Application of trelaglitazone in preparation of medicine for preventing or treating neurodegenerative diseases

Abstract

The invention discloses application of trelaglitazone in preparation of a medicine for preventing or treating neurodegenerative diseases, a PC12 cell oxidative damage model induced by H2O2 or 6-OHDA is adopted to evaluate the neuroprotective effect of the trelaglitazone, and the result shows that the trelaglitazone can effectively resist oxidative damage induced by H2O2 or 6-OHDA and plays a good neuroprotective effect. In-depth study finds that trelaglitazone can activate a KEAP1 / Nrf2 / ARE pathway, promote dissociation of Nrf2 from KEAP1, translocation to a cell nucleus and combination with ARE, further regulate and control transcription and protein expression of downstream antioxidant genes and enhance the capability of cells in scavenging reactive oxygen free radicals and oxidative stress products, so that the trelaglitazone has a good neuroprotection function. Therefore, the resistance of cells to oxidative damage is obviously improved. Therefore, the trelaglitazone with the neuroprotective effect can be applied to preparation of drugs for preventing or treating neurodegenerative diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the use of troglitazone in preparing drugs for preventing or treating neurodegenerative diseases. Background Art

[0002] Neurodegenerative diseases, such as Parkinson's disease and Alzheimer's disease, are serious diseases caused by progressive neuronal damage and death. Neurodegenerative diseases are closely related to oxidative stress. By protecting nerve cells from oxidative damage, the development of neurodegenerative diseases can be effectively inhibited, thereby achieving the purpose of preventing and treating neurodegenerative diseases. Therefore, in-depth research on the mechanism of action of such diseases and finding effective drugs to treat anti-oxidative stress have become a research hotspot in this field. Redox homeostasis is the key to maintaining normal physiological functions of the body, and oxidative stress caused by redox imbalance, especially excessive accumulation of reactive oxygen species (ROS), is closely related to neurodegenerative diseases. Cells enhance antioxidant defense mechanisms by activating nuclear factor E2-related factor 2 (Nrf2). As a key transcription factor, Nrf2 regulates the expression of genes containing antioxidant response elements (AREs) to fight oxidative stress in the brain, becoming an important target for the treatment of neurodegenerative diseases.

[0003] Troglitazone is an approved oral thiazolidinedione antidiabetic drug that has attracted widespread attention due to its significant efficacy in improving blood sugar control in patients with type 2 diabetes. In addition to the traditional hypoglycemic effect, with the deepening of research, troglitazone has also been found to have multiple biological activities such as improving insulin resistance, anti-proliferation and redifferentiation, anti-tumor, and anti-oxidation and anti-inflammatory. However, there have been no reports on the use of troglitazone in the preparation of neuroprotective drugs. Summary of the invention

[0004] In view of the problems existing in the prior art, the object of the present invention is to provide the use of troglitazone in the preparation of drugs for preventing or treating neurodegenerative diseases.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] The first aspect of the present invention provides the use of troglitazone in the preparation of a drug for preventing or treating neurodegenerative diseases.

[0007] Preferably, the neurodegenerative disease includes but is not limited to Parkinson's disease, Alzheimer's disease, Huntington's disease or amyotrophic lateral sclerosis.

[0008] The second aspect of the present invention provides a pharmaceutical composition comprising troglitazone as an active ingredient and a pharmaceutically acceptable carrier or excipient.

[0009] The present invention has the following beneficial effects:

[0010] (1) In the present invention, the neuroprotective effect of troglitazone was evaluated by using a PC12 cell oxidative damage model induced by H2O2 or 6-OHDA. The results showed that troglitazone could effectively resist the oxidative damage induced by H2O2 or 6-OHDA and exerted a good neuroprotective effect.

