Application of flavobacterium przewalskii in metabolic disorder treatment and human body constitution improvement

Abstract

The invention belongs to the technical field of microorganism application, and particularly relates to application of flavobacterium przewalskii in metabolic disorder treatment and human body constitution improvement, and the flavobacterium przewalskii can participate in promoting synthesis of phytosphingosine and can be applied to metabolic disorder treatment and human body constitution improvement. The Flavobacterium przewalskii is preserved in the China General Microbiological Culture Collection Center (CGMCC) on November 19, 2024, and the preservation number of the Flavobacterium przewalskii is CGMCC No.32703. The invention also provides a verification method which verifies the effectiveness and reliability of the application of the Flavobacterium przewalskii.

Description

Technical Field

[0001] The present application belongs to the field of microbial application technology, and in particular relates to the application of Flavobacterium prausnitzii in the treatment of metabolic disorders and the improvement of human physique. Background Art

[0002] The statements in this section merely provide background technical information related to the present application and do not necessarily constitute prior art.

[0003] Metabolic disorders (MDs) are a group of diseases that are composed of multiple interrelated pathological conditions. They have a high incidence, are difficult to prevent and treat, have serious consequences, and have a huge impact. Many of these metabolic disorders have a common pathological basis, such as insulin resistance, chronic low-grade inflammation, etc., so they often appear simultaneously or successively, bringing great difficulties to treatment.

[0004] Phlegm-dampness constitution is a common constitution type in traditional Chinese medicine. Phlegm-dampness constitution is caused by the dysfunction of body fluid transportation and transformation, and the accumulation of phlegm and dampness over a long period of time. Meta-analysis of epidemiological and clinical studies has confirmed that people with phlegm-dampness constitution are a high-risk group for metabolic disorders.

[0005] At present, the intervention program for phlegm-dampness constitution is mainly achieved through taking traditional Chinese medicine, and the prevention and control of metabolic disorders mainly adopts measures such as health examinations and health education, which have achieved certain results, but are far from the expected results. Chinese medicine constitution believes that phlegm-dampness constitution is a high-risk group for metabolic disorders. By identifying phlegm-dampness constitution, "early screening" and "early warning" of metabolic disorders can be achieved. Through intervention in phlegm-dampness constitution, it is possible to achieve the transition from "prevention of one disease" to "prevention of a class of diseases", providing theoretical guidance and technical support for the prevention and control of metabolic disorders.

[0006] In recent years, an increasing number of epidemiological studies have used metabolomics to search for metabolites that reflect specific exposures, are early markers of disease, represent pathways that promote disease development, or help predict disease risk.

[0007] The correlation between phlegm-dampness constitution and metabolic diseases has been supported by clinical and experimental studies, and modern biomarker studies have shown that the levels of lipid metabolites, such as sphingolipid metabolites, in individuals with phlegm-dampness constitution are closely related to their disease risk.

[0008] The gut microbiota actively participates in the metabolism of blood metabolites, and many circulating metabolites derived from the gut microbiota are associated with metabolic disorders and cardiovascular disease. We believe that many unknown factors are involved in the pathogenesis of metabolic disorders. With recent technological advances, it is now possible to study these unknown factors from multi-omics data and identify multi-omics signatures of metabolic disorders in specific populations, thereby facilitating the development of personalized medicine approaches.

[0009] Although phytosphingosine has been well studied in the cosmetics industry, there is relatively little research on the ability of bacterial-derived phytosphingomyelin to regulate host metabolism. In addition, the phlegm-damp constitution of the human body is associated with metabolic disorders.

[0010] Therefore, we need to find a bacterial strain that can affect the phytosphingosine content in the human body and apply this bacterial strain in the intervention of phlegm-damp constitution and the treatment of metabolic disorders. Summary of the invention

[0011] In order to solve the above problems, the present application provides the application of Flavobacterium prausnitzii in the treatment of metabolic disorders and the improvement of human physique.

[0012] The first object of the present application is to provide the application of Flavobacterium prausnitzii.

[0013] In order to achieve the first purpose of this application, the technical solution of this application is:

[0014] Flavonibacterium plauti is involved in promoting the synthesis of phytosphingosine and is used in the treatment of metabolic disorders and the improvement of human physical fitness. Flavonibacterium plauti was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on November 19, 2024, and the culture collection number is CGMCC No.32703.

[0015] In the above-mentioned applications, metabolic disorders include obesity, diabetes, hyperlipidemia, hypertension, hyperuricemia, and non-alcoholic fatty liver disease; human physical constitutions include balanced constitution, yang deficiency constitution, yin deficiency constitution, qi deficiency constitution, phlegm-damp constitution, damp-heat constitution, blood stasis constitution, special constitution, and qi stagnation constitution; and Flavobacterium prausnitzii can improve the phlegm-damp constitution of the human body.

[0016] Supplementation of Flavobacterium prausnitzii can effectively intervene in metabolic disorders. Supplementation of Flavobacterium prausnitzii alone can reduce body weight, reduce lipid deposition in adipocytes, lower blood lipids, blood sugar and blood uric acid, and intervene in liver metabolism.

[0017] Supplementation of Flavobacterium prausnitzii can effectively improve the phlegm-damp phenotype, and supplementation of Flavobacterium prausnitzii alone can improve skin oiliness and drowsiness.

[0018] When culturing Flavobacterium prausnitzii, the mixed gas was filled in the anaerobic glove box under anaerobic conditions at 37°C. The brain heart infusion broth medium was placed in an anaerobic environment 24 hours in advance when used. The original strain was placed in the brain heart infusion broth medium for culture. When the original strain reached the logarithmic growth phase, it was taken out, and the original strain in the logarithmic growth phase was diluted 1:500 and inoculated into the brain heart infusion broth medium. It was cultured for more than 24 hours, and then centrifuged at a speed of 3000r / min for 5 minutes, and the supernatant of the brain heart infusion broth medium and the precipitated bacteria were collected. The precipitated bacteria were resuspended with PBS to obtain a total concentration of 2.5×10 9 CFU / ml of live bacterial inoculant, the mixed gas includes H2, CO2 and N2, and the volume ratio of H2, CO2 and N2 is 1:1:8.

