly concentrated in a certain area of ​​the plant, usually manifested as a large number of tubers and dense distribution.

[0038] Tuber concentration is dispersed, which means that the distribution of tubers on the plant is relatively scattered, the number of tubers is small, and the distribution is sparse.

[0039] Example 4 Detection and verification of SV molecular markers in cassava To verify the practicality of the SV molecular marker, several cassava plants (excluding 337 cassavas used for the development of SV molecular markers) were randomly selected in the cassava planting area of ​​Danzhou City, Hainan Province, China (109.5° east longitude, 19.5° north latitude). The method in Example 3 was used to determine whether they carried the SV molecular marker through PCR amplification, and the root tuber concentration of these cassava samples was investigated. The results are shown in Tables 1 and 2 below.

[0040] Table 1 Whether 20 cassava plants carry SV molecular markers and tuber concentration (cm)

[0041] Table 2 Statistical table of whether 20 cassava plants carry SV molecular markers and the proportion of tuber concentration (%)

[0042] It can be seen from Tables 1 and 2 that the method of the present invention can identify whether cassava carries the SV molecular marker, thereby predicting the tuber concentration of cassava; the tuber concentration trait of cassava carrying the SV molecular marker is concentrated; the tuber concentration trait of cassava lacking the SV molecular marker is dispersed.

[0043] Since the properties of cassava are not only regulated by cassava-related genes, but also affected by other factors such as the environment, for example, environmental conditions such as soil fertility, water supply, and temperature will affect the tuber concentration. Therefore, there will be a small number of single cassavas carrying the SV molecular marker whose tuber concentration shows a dispersed phenotype. However, based on the cassava population carrying the SV fragment, the tuber concentration has a centralized trend, that is, the cassava with a higher proportion in the population shows a concentrated tuber. Therefore, it can be explained that the method of the present invention can be used to identify the concentration or dispersion of the tuber concentration of cassava.

[0044] Example 5 Detection of SV molecular markers in cassava Further, 256 cassava samples were typed using the method in Example 3. The results are as follows: Figure 2 As shown in the figure, 53 samples carried the SV molecular marker and 203 samples lacked the SV molecular marker. The proportion of scattered tuber concentration in the cassava sample population carrying the SV molecular marker was 33.96%, and the proportion of concentrated tuber concentration was 66.04%; the proportion of scattered tuber concentration in the cassava sample population lacking the SV molecular marker was 68.47%, and the proportion of concentrated tuber concentration was 31.53%; that is, the proportion of scattered tuber concentration in the cassava population carrying the SV molecular marker was less than the proportion of scattered tuber concentration in the cassava population lacking the SV molecular marker, and there was a significant difference.

[0045] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, rather than all the embodiments. A person skilled in the art can also obtain other embodiments based on the embodiments without inventiveness, and these embodiments all belong to the protection scope of the present invention.

Claims

1. An SV molecular marker related to cassava tuber concentration, characterized in that: The sequence of the SV molecular marker is shown in SEQ ID NO: 1; The tuber concentration trait of cassava carrying SV molecular markers is concentrated.

2. An application of the SV molecular marker related to cassava tuber concentration according to claim 1, characterized in that: The application is to predict the tuber concentration of cassava by detecting whether cassava carries SV molecular markers.

3. A primer set for amplifying the SV molecular marker associated with cassava tuber concentration according to claim 1, characterized in that: The primer set comprises: The sequence of the upstream primer was 5′-AACAAGAAACAAACTGTGCAT-3′; The sequence of the downstream primer was 5'-CTGCCACTTGGCTCATCT-3'. A kit comprising the primer set according to claim 3.

5. The kit according to claim 4, characterized in that The kit includes conventional reagents for PCR amplification.

6. The kit according to claim 5, characterized in that The kit includes: 2× Rapid TaqMaster Mix and ddH2O.

7. A method for identifying cassava tuber concentration, characterized in that: The method comprises using the primer set of claim 3 to perform PCR amplification on the DNA of the cassava to be tested, so as to predict the tuber concentration of the cassava; Alternatively, the kit according to any one of claims 4 to 6 is used to perform PCR amplification on the DNA of the cassava to be tested to predict the tuber concentration of the cassava.

8. The method for identifying cassava seeding concentration according to claim 7, characterized in that: The tuber concentration of cassava is predicted by sequencing the PCR amplification product to determine whether it carries the SV molecular marker to predict the tuber concentration of cassava.

9. The method for identifying cassava seeding concentration according to claim 7, characterized in that: The tuber concentration of cassava is predicted by electrophoresis detection of PCR amplification products and interpretation of the electrophoresis detection results to predict the tuber concentration of cassava; When only a 543 bp band appears in the electrophoresis detection result, the cassava to be tested carries the SV molecular marker, and the tuber concentration trait of the cassava to be tested is concentrated; When only a 293 bp band appears in the electrophoresis detection result, the cassava to be tested lacks the SV molecular marker, and the tuber concentration of the cassava to be tested is dispersed.

10. The method for identifying cassava tuber concentration according to any one of claims 7 to 9, characterized in that: The PCR amplification system includes: 2× Rapid Taq Master Mix, the upstream primer, the downstream primer, the DNA template of cassava to be tested and ddH2O; The reaction program of PCR amplification was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, 35 cycles; 72°C for 5 min.

Images