[0011] (2) Through in-depth research, the present invention found that troglitazone can effectively resist the neurotoxicity induced by oxidative stressors such as H2O2 and 6-OHDA in PC12 cells, and play a significant neuroprotective role. The core of its protective mechanism is that troglitazone can promote Nrf2 to dissociate from KEAP1 and translocate to the nucleus after activating the key anti-oxidative stress response pathway of KEAP1 / Nrf2 / ARE, and bind to ARE, thereby regulating the transcription and protein expression of a series of downstream antioxidant genes, enhancing the ability of cells to scavenge reactive oxygen free radicals and oxidative stress products, thereby significantly improving the defense ability of cells against oxidative damage. The present invention not only enriches and broadens the pharmacological action range of troglitazone, provides new strategies and targets for the prevention and treatment of neurodegenerative diseases, but also provides valuable references and inspirations for the research and development of similar drugs, and has great scientific significance and clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0013] Figure 1 This is a graph showing the toxicity of troglitazone to PC12 cells;

[0014] Figure 2 The results of the MTT assay to detect the neuroprotective effect of troglitazone on H2O2 and 6-OHDA-damaged PC12 cells are shown in the figure below: (A) The neuroprotective effect of troglitazone on H2O2-damaged PC12 cells; (B) The neuroprotective effect of troglitazone on 6-OHDA-damaged PC12 cells;

[0015] Figure 3 The results of the lactate dehydrogenase (LDH) method to detect the protective effect of troglitazone on PC12 cells injured by H2O2 and 6-OHDA are shown in the figure: (A) The results of the neuroprotective effect of troglitazone on H2O2 injury; (B) The results of the neuroprotective effect of troglitazone on 6-OHDA injury;

[0016] Figure 4The diagrams are the docking results of troglitazone and KEAP1 protein molecules: (A) 3D diagram of troglitazone and KEAP1 protein molecule docking; (B) 2D diagram of troglitazone and KEAP1 protein molecule docking;

[0017] Figure 5 This is the result diagram showing that troglitazone promotes Nrf2 to enter the cell nucleus;

[0018] Figure 6 This is a result diagram of verifying the binding of troglitazone to KEAP1 through thermal drift experiment;

[0019] Figure 7 This is a graph showing the results of the detection of the activation ability of troglitazone on ARE transcription factors;

[0020] Figure 8 Results of the neuroprotective effect test of troglitazone after knocking out Nrf2: (A) Nrf2 knockdown effect test; (B) MTT method to detect the neuroprotective effect of troglitazone on H2O2 injury before and after Nrf2 knockdown; (C) LDH method to detect the neuroprotective effect of troglitazone on H2O2 injury before and after Nrf2 knockdown; (D) MTT method to detect the neuroprotective effect of troglitazone on 6-OHDA2 injury before and after Nrf2 knockdown; (E) LDH method to detect the neuroprotective effect of troglitazone on 6-OHDA2 injury before and after Nrf2 knockdown;

[0021] Fig. 9 This is the result diagram of scavenging DPPH free radical by troglitazone;

[0022] Fig.10 This is the result diagram of troglitazone regulating related antioxidant genes;

[0023] Fig.11 The results of troglitazone regulating the expression of related antioxidant proteins are shown in the figure below: (A) Troglitazone-induced increase in HO-1 protein level; (B) Troglitazone-induced increase in NQO1 protein level; (C) Troglitazone-induced increase in Trx1 protein level; (D) Troglitazone-induced increase in TrxR1 protein level;

[0024] Fig.12 The results of Hoechst 33324 and DCFH-DA fluorescence staining of troglitazone are as follows: (A) Hoechst 33324 and DCFH-DA fluorescence staining under H2O2 injury conditions; (B) Hoechst 33324 and DCFH-DA fluorescence staining under 6-OHDA injury conditions. DETAILED DESCRIPTION

[0025] In the following description, for the purpose of illustration rather than limitation, specific details such as specific system structures and technologies are provided to provide a thorough understanding of the embodiments of the present invention. However, it should be clear to those skilled in the art that the present invention may also be implemented in other embodiments without these specific details.

[0026] Example 1

[0027] The pharmacological effects of troglitazone on the neuroprotective activity were tested in PC12 neurons and H2O2-injured and PC12 neurons.