[0019] The present application also discloses a composition, comprising the above-mentioned Flavobacterium prausnitzii, and the composition further comprises a pharmaceutically acceptable excipient, the pharmaceutically acceptable excipient is selected from at least one of a filler, a disintegrant, a lubricant, a flavoring agent, a binder, a suspending agent and a flavor, and the pharmaceutically acceptable excipient includes but is not limited to: a pharmaceutically acceptable carrier, an auxiliary substance or a solvent. The pharmaceutically acceptable excipient includes various organic or inorganic carriers and / or auxiliary materials, and the oral administration amount of Flavobacterium prausnitzii in the composition is at least 10 7 CFU / d, preferably 10 9 CFU / d.

[0020] The second purpose of this application is to provide a verification method.

[0021] To achieve the second purpose of this application, the technical solution of this application is:

[0022] The subjects were identified as having a peaceful constitution and a phlegm-dampness constitution, and were divided into a peaceful constitution group without disease, a peaceful constitution group with disease, a phlegm-dampness group without disease, and a phlegm-dampness group with disease. The fecal microbiome of the subjects was analyzed to obtain the characteristic bacteria of phlegm-dampness constitution that are susceptible to metabolic disorders and bacteria with the potential to produce phytosphingosine. Metagenomic sequencing and absolute quantification of intestinal bacteria were then performed, and it was verified that the characteristic bacteria used to significantly identify human constitution and early screening of metabolic disorders was Flavobacterium prausnitzii. Flavobacterium prausnitzii was then cultured in vitro and phytosphingosine and phytosphingosine were detected in a targeted manner, and experiments were conducted on colonization of Flavobacterium prausnitzii in germ-free mice to verify that Flavobacterium prausnitzii can participate in promoting the synthesis of phytosphingosine. Animal model experiments and cell intervention model experiments were then performed to verify that Flavobacterium prausnitzii that participates in promoting the synthesis of phytosphingosine can be used in the treatment of metabolic disorders and the improvement of human constitution.

[0023] Compared with the prior art, the beneficial effects of this application are:

[0024] 1. The Flavobacterium prausnitzii of the present application has the ability to efficiently produce phytosphingosine and the bacteria species that is most closely related to the production of phytosphingosine in the body is Flavobacterium prausnitzii. The application of Flavobacterium prausnitzii can efficiently produce phytosphingosine and is used to treat metabolic disorders caused by phlegm-damp constitution, especially the treatment of hyperuricemia.

[0025] 2. This application verifies through a verification method that Flavobacterium prausnitzii can efficiently produce phytosphingosine, and is used to alleviate the phenotype and typical characteristics of phlegm-damp constitution and improve the phlegm-damp constitution of the human body. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The drawings in the specification, which constitute a part of the present application, are used to provide further understanding of the present application. The illustrative embodiments of the present application and their descriptions are used to explain the present application and do not constitute improper limitations on the present application.

[0027] Figure 1 This is a comparison chart of the BC group samples and the PDC group samples based on the Shannon index in the α-diversity analysis;

[0028] Figure 2 The PCoA score diagram based on Bray-Curtis distance in β-diversity analysis of BC group samples and PDC group samples;

[0029] Figure 3 This is a comparison of the relative abundance changes of Flavobacterium prausnitzii in the BC group samples and the PDC group samples;

[0030] Figure 4 This is a comparison chart of the content of Flavobacterium prausnitzii in samples from the BC group and the PDC group;

[0031] Figure 5 This is the correlation analysis diagram between Flavobacterium prausnitzii and the transformation score of phlegm-dampness constitution, PDC socre is the transformation score of phlegm-dampness constitution;

[0032] Figure 6 The PCoA score diagram based on Unweighted Unifrac distance in β-diversity analysis of BCN group samples and PDN group samples;

[0033] Figure 7 It is a comparison chart of the contents of Flavobacterium prausnitzii in the samples of the BCN group, the BCD group, the PDC group and the PDD group;

[0034] Figure 8 ROC curves for the BCN and PDN groups constructed with Flavobacterium prausnitzii as the explanatory variable;

[0035] Fig. 9 ROC curves for the PDN and PDD groups constructed with Flavobacterium prausnitzii as the explanatory variable;

[0036] Fig.10 This is the growth curve of Flavobacterium prausnitzii cultured in vitro;

[0037] Fig.11 is a box plot of the content of phytosphingosine in the culture fluid of Flavobacterium prausnitzii;

[0038] Fig.12 The following are comparisons of skin oiliness and sleepiness between the model group and the intervention group. A is a comparison of skin oiliness, and B is a comparison of sleepiness.

[0039] Fig.13 Comparison charts of weight change and food intake between the model group and the intervention group. A and B are the linear comparison chart and box plot of weight change, respectively. C is the comparison chart of food intake.

[0040] Fig.14 Comparison of fat weight, white fat morphology and white fat volume between the model group and the intervention group. A is a comparison of the weight of white fat, beige fat and brown fat. B is a comparison of the volume of white fat. C is a comparison of the morphology of white fat. Epididymal is white fat, Inguinal is beige fat, and perirenal is brown fat.

[0041] Fig.15 The comparison charts of the model group and the intervention group in reducing TC, LDLC, TG, HDLC, blood glucose and blood uric acid are shown in Figure 1. A is the comparison chart of TC, LDLC, TG, HDLC, B is the comparison chart of blood glucose, and C is the comparison chart of blood uric acid.

[0042] Fig.16 Comparison of lipid droplet size, lipid droplet area ratio, liver tissue homogenate detection of TC, TG, and liver AST and ALT between the model group and the intervention group. A is a comparison of lipid droplet size in liver tissue, B is a comparison of lipid droplet area ratio, C and D are comparisons of TC and TG in liver tissue homogenate detection, and E and F are comparisons of liver AST and ALT;

[0043] Fig.17 The figures are box plots comparing the contents of phytosphingosine in feces, blood, and liver samples of the control group and the intervention group, wherein A is a box plot comparing the contents of phytosphingosine in feces of the control group and the intervention group, B is a box plot comparing the contents of phytosphingosine in serum of the control group and the intervention group, and C is a box plot comparing the contents of phytosphingosine in liver of the control group and the intervention group.