[0028] 1) Testing the protective activity of troglitazone on PC12 cells

[0029] (1.1) Study on the cytotoxic effect of troglitazone on PC12 cells

[0030] Experimental method: Adrenal pheochromocytoma PC12 cells were cultured in a 37°C, 5% CO2 cell culture incubator using DMEM medium containing 10% fetal bovine serum, glutamine (2 mM), and penicillin / streptomycin (100 U / mL).

[0031] A control group and a drug group were set up, wherein the control group contained no drug, and the drug groups were divided into a troglitazone low concentration group (5 μM), a medium concentration group (10 μM), a high concentration group (20 μM) and a highest concentration group (40 μM).

[0032] PC12 cells growing in logarithmic growth were cultured at 2.5×10 4 / well were inoculated in a 96-well plate. When the cells grew to 80% confluence, the medium was aspirated and pre-configured 5μM, 10μM, 20μM and 40μM concentrations of troglitazone were added. The cells were incubated at 37°C for 24h, and then 20μL of MTT was added and incubated for another 4h. After the incubation, the medium was aspirated and 150μL of DMSO was added and shaken for 10min. The absorbance (OD) was measured at 570nm using an enzyme reader to calculate the cell viability. This experiment used the MTT method to determine the effect of troglitazone on cell viability. Results are shown in Figure 1 .

[0033] Depend on Figure 1 The results show that the cell survival rates of different concentrations of troglitazone in each group are all above 90%, which indicates that troglitazone has no toxic effect on PC12 cells at concentrations of 40 μM and below, that is, troglitazone at this concentration will not cause damage to PC12 cells.

[0034] (1.2) MTT assay was used to detect the protective effect of troglitazone on PC12 cells damaged by H2O2 or 6-OHDA

[0035] Experimental method: A control group, a drug group and an injury group were set up. The control group did not contain drugs, and the drug group was divided into 1.25μM, 2.5μM, 5μM, 10μM, 20μM and 40μM according to the low concentration of troglitazone. The injury group was divided into H2O2 injury group and 6-OHDA injury group.

[0036] PC12 cells growing in logarithmic growth were cultured at 2.5×10 4 / well were inoculated in a 96-well plate. When the cells grew to 80% confluence, the original culture medium was discarded and pre-prepared culture medium containing different concentrations of troglitazone was added. The cells were incubated at 37°C for 24 hours. After the incubation, the culture medium was discarded. The culture medium containing 500μM H2O2 or 6-OHDA was added to damage the cells. When about half of the cells died, the damage was terminated by observing under a microscope. The culture medium was replaced with a culture medium containing 10% MTT. The cells were allowed to stand for 4 hours, and then a triple solution (10% SDS, 5% isobutanol and 0.1% HCl) was added. After the generated formazan was completely dissolved, the absorbance value was measured at 570nm using an enzyme reader to calculate the cell survival rate. The results are shown in Figure 2 .

[0037] Here, 500μM H2O2 or 6-OHDA was used to model H2O2 oxidative damage in PC12 cells, and then troglitazone at concentrations of 5μM, 10μM, 20μM and 40μM was added for intervention experiments to study the protective effect of troglitazone on PC12 cells damaged by H2O2. 500μM 6-OHDA was used to model 6-OHDA oxidative damage in PC12 cells, and then troglitazone at concentrations of 1.5μM, 2.5μM, 5μM and 10μM was added for intervention experiments to study the protective effect of troglitazone on PC12 cells damaged by 6-OHDA.

[0038] Depend on Figure 2 The results show that compared with the drug group incubated with troglitazone, the cell survival rate of the model group treated with H2O2, i.e., the H2O2 injury group, was significantly reduced, and with the increase of the concentration of the added troglitazone drug, the survival rate of the PC12 cells damaged by oxidation also showed a significant upward trend. Therefore, it can be concluded that troglitazone has a good neuroprotective effect on PC12 cells induced by H2O2, and the effective protection concentration is 10-40μM. Compared with the drug group incubated with troglitazone, the cell survival rate of the model group treated with 6-OHDA, i.e., the 6-OHDA injury group, was significantly reduced, and with the increase of the concentration of the added troglitazone drug, the survival rate of the PC12 cells damaged by oxidation also basically showed an upward trend. Therefore, it can be concluded that troglitazone has a good neuroprotective effect on PC12 cells induced by 6-OHDA, and the effective protection concentration is 1.25-10μM.

[0039] The above results indicate that troglitazone can effectively resist the oxidative damage of H2O2 or 6-OHDA and exert its neuroprotective effect (in the figure, * represents the comparison with the untreated cell group, *P<0.05, **P<0.01, ***P<0.001). # Compared with the H2O2 or 6-OHDA injury group, # P<0.05, ## P<0.01, ### P<0.001)

[0040] (1.3) Lactate dehydrogenase (LDH) assay was used to detect the protective effect of troglitazone on PC12 cells oxidatively damaged by H2O2 or 6-OHDA

[0041] Experimental method: PC12 cells were seeded in 96-well plates and incubated for 24 hours with different concentrations of troglitazone (5μM, 10μM, 20μM and 40μM). After the incubation, the culture medium was removed and 500μM H2O2 or 6-OHDA was added to damage the cells. The culture medium was removed after the cells were damaged to about 50% of their activity. The lactate dehydrogenase (LDH) kit of GlpBio was then used for LDH detection. The manufacturer's instructions were followed. The test results are shown in Figure 3 .

[0042] Depend on Figure 3 The results showed that the lactate dehydrogenase released by the troglitazone group was significantly less than that of the H2O2 injury group and the 6-OHDA injury group, indicating that troglitazone has a certain protective effect on the damage of H2O2 or 6-OHDA. The LDH test results are consistent with the MTT test results, further indicating that troglitazone can effectively resist the oxidative damage of H2O2 or 6-OHDA and play its neuroprotective role (in the figure, * represents compared with the untreated cell group, *P<0.05, **P<0.01, ***P<0.001). # Compared with the H2O2 or 6-OHDA injury group, # P<0.05, ## P<0.01, ### P<0.001).

[0043] 2) Docking study of troglitazone and KEAP1 protein molecule

[0044] Experimental method: The three-dimensional structure of the KEAP1 protein molecule (PDB ID: 4IQK) is from the PDB protein structure database, and the structure of troglitazone is from the Pubchem database. When preparing the protein receptor, AutoDockTools 1.5.7 was used and operations such as removing small molecule ligands, removing water and adding hydrogen were performed. The docking type was set to semi-flexible docking, the ligand was set to rigid, and the small molecule ligand was set to flexible. For the small molecule ligand, the present invention used the B3LYPB3LYP classical generalization method of the atomic molecular orbital (MO) program Gaussian09 (G09) to comprehensively optimize the structure, and the group was set to 6-31G (d) to obtain the energy-minimized structure. Finally, the prepared protein and troglitazone were subjected to molecular docking simulation using Autodock vina software. The coordinates of the ligand center and the ligand frame were obtained from the co-crystal structure downloaded from the PDB database using PyMol software. In the docking of KEAP1 and troglitazone, the XYZ coordinates of the KEAP1 binding site were set to −47.2, 4.1, and −14.9, respectively, and the dimensions of the docking box along the X, Y, and Z axes were set to 20 × 19.9 × 16.6, with a grid spacing of Results Figure 4 .

[0045] Depend on Figure 4 The results show that the affinity of troglitazone to KEAP1 is -10.7 kcal / mol, which indicates that the affinity between the two is very strong (a binding energy less than -5 kcal / mol is a good binding). By using two-dimensional and three-dimensional visualization software, the binding sites formed by Tyr334, Tyr572, Arg415, Ala556, Ala510, Phe577 and Ser602 can be observed. Among them, Tyr334, Tyr572, Arg415, Ala556 and Phe577 have hydrophobic interactions and form four hydrogen bonds with Ala510, Ala556, Arg415 and Ser602. In addition, a π-π stacking bond is formed between Tyr334 and troglitazone, which indicates that troglitazone binds to KEAP1 and has a strong binding ability.