[0044] Fig.18This is a box plot comparing the model group, high-dose phytosphingosine group and low-dose phytosphingosine group when using the human flora transplantation model of non-patients with phlegm and dampness. A is the comparison of the oiliness of the mice's skin, B is the comparison of the sleepiness of the mice, PBS is the model group, PhyH is the high-dose phytosphingosine group, and PhyL is the low-dose phytosphingosine group.

[0045] Fig.19 It is a comparison chart of body weight and food intake of the model group, high-dose phytosphingosine group and low-dose phytosphingosine group. A is the weight change of mice with the number of weeks, B is the comparison box plot of body weight among the three groups, and C is the comparison box plot of food intake among the three groups.

[0046] Fig. 20 A is a comparison chart of fat weight and morphology, A is a box plot comparing the weight changes of white fat cells, beige fat cells, and brown fat cells in the three groups, where Inguinal is beige fat, Epididymal is white fat, and perirenal is brown fat, B is a box plot comparing the fat cell sizes of the three groups, and C is a morphological comparison chart of the volume of white fat cells.

[0047] Fig.21 The figures are comparison charts of the three groups in four blood lipid items, blood sugar and blood uric acid. A is the comparison chart of four blood lipid items, where TC is total cholesterol, TG is triglyceride, HDLC is high-density lipoprotein, and LDLC is low-density lipoprotein. B is the comparison chart of blood sugar, serum GLU is blood sugar, C is the comparison chart of blood uric acid, and serum UA is blood uric acid.

[0048] Fig. 22 These are comparison graphs of fat deposition in mouse livers of the three groups. A is a comparison graph of the sizes of lipid droplets in liver tissues, B is a comparison graph of the area percentage of lipid droplets calculated using ImageJ, C is a comparison graph of total cholesterol detected by liver tissue homogenate, D is a comparison graph of triglyceride detected by liver tissue homogenate, E is a comparison graph of AST detected by liver tissue homogenate, and F is a comparison graph of ALT detected by liver tissue homogenate.

[0049] Fig.23 This is a comparison chart of the cell viability of HepG2 cells at various concentrations under the high-lipid cell model, and cell viability refers to cell viability.

[0050] Fig.24 The effect of plant phytosphingosine treatment at 1 μM and 2.5 μM on lipid deposition in the hyperlipidemia cell model. A is a comparison chart of TC in the hyperlipidemia cell model. B is a comparison chart of TG in the hyperlipidemia cell model. Oleic acid refers to Oil Red O staining. C is the number of HepG2 cells after staining under a microscope.

[0051] Fig.25This is a comparison chart of the cell viability of HepG2 cells at various concentrations in the insulin resistance cell model. Cellviability refers to cell viability.

[0052] Fig.26 Effects of plant phytosphingosine treatment at 1 μM and 2.5 μM on glucose consumption in a cellular model of insulin resistance.

[0053] Flavonifractor plauti was deposited on November 19, 2024 in the General Microbiology Center of the China Culture Collection Administration, referred to as CGMCC, with the address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the culture collection number is CGMCC No.32703.

[0054] DETAILED DESCRIPTION

[0055] The present application is further described below in conjunction with the accompanying drawings and embodiments.

[0056] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0057] Example 1

[0058] Flavonibacterium plauti is involved in promoting the synthesis of phytosphingosine and is used in the treatment of metabolic disorders and the improvement of human physical fitness. Flavonibacterium plauti was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on November 19, 2024. The culture collection number is CGMCC No. 32703, and its survival is confirmed.

[0059] In the above applications, metabolic disorders include obesity, diabetes, hyperlipidemia, hypertension, hyperuricemia, and non-alcoholic fatty liver disease; human physiques include balanced physique, yang deficiency physique, yin deficiency physique, qi deficiency physique, phlegm-damp physique, damp-heat physique, blood stasis physique, special constitution, and qi stagnation physique; and the cultured Flavobacterium prausnitzii in this embodiment can improve the phlegm-damp physique of the human body.

[0060] When culturing Flavobacterium prausnitzii, the mixed gas was filled in the anaerobic glove box under anaerobic conditions at 37°C. The brain heart infusion broth medium was placed in an anaerobic environment 24 hours in advance when used. The original strain was placed in the brain heart infusion broth medium for culture. When the original strain reached the logarithmic growth phase, it was taken out, and the original strain in the logarithmic growth phase was diluted 1:500 and inoculated into the brain heart infusion broth medium. It was cultured for more than 24 hours, and then centrifuged at a speed of 3000r / min for 5 minutes, and the supernatant of the brain heart infusion broth medium and the precipitated bacteria were collected. The precipitated bacteria were resuspended with PBS to obtain a total concentration of 2.5×10 9 CFU / ml of live bacterial inoculant, the mixed gas includes H2, CO2 and N2, and the volume ratio of H2, CO2 and N2 is 1:1:8.

[0061] As the basic process of the verification method of this embodiment, this embodiment determines the peaceful constitution and phlegm-dampness constitution of the subjects, and divides the subjects into a peaceful constitution group, a phlegm-dampness non-disease constitution group and a phlegm-dampness already-disease constitution group, wherein the ratio of the number of people in the peaceful constitution group, the phlegm-dampness non-disease constitution group and the phlegm-dampness already-disease constitution group is 1:1:3, and when subdivided, the peaceful constitution group includes a peaceful constitution non-disease group and a peaceful constitution already-disease group, and the fecal microbiome of the subjects is analyzed to obtain characteristic bacteria that are susceptible to metabolic disorders of the phlegm-dampness constitution and bacteria with the potential to produce phytosphingosine, and then metagenomic sequencing and intestinal microbiome analysis are performed. The absolute quantification of bacteria in the intestine was performed, and it was verified that the characteristic bacteria used to significantly identify human constitution and early screening of metabolic disorders was Flavobacterium prausnitzii, and then Flavobacterium prausnitzii was cultured in vitro and phytosphingosine was detected in a targeted manner, and experiments on colonization of Flavobacterium prausnitzii in germ-free mice were performed to verify that Flavobacterium prausnitzii could participate in promoting the synthesis of phytosphingosine, and then animal model experiments and cell intervention model experiments were performed to verify that Flavobacterium prausnitzii involved in promoting the synthesis of phytosphingosine could be used in the treatment of metabolic disorders and the improvement of human constitution. Specifically, the verification method of this embodiment is: 16S rDNA amplicon sequencing is used to study the fecal microbiome of subjects with phlegm-damp constitution and peaceful constitution, and through diversity analysis, species difference analysis, and Spearman correlation analysis of the difference species and PDC score, the content of phytosphingosine, the characteristic bacteria susceptible to metabolic disorders in phlegm-damp constitution and the bacteria with the potential to produce phytosphingosine are obtained.