[0046] (5) Effect of troglitazone on the entry of Nrf2 into the cell nucleus.

[0047] Experimental method: After PC12 cells were cultured with troglitazone for 0, 2, 4, 6, and 8 hours, PC12 cells were collected and lysed in buffer A, which consisted of 1mM PMSF, 10mM Hepes (pH 7.9), 10mM KCl, 1.5mM MgCl2, 0.1mM EDTA, 1mM DTT, and 1% NP-40. After PC12 cell lysis, the lysate was incubated on ice for 10 minutes and then centrifuged at 10,000 rpm for 10 minutes at 4°C. The supernatant containing cytoplasmic proteins was collected. The precipitate was then further lysed with buffer B, which consisted of 20mM Hepes (pH 7.9), 0.4M NaCl, 1.5mM MgCl2, 0.2mM EDTA, 0.5mM DTT, and 1mM PMSF. The lysate was stirred on ice for 30 minutes, then centrifuged at 10,000 rpm for 10 minutes at 4°C to collect the supernatant rich in nuclear protein. The collected nuclear protein was added to the loading buffer and heated at 100°C for ten minutes. The content of nuclear Nrf2 protein, cytoplasmic Nrf2 protein, and total cellular Nrf2 protein was detected by Western Blot method. The results are shown in Figure 5 .

[0048] Depend on Figure 5 The results showed that the proportion of Nrf2 in the nucleus of PC12 cells increased significantly after two hours of incubation with troglitazone. This indicates that troglitazone can promote the dissociation of Nrf2 and its migration into the nucleus, proving that the Nrf2 pathway is activated (in the figure, * represents comparison with the untreated cell group, *P<0.05, **P<0.01).

[0049] (6) The study verified the binding of troglitazone to KEAP1 protein molecules through thermal drift experiments

[0050] Experimental method: PC12 cells were collected and resuspended in PBS, followed by three cycles of freezing and thawing in liquid nitrogen. Subsequently, centrifugation was performed and the supernatant was divided equally into two portions. Troglitazone (100 μM) was added to one portion, and an equal volume of DMSO (as a solvent control) was added to the other portion. The two samples were then incubated at 37°C for 2 hours. After the incubation, the protein samples were evenly distributed into 8 Eppendorf tubes and incubated at 43°C, 46°C, 49°C, 52°C, 55°C and 58°C for 3 minutes, respectively. After cooling and centrifugation, sample buffer was added to the supernatant. The mixture was heated to 100°C for 10 minutes. Finally, Western blot analysis was performed to determine the presence of KEAP1 protein. Results are shown in Figure 6 .

[0051] Depend on Figure 6The results show that there are obvious differences in the protein bands between the drug group and the control group, and the trend of protein reduction is inconsistent. This indicates that troglitazone binds to the KEAP1 protein to a certain extent. This result is consistent with the molecular docking results, confirming that troglitazone has a strong binding ability with the KEAP1 protein molecule.

[0052] (7) Detection of the activation ability of troglitazone on ARE transcription factors

[0053] Experimental method: First, PC12 cells were transfected with pARE-luciferase reporter plasmid and screened with G418 (0.5 mg / mL). Stable PC12-pARE-Luc cells were inoculated in 6-well plates and incubated with different concentrations of Troglitazone for 24 hours. After incubation, the culture medium was aspirated and washed three times with PBS. The Firefly luciferase reporter gene assay kit was used for detection, and the operation was carried out according to the instructions. The results are shown in Figure 7 .

[0054] Depend on Figure 7 The results showed that tert-butylhydroquinone (tBHQ) was used as a positive control, showing that troglitazone had different degrees of activation ability for ARE transcription factors at concentrations of 5-40μM. This indicates that troglitazone can resist oxidative stress by activating the Nrf2 / ARE signaling pathway and thus play a neuroprotective role (in the figure, * represents comparison with the untreated cell group, *P<0.05, **P<0.01, ***P<0.001.).

[0055] (8) Detection of neuroprotective effects of troglitazone after Nrf2 knockout

[0056] Specific experimental method: PC12 cells were transfected with 66nM non-targeting control siRNA (si-NC RNA) or Nrf2-specific siRNA (si-Nrf2 RNA) for 48 hours according to the manufacturer's instructions. After transfection, the cells were treated with troglitazone for 24 hours. The protein was then collected and Western blotted using anti-Nrf2 antibody to quantify the level of Nrf2 protein in the cells. The relative level of Nrf2 protein was evaluated by analyzing the band intensity. The sequencing of si-Nrf2 RNA is as follows:

[0057] Sense 5'-UUGUAGUCUAAGGAGUUCAGCUGGC-3'

[0058] Nonsense 5′-GCCAGCUGAACUCCUUAGACUCAAA-3′.

[0059] Then, the two successfully transfected cells were used to test the neuroprotective effect. The method was referred to above (1.2) and (1.3). The results are shown in Figure 8 .

[0060] Depend on Figure 8 The results show that after knocking out Nrf2, the neuroprotective effect of troglitazone was significantly weakened, which shows that Nrf2 plays a key role in the neuroprotective effect of troglitazone. Therefore, from another perspective, it is proved that troglitazone does activate the Nrf2 pathway and exerts neuroprotective effects through this pathway (in the figure, * represents the comparison with the non-knockout Nrf2 cell group, *P<0.05, **P<0.01, ***P<0.001.).

[0061] (9) Study on the antioxidant capacity of troglitazone

[0062] Experimental method: Equal amounts of DPPH (final concentration: 50 μM) were mixed with different concentrations of troglitazone and reacted in the dark at room temperature for 30 minutes. The absorbance was then measured at a wavelength of 517 nm. Resveratrol was used as a positive control, and the results are shown in Fig. 9 .

[0063] Depend on Fig. 9 The results show that the ability of troglitazone to remove DPPH under different concentration conditions is higher than that of the positive control resveratrol, which indicates that troglitazone has a strong antioxidant capacity (in the figure, ^ represents compared with the resveratrol positive group, ^P<0.05, ^^P<0.01, ^^^P<0.001).

[0064] (10) Study on the expression of related antioxidant genes downstream of the troglitazone regulatory pathway

[0065] Experimental method: One day in advance, 1×10 5Cells were added to the tubes and incubated with different concentrations of troglitazone for 24 hours after the cells adhered to the wall. Cells were collected by scraping and centrifugation. 1 mL of TRIzol reagent was added to each sample, and the cells were blown with a pipette to ensure that the cells were fully lysed. 200 μL of chloroform was added, mixed and placed at room temperature for 5 minutes. Centrifuge (12000×g, 4℃, 15 minutes), and the aqueous phase was carefully transferred to a new RNase-free centrifuge tube. An equal volume of isopropanol was added, and the mixture was gently mixed to precipitate RNA. Centrifuge (12000×g, 4℃, 10 minutes) to form an RNA precipitate. The supernatant was discarded and the precipitate was washed with 75% ethanol. Centrifuge (12000×g, 4℃, 5 minutes) and the ethanol was discarded. Air-dry the RNA precipitate for about 5-10 minutes. Dissolve the RNA precipitate in RNase-free water or DEPC water.

[0066] Use the kit ( III 1 st Strand cDNA Synthesis SuperMix for qPCR). The first step was to remove residual genomic DNA. RHase-free H2O, 5×gDNA digester MIx and TotalRNA were mixed according to the instructions and incubated at 42°C for 2 minutes. The second step was to mix the above reaction solution with III SuperMIx plus, and perform reverse transcription (25°C for 5 min, 55°C for 15 min, 85°C for 5 min), thereby obtaining cDNA.