[0062] The selection of the in-group ratio of the peaceful constitution group, the phlegm-dampness non-disease constitution group, and the phlegm-dampness already-disease constitution group was not random, but was due to the limitations of current technology. 16S rDNA gene amplified fragment sequencing cannot cover 100% of the intestinal microbiota, and even multiple sequencing cannot guarantee 100% coverage. Therefore, the in-group ratio of the peaceful constitution group, the phlegm-dampness non-disease constitution group, and the phlegm-dampness already-disease constitution group was 1:1:3 to expand the coverage of the intestinal microbiota, so as to better explore the detailed information of the Flavonifractor genus and further explore the application of Flavonifractor.

[0063] In the stage of distinguishing the constitution of the subjects, this embodiment is in accordance with the "Classification and Determination of Chinese Medicine Constitution" standard promulgated by the China Association of Traditional Chinese Medicine, which is numbered ZZYXH / T157-2009. The subscales of the mild constitution and phlegm-damp constitution are shown in Tables 1 and 2, and the scoring method and determination criteria are shown in Tables 3 and 4 respectively. The volunteers first fill out the "Chinese Medicine Constitution Scale" to determine the constitution type, which is then manually identified and confirmed by a doctor specializing in Chinese medicine constitution.

[0064] Table 1: "Classification and Determination of Constitution in Traditional Chinese Medicine" subscale of peaceful constitution

[0065]

[0066] Table 2: Phlegm-dampness constitution subscale in "Classification and determination of constitution in traditional Chinese medicine"

[0067]

[0068] Table 3: Scoring method for peaceful constitution and phlegm-damp constitution

[0069] Fraction Score range Calculation method Raw score 8-40 points Raw score = sum of all item scores Conversion score 0-100 points Conversion score = (original score - 8) / 32 × 100

[0070] Note: Entries marked with * require linear reverse integration, that is: 1 is recorded as 5, 2 is recorded as 4, 3 is recorded as 3, 4 is recorded as 2, 5 is recorded as 1, and then the conversion score is calculated.

[0071] Table 4: Criteria for determining the peaceful constitution and the phlegm-damp constitution

[0072]

[0073] As the diagnostic criteria for metabolic disorders, at least one of the following conditions, obesity, diabetes, hyperlipidemia, hypertension, and hyperuricemia, can be diagnosed as metabolic disorders (MDs).

[0074] The diagnostic criteria for obesity are based on the “Epidemiology and Determinants of Obesity in China” published in The Lancet, as shown in Table 5.

[0075] Table 5: Body mass index of overweight and obese adults in China

[0076] project <![CDATA[Body Mass Index (Kg / m 2 )]]> Being underweight <18.5 normal weight 18.5-23.9 overweight 24.0-27.9 obesity ≥28.0

[0077] The diagnostic criteria for dyslipidemia are in accordance with the Guidelines for the Prevention and Treatment of Dyslipidemia in Chinese Adults (2016 Revised Edition), see Table 6 for details.

[0078] Table 6: Appropriate blood lipid levels and abnormal stratification criteria for primary prevention of ASCVD [mmol / L (mg / dl)]

[0079]

[0080] Note: The letters in Table 6 mean: ASCVD: atherosclerotic cardiovascular disease; TC: total cholesterol; LDL-C: low-density lipoprotein cholesterol; HDL-C: high-density lipoprotein cholesterol; non-HDL-C: non-high-density lipoprotein cholesterol; TG: triglycerides. LDL-C can also be written as LDLC, and HDL-C can also be written as HDLC.

[0081] The diagnostic criteria for prediabetes are in accordance with the "Guidelines for the Prevention and Treatment of Type 2 Diabetes in China (2017 Edition)", see Table 7 for details.

[0082] Table 7: Classification of glucose metabolism status in the "Guidelines for the Prevention and Treatment of Type 2 Diabetes in China (2017 Edition)" (WHO 1999 standard)

[0083]

[0084] Note: The letters in Table 7 mean: IFG stands for impaired fasting glucose, IGT stands for impaired glucose tolerance, and IFG and IGT are collectively referred to as impaired glucose regulation.

[0085] The diagnostic criteria for hyperuricemia are in accordance with the "Guidelines for the Diagnosis and Treatment of Hyperuricemia and Gout in China (2019)", see Table 8 for details.

[0086] Table 8: Diagnostic criteria for hyperuricemia in the "Guidelines for the Diagnosis and Treatment of Hyperuricemia and Gout in China (2019)"

[0087] concept Diagnostic criteria hyperuricemia Fasting blood uric acid>420umol / L (adults of some genders)

[0088] The diagnostic criteria for hypertension are in accordance with the "2018 Revised Edition of the Guidelines for the Prevention and Treatment of Hypertension in China", see Table 9 for details.

[0089] Table 9: Classification and definition of blood pressure levels in the 2018 revised version of the Guidelines for the Prevention and Treatment of Hypertension in China

[0090] Classification SBP (mmHg) DBP (mmHg) Normal blood pressure <120 and <80 Normal high 120-139 and / or 80-89 hypertension ≥140 and / or ≥90

[0091] Note: The letters in Table 9 mean: SBP: systolic blood pressure; DBP: diastolic blood pressure.

[0092] The following are the specific inclusion criteria for the subjects:

[0093] (1) According to the research diagnostic criteria, the constitution is judged as a mild constitution or a phlegm-damp constitution;

[0094] (2) Age range: 18 years ≤ ≤ 50 years, with age calculated as the difference between the screening survey date and date of birth;

[0095] (3) Any gender;

[0096] (4) have lived stably in the survey area for at least 1 year and have a fixed residence;

[0097] (5) Have good memory and mobility, be able to take care of themselves, and be mentally healthy;

[0098] (6) The subjects gave their informed consent and signed the informed consent form;

[0099] The following are the specific exclusion criteria for the subjects:

[0100] (1) Use of antibiotics within the past 3 months; use of gastrointestinal motility drugs, microecological regulators, and other foods and drugs that affect intestinal flora within the past 3 months;

[0101] (2) Those who have used any medication or surgical method to lose weight in the past 3 months, including appetite suppressants, thyroid hormones, progesterone, laxatives, and various Chinese herbal slimming drugs.

[0102] (3) Those who suffer from gastrointestinal diseases or have undergone gastrointestinal surgery;

[0103] (4) Suffering from serious organic or infectious diseases.

[0104] When collecting clinical data in this embodiment, a trained professional doctor collected detailed clinical information of eligible participants in a face-to-face manner. The collected clinical data included the participants' demographic information, anthropometric characteristics, health status, medical history, medication status and other related information. The body mass index (BMI) of the participants was calculated by dividing the weight (kg) by the square of the height (m2). The waist circumference was measured by circling the abdomen horizontally at 5 cm above the navel. The hip circumference was measured at the most protruding part of the buttocks. Vital signs (heart rate, blood pressure) were measured in a resting state, and the blood pressure was taken on the right side of the sitting position.

[0105] Among a large number of participants, subjects are selected and repeatedly verified according to the method of this embodiment.

[0106] Specifically, before analyzing the fecal microbiome of the subject, the feces of the subject in the middle and rear part of the excretion were collected using a fecal sampler. The subject was provided with a fecal sampler and detailed illustrated sample collection instructions. The subject should collect the feces immediately after defecation and excrete the feces into a clean container to avoid urine contamination of the fecal sample as much as possible. After collection, the feces were immediately frozen with liquid nitrogen and stored at -80°C. Total DNA was extracted from fecal samples according to the instructions provided by the soil kit (OmegaBio-tek, Norcross, GA, US). The purity and concentration of DNA were detected and calculated using NanoDrop2000, and the quality of the extracted DNA was determined using 1% agarose gel.

[0107] For sequencing and data analysis, the V3-V4 variant region of the DNA sample was PCR amplified using primers 343F (5′-TACGGRAGGCAGCAG-3′) and 798R (5′-AGGGTATCTAATCCT-3′), and the quality of the amplicon was observed by gel electrophoresis, purified with AMPure XP beads (Agencourt), and amplified by another round of PCR. After purification again with AMPure XP beads, the amplicon was analyzed using Qubit The final amplified fragments were quantified by the dsDNA detection kit, and equal amounts of purified amplified fragments were pooled for subsequent sequencing. Paired samples were merged using Flash software (version 1.2.11), and the split_libraries (version 1.8.0) function of QIIME software (version 1.8.0) was used to remove ambiguous sequences, homologous sequences, or reads less than 200 bp from the original labels to obtain clean labels. Downstream bioinformatics analysis was performed using EasyAmpliconv (1.0), and low-abundance sequences with n less than 8 were discarded using the -derep_fullength command in VSEARCH software (version v2.15). USEAR The -unoise3 command in the CH software (version 10.0) was used to denoise non-redundant sequences into amplicon sequence variants (ASVs), and then an ASV feature table was created using Vsearch-usearch_global. High-quality reads were analyzed using USEARCH, and chimeric sequences and organelle sequences were removed to generate a total feature worksheet (ASVs worksheet) for final analysis. Representative sequences of ASVs in each feature table were classified, and classification data were assigned to each sequence using the Ribosomal Database Project (RDP) classifier (version 11.5). For downstream diversity analysis, the sequences of all samples were diluted to 20,000, and the α-diversity was evaluated using the species richness index (Richness index) and the Shannon diversity index (Shannon index). β-diversity was calculated using principal coordinate analysis (PcoA), and the significance of differences between groups was evaluated using the Adonis test. The ROC curve was generated and the AUC was calculated using the oebiotech platform, and the website of the oebiotech platform is: https: / / cloud.oebiotech.cn / task / .

[0108] In metagenomic sequencing and data analysis, the Nextera DNA sample preparation kit (Illumina) was used, and the Illumina NovaSeq platform was used for sequencing to generate 2 × 150-bp paired-end reads and prepare Illumina libraries. Trimmomatic with default parameters was used to filter and trim Illumina sequence data and low-quality reads. After obtaining valid reads at the gaps within the scaffold, SOAPdenovo2 (v2.04) was used for metagenomic splicing to break the scaffold into new ScafContigs, and ScafContigs greater than or equal to 200 bp were retained. Prodigal (v2.6 .3 version) was used to predict the ORFs of the spliced ​​scaffolds and translated them into amino acid sequences. CDHIT (v4.6.7 version) was used to establish non-redundant gene sets for all predicted genes, with clustering parameters of 95% identity and 90% coverage. The longest gene was selected as the representative sequence of each gene set. Bowtie2 (v2.2.9 version) was used to align the clean reads of each sample with the non-redundant gene set, which was required to meet 95% identity, and the abundance information of genes in the corresponding samples was obtained. The classification information of species came from the corresponding classification database of the NR library, and the species abundance was calculated based on the corresponding gene abundance. The abundance maps of the corresponding classification levels were constructed, and the abundance data were statistically analyzed at the phylum, class, order, family, genus, and species levels.