[0067] Mix the reaction system of 10μL 2×SYBR Green PCR Master Mix, 1μL cDNA, 0.5μL primer (10μM) and 8.5μL RNase-free water, and centrifuge gently. Place in the qPCR instrument for real-time PCR reaction, the program is as follows: 95℃ for 5 minutes, one cycle; 95℃ for 10 seconds, 60℃ for 20 seconds, 72℃ for 20 seconds, repeat 40 cycles; the instrument default program is one cycle. After the qPCR experiment, the Ct value (threshold cycle) is used to calculate the relative gene expression. According to the Ct value difference (ΔCt) between the target gene and the internal reference gene, the ΔΔCt value is further calculated to infer the relative expression. Results are shown in Fig.10 The gene primer information is shown in Table 1 below.

[0068] Table 1

[0069] Gene Forward primer (5'-3') Reverse primer(5'-3') GAPDH CAGTGCCAGCCTCGTCTCAT AGGGGCCATCCACAGTCTTC NQO1 TCACCACTCTACTTTGCTCCAA TTTTCTGCTCCTCTTGAACCTC HO-1 GCCCTGGAAGAGGAGATAGAG TAGTGCTGTGT GGCTGGTGT Trx1 CCTTCTTTCATTCCCTCTGTGAC CCCAACCTTTTGACCCTTTTTAT TrxR1 ACTGCTCAATCCACAAACAGC CCACGGTCTCTAAGCCAATAGT GCLC CAAGGACAAGAACACACCATCT CAGCACTCAAAGCCATAACAAT GCLM GGCACAGGTAAAACCCAATAGT TTCAATGTCAGGGATGCTTTCT

[0070] Depend on Fig.10The results showed that with the increase of troglitazone concentration, the mRNA levels of GAPDH, NQO1, HO-1, Trx1, TrxR1, GCLC and GCLM also gradually increased, indicating that troglitazone can regulate the relevant antioxidant genes downstream of the pathway, and resist oxidative damage by enhancing the expression of antioxidant genes, thereby exerting a neuroprotective effect (in the figure, * represents comparison with the untreated cell group, *P<0.05, **P<0.01, ***P<0.001.).

[0071] (11) Study on the effect of troglitazone on the expression of downstream related antioxidant proteins

[0072] Specific experimental method: PC12 cells were planted in culture dishes and incubated with different concentrations of troglitazone for 24 hours. The cells were then collected, ultrasonically disrupted, and proteins were extracted and quantified. Western Blot was used to detect changes in the content of different proteins in the cells. The bar graph was used to quantify the band data. The results are shown in Fig.11 .

[0073] Depend on Fig.11 The results showed that with the increase of troglitazone concentration, the protein levels of HO-1, NQO1, Trx and TrxR gradually increased, which indicated that troglitazone activated the expression of downstream antioxidant proteins and exerted a neuroprotective effect by increasing the content of antioxidant proteins.

[0074] (12) Hochest 33324 and DCFH-DA fluorescence staining study of troglitazone

[0075] Experimental method: The seeding density of PC12 cells should reach 60% to 70% of the confluence of the bottom area of ​​6-well plates. After 24 hours of pretreatment with troglitazone, cells were induced with H2O2 or 6-OHDA (500μM). For imaging, cells were first cultured with serum-free medium containing 5μg / mL Hoechst 33324 for 30 minutes to stain the nuclei; or treated with 10μM DCFH-DA for 30 minutes to detect ROS. Subsequently, FLoid TM The cell imaging station images the cells. Fig.12 .

[0076] Depend on Fig.12 The results showed that compared with the H2O2 or 6-OHDA injury groups, troglitazone pretreatment for 24 hours showed fewer apoptotic nuclei and less green fluorescence, indicating that troglitazone protected PC12 neurons to some extent.

[0077] The present invention is not limited to the above-mentioned specific implementation modes. Various changes made by ordinary technicians in this field based on the above-mentioned concepts without creative work are all within the protection scope of the present invention.

Claims

1. Use of troglitazone in the preparation of drugs for preventing or treating neurodegenerative diseases.

2. The use according to claim 1, characterized in that: The neurodegenerative disease is selected from Parkinson's disease, Alzheimer's disease, Huntington's disease or amyotrophic lateral sclerosis.

3. A pharmaceutical composition, characterized in that The invention comprises troglitazone as an active ingredient and a pharmaceutically acceptable carrier or excipient.

Images