[0109] In the quantitative determination stage of bacteria, SYBR Green dye method was used for absolute quantitative PCR analysis. 1 μL of gDNA was added to 2 tubes of 7.5 μL of 2×Taq Pro Universal SYBR qPCR Master Mix, and the forward and reverse primers of 16S rDNA and Flavobacterium prausnitzii were added to 1 tube of 2×Taq Pro Universal SYBR qPCR Master Mix, respectively. Then, molecular biology grade H2O (ddH2O) was added to finally obtain a volume of 15 μL. The forward primer sequence of the 16S rDNA was TCCTACGGGAGGCAGCAGT, and the volume was 0.7 μL. The reverse primer sequence of rDNA is GGACTACCAGGGTATCTAATCCTGTT, with a volume of 0.7 μL, the forward primer sequence of Flavobacterium prausnitzii is TTGTCGGGGACGAAACAAAT, with a volume of 0.7 μL, and the reverse primer sequence of Flavobacterium prausnitzii is CTCCAGCACTCAAGAACTAC, with a volume of 0.7 μL. Specifically, the primer information of RT-qPCR is shown in Table 10:

[0110] Table 10: Primer information for RT-qPCR

[0111]

[0112] qPCR detection used the Step One Plus real-time PCR system and software, and the set conditions were: pre-denaturation at 95°C for 5 minutes, one cycle, then denaturation at 95°C for 20 seconds, annealing at 55°C for 20 seconds, extension at 72°C for 40 seconds, and denaturation-annealing-extension cycles for 40 times. The conditions for melting curve collection were: 95°C for 15 seconds, 60°C for 60 seconds, 95°C for 30 seconds, and 95°C for 15 seconds, one cycle. The calculated CT value was substituted into the standard curve formula y=-3.6206x+31.549 to calculate the logarithm of the gene copy number x. The reaction program is shown in Table 11.

[0113] Table 11: Reaction Procedure

[0114]

[0115] During the anaerobic bacterial in vitro culture stage: under anaerobic conditions at 37°C, that is, all sample processing and culture were carried out under anaerobic conditions of the ELECTROTEK AW 400SG workstation at 37°C, the anaerobic glove box was filled with mixed gas, and the culture medium, PBS and all other materials used for culture were placed in an anaerobic environment 24 hours before use to adapt to anaerobic conditions. The mixed gas included H2, CO2 and N2, and the volume ratio of H2, CO2 and N2 was 1:1:8. The original strain of Flavobacterium prausnitzii was placed in Brain-Heart Infusion Broth medium (Brain-Heart Infusion Broth medium) Broth, BHI), and when the original strain reached the logarithmic growth phase, it was taken out and cultured in vitro. The original strain in the logarithmic growth phase was diluted 1:500 and inoculated into brain heart infusion broth medium for 24 hours. The culture of Flavobacterium prausnitzii was collected at 0, 2, and 6 hours for phytosphingosine targeted determination. The culture was centrifuged at 3000r / min for 5 minutes, and then the supernatant of the culture medium and the precipitated bacteria were collected. The precipitated bacteria were resuspended in PBS to obtain 5×10 per 200μL. 8 The density of total colony count (cfu) is the total concentration of viable bacteria obtained by resuspending the precipitated bacteria in PBS to 2.5×10 9 CFU / ml of live bacterial inoculant.

[0116] As one use, bacterial live inoculants are freshly prepared for animal experiments.

[0117] In this embodiment, the selection and feeding of sterile mice are as follows: 7-week-old sterile-grade healthy male mice are selected as sterile mice, and the sterile mice are divided into a control group and an intervention group by random grouping. The control group and the intervention group have free access to food and water, and are fed for one week for environmental adaptation. After the environmental adaptation is completed, they are fed with 60% sterile high-fat feed. When the experiment begins, the sterile mice are 8 weeks old, the dosage volume is 0.2 mL / mouse, and they are gavaged once a day for 10 days. The control group is gavaged with PBS, and the intervention group is gavaged with bacterial solution.

[0118] In this embodiment, phytosphingosine was detected in a targeted manner, and the phytosphingosine content was analyzed by ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS). The sample was extracted with an extracting solution, the extracting solution was a 9:1 liquid of chloroform: methanol, vortexed for 5 minutes, and then centrifuged at 12000r / min for 10 minutes, and then 400μL of the supernatant was concentrated at 20°C to complete dryness, and then reconstituted with 100μL of methanol;

[0119] In this example, water and methanol were used as mobile phases to separate phytosphingosine on an ACQUITY HSST3 chromatographic column (2.1×100 mm, 1.8 μm), and MRM detection was performed on a QTRAP 6500 mass spectrometer (Sciex, Concord, Canada). Internal and external standard curves were used for quantification. The chromatographic conditions were: 5 mM ammonium acetate and 0.1% formic acid in water, 0.1% formic acid in methanol, the injection volume was 2 μL, and the column temperature was 40°C. The mass spectrometry conditions and corresponding parameters are shown in Table 12.

[0120] Table 12: Mass spectrometry conditions and parameters

[0121] Ion Mode ESI Curtain Gas 20 IonSpray Voltage 5500 Temperature 500 Ion Source Gas1 40 Ion Source Gas2 50 Collision Gas Medium Scan type MRM Entrance Potential 10 Collision Cell Exit Potential 10

[0122] Regarding the statistical analysis methods used in this embodiment, according to different data, for microbiome data, RV.3.5 was used for statistical analysis under RStudio (V.1.1.453), and the inter-group statistical analysis was analyzed by Wilcoxon rank sum test or Kruskal-Wallis test. Multiple hypotheses were adjusted using the FDR method. For animal and bacterial culture studies, GraphPad Prism (version 9.5) was used for data statistical analysis and drawing. For data that conformed to normal distribution, the independent sample t test was used for comparison between two groups, and ANOVA analysis was used for comparison between multiple groups. Turkey and REG-WQ methods were used for analysis of homogeneous variances, and Dunnetts T3 method was used for analysis of unequal variances. For variables with non-normal distribution, Mann-Whitney was used for comparison between two groups. U rank-sum test was used, Kruskal-Wallis test was used for comparison among multiple groups, Spearman's rho statistic was used for correlation analysis, p < 0.05 indicated statistical significance, among which, in the comparative analysis, *p < 0.05, **p < 0.01, ***p < 0.001 indicated statistical significance. According to the analysis results, it was demonstrated that Flavobacterium prausnitzii species has the strongest correlation as a biomarker for the identification of peaceful constitution, phlegm-damp constitution and early screening of metabolic disorders.

[0123] From the data and research results, the abundance of Flavobacterium prausnitzii species is reduced in phlegm-dampness constitution, and is significantly correlated with PDCscore and phytosphingosine. From the sample characteristics collected in this embodiment, there are no significant differences in age and gender among the peaceful constitution group, the phlegm-dampness constitution non-disease group and the phlegm-dampness constitution already-disease group. The peaceful constitution group is the BC group, the phlegm-dampness constitution group is the PDC group, the BCN group is the peaceful constitution non-disease group, the BCD group is the peaceful constitution already-disease group, the PDN group is the phlegm-dampness constitution non-disease group, and the PDD group is the The PDN group was a group with phlegm-dampness constitution and was already ill. Compared with the peaceful constitution, although the variation of clinical indicators in the PDN group was within the normal range, the weight, BMI, waist circumference, hip circumference, and waist-to-hip ratio of the PDN group were still significantly higher than those of the BC group (p<0.05), while the blood lipid indicators (TC, Triglyceride, HDLC, LDLC, ApoA1, ApoB), blood glucose indicators (2hPG, INS, HBA1C%), blood uric acid (UA), and blood pressure (SBP, DBP) were not significantly different from those of the BC group. With the occurrence of metabolic diseases, the metabolic disorder of the PDD group was further aggravated compared with the PDN group. The obesity indicators (weight, BMI, waist circumference, hip circumference, waist-to-hip ratio), blood lipid indicators (TC, Triglyceride, LDLC, ApoB), blood glucose indicators (2hPG, INS), blood uric acid (UA), and blood pressure (DBP) were all higher than those of the BC group and the PDN group. There were no significant differences in some indicators among the BC group, the PDN group, and the PDD group, and there was no obvious identification scheme for the diseases to be developed.

[0124] Table 13: Clinical characteristics of the mild constitution group, the phlegm-damp constitution group without disease, and the phlegm-damp constitution group with disease

[0125]

[0126] like Figure 1-Figure 2 As shown, Figure 1 The results showed that there was no significant difference in the Shannon index between the BC group and the PDC group. Figure 2 The results showed that there were significant differences in the intestinal flora structure between the BC group and the PDC group.

[0127] At the genus level, compared with the BC group, there were 44 genera with significant differences in the PDN group, of which 31 were enriched in the PDN group and 13 were reduced. This example focused on the top 100 species with different relative abundances. The results showed that at the genus level, Chlamydia, Dialister, and Prevotella were significantly increased in the PDN group, while Flavonifractor and Fusobacterium were significantly reduced in the PDN group, as shown in Table 13.

[0128] Table 14: Comparison of different species between BC group and PDN group (genus level)

[0129] Species name Mean BC Mean PDN PDN vs BCLevel PValue FDR Chlamydia 0.074 0.421 Enriched 0.019 0.957 Dialister 0.006 0.074 Enriched 0.043 0.957 Flavonifractor 0.115 0.049 Depleted 0.005 0.957 Fusobacterium 0.408 0.015 Depleted 0.019 0.957 Prevotella 0.963 18.675 Enriched 0.043 0.957

[0130] At the genus level, compared with the BC group, there were 100 genera in the PDD group with significant differences, of which 29 were enriched in the PDD group and 71 were reduced. This example focuses on the top 100 species with different relative abundances. The results show that at the genus level, Capnocytophaga, Chlamydia, Collinsella, Dialister, Flavobacterium, Paraprevotella, Prevotella, and Sinorhizobium were significantly increased in the PDN group, while Bacteroides, Butyricicoccus, Erysipelatoclostridium, Flavonifractor, Fusobacterium, Hungatella, Intestinibacter, Ornithobacterium, Phascolarctobacterium, and Veillonella were significantly reduced in the PDN group. After FDR correction (FDR=0.003), Flavonifractor was still significantly reduced, as shown in Table 14.

[0131] Table 15: Comparison of different species between BC group and PDD group (genus level)

[0132]

[0133] Figure 3 The results showed that there were significant differences in the species of Flavobacterium prausnitzii between the BC group and the PDC group, and the abundance of Flavobacterium prausnitzii was significantly reduced in patients with phlegm-damp constitution. Figure 4 The results showed that compared with the BC group, the content of Flavobacterium prausnitzii in the PDC group decreased. Figure 5 The results showed that Flavobacterium prausnitzii had a significant correlation with sputum dampness score.

[0134] Figure 6 The results showed that the intestinal flora structures of the BCN group and the PDN group overlapped with each other, but there was no significant difference. Figure 7 The results showed that compared with the BC group, the content of Flavobacterium prausnitzii in the BCD group, PDC group, and PDD group gradually decreased. Figure 8 The results showed that Flavobacterium prausnitzii had a strong ability to identify the PDN group, with the area under the ROC curve (AUC) as high as 0.87. The content of Flavobacterium prausnitzii could distinguish between healthy people with a mild constitution and healthy people with a phlegm-damp constitution. Fig. 9 The results showed that the ability of Flavobacterium prausnitzii to distinguish between PDN and PDD was poor, with AUC = 0.57. AUC less than 0.6 indicated that it had no diagnostic significance and could not distinguish whether people with phlegm-damp constitution had disease.

[0135] The above results indicate that Flavobacterium prausnitzii is a good predictive factor for distinguishing phlegm-damp constitution and balanced constitution, and further illustrate that Flavobacterium prausnitzii is a biomarker of phlegm-damp constitution, which can identify the phlegm-damp constitution in the human body.

[0136] In this example, the strain of Flavobacterium prausnitzii was cultured in vitro. Specifically, in this example, the activated strain of Flavobacterium prausnitzii was inoculated into a brain heart infusion broth culture medium at a 10% inoculation amount, and cultured under anaerobic conditions at 37° C., samples were taken every 2 hours, the optical density (OD600) value of the sample was measured at a wavelength of 600 nm, a growth curve was drawn, and the content of phytosphingosine in the culture solution at 2 hours, 6 hours, and 10 hours was targetedly determined using the LC-MS method, as shown in FIG. Fig.10 As shown in Figure 2, the strain of Flavobacterium prausnitzii grew rapidly and entered the logarithmic phase after 2 hours and the stable phase after 10 hours. Fig.11 As shown, when the LC-MS method was used to target the determination of the phytosphingosine content in the culture medium at 2h, 6h, and 10h, the phytosphingosine content was significantly increased after 6h and 10h of culture compared to 2h.

[0137] In the experiment of colonizing the germ-free mice with Flavobacterium prausnitzii, the germ-free mice were orally gavaged with the treated Flavobacterium prausnitzii suspension once a day and killed after 10 days. The feces, blood and liver samples of the mice were collected for the targeted determination of the content of phytosphingosine. Correspondingly, we supplemented the mice with the cultured and preserved Flavobacterium prausnitzii of this example separately, and used the human flora transplantation model of non-patients with phlegm and dampness. We observed that Fig.12 As shown, under the condition of high-fat feeding, supplementation with Flavobacterium prausnitzii can significantly reduce the skin oiliness and drowsiness of mice compared with the model group gavaged with PBS, indicating that supplementation with Flavobacterium prausnitzii can effectively improve the phlegm-damp phenotype of mice.

[0138] like Fig.13 As shown in the data, compared with the PBS-intervention model group, treatment with F. prausnitzii for 5 weeks can significantly reduce the body weight of mice, while there is no significant difference in food intake between the PBS-intervention model group and the F. prausnitzii-intervention group, which indicates that F. prausnitzii can effectively alleviate obesity in the human flora transplantation model of non-patients with phlegm and dampness, and this effect is not caused by reduced food consumption or energy acquisition.

[0139] like Fig.14 As shown, compared with the model group, the weight of white fat and beige fat in the intervention group was significantly reduced, while the weight of brown fat did not change significantly. The morphology of white fat cells was observed using HE staining. Compared with the model group, the white fat cells in the intervention group were significantly reduced, and the number of cells in the field of view was significantly increased. The volume of white fat cells was calculated using ImageJ, and it was found that the volume of fat cells in the intervention group was significantly reduced, which indicates that the Flavobacterium prausnitzii strain cultured in this example can effectively reduce lipid deposition in adipocytes.

[0140] like Fig.15 As shown in the results, after 5 weeks of treatment with Flavobacterium prausnitzii, the total cholesterol (TC) and low-density lipoprotein (LDLC) in the intervention group were significantly reduced compared with the model group, while there were no significant differences in triglycerides (TG) and high-density lipoprotein (HDLC). Compared with the model group, the intervention group could significantly reduce the fasting blood glucose level of mice after 5 weeks of intervention, and compared with the model group, the intervention group could significantly reduce the fasting blood uric acid level of mice after 5 weeks of intervention. The above results show that the intervention with Flavobacterium prausnitzii can effectively alleviate the metabolic disorders of blood lipids, blood sugar and blood uric acid caused by phlegm-dampness.

[0141] like Fig.16As shown in the figure, we tested whether the intervention with Flavobacterium prausnitzii would affect liver metabolism. According to histological analysis (HE staining), the size of lipid droplets in the liver tissue of the intervention group was significantly reduced compared with the model group. The area ratio of lipid droplets was calculated using ImageJ, which was significantly reduced in the intervention group compared with the model group. Consistent with this, the results of TC and TG detection in liver tissue homogenate showed that TC and TG in the intervention group were significantly reduced. In addition, compared with the model group, the liver AST and ALT in the intervention group changed significantly.

[0142] like Fig.17 As shown, the levels of phytosphingosine in feces, blood serum and liver in the intervention group were significantly increased compared with the control group fed PBS.

[0143] This example verifies that the Flavobacterium prausnitzii species can efficiently produce phytosphingosine by culturing the species of Flavobacterium prausnitzii in vitro and colonizing the species of Flavobacterium prausnitzii in germ-free mice. This example also verifies that the changes of Flavobacterium prausnitzii in people with phlegm-damp constitution are most significant, and the correlation with the conversion score of phlegm-damp constitution and serum phytosphingosine is the strongest. The reduced abundance of Flavobacterium prausnitzii species in phlegm-damp constitution leads to a reduced content of phytosphingosine in human circulation, which is the cause of its metabolic disorder. The application of Flavobacterium prausnitzii species in the fields of medicine and the like can change the content of phytosphingosine in the human body, and can be used in the treatment of metabolic disorder diseases.

[0144] Phytosphingosine can be used in the treatment of metabolic disorders, and the Flavobacterium prausnitzii strain cultured in this example can change the phytosphingosine content in the human body, and can therefore be used in the treatment of metabolic disorders.

[0145] The specific verification method is:

[0146] In this verification method, animal model experiments and cell intervention model experiments are conducted. In the animal model experiments, biochemical index detection and histological analysis are performed. In the cell intervention model experiments, cell culture is performed and phytosphingosine is intervened in the cultured cells.

[0147] Specifically, an animal model experiment was conducted. Based on the human microbiota model of phlegm-damp constitution, mice were randomly divided into a model group, a high-dose phytosphingosine group, and a low-dose phytosphingosine group. Phytosphingosine was vortexed with sterile PBS buffer and the dosage was: 25 mg / kg for the low-dose phytosphingosine group and 50 mg / kg for the high-dose phytosphingosine group. The administration method was as follows: after microbiota transplantation, the high-dose phytosphingosine group and the low-dose phytosphingosine group were gavaged with the corresponding dosage of phytosphingosine, and the model group was gavaged with an equal amount of PBS buffer, once a day for 5 consecutive weeks.

[0148] The mice's reactivity, hair color, diet, eyes, excrement and mental state were closely observed throughout the animal experiment. After one week of adaptive feeding, the weight change data of the mice were recorded every week thereafter, and the food intake of the mice was recorded on 10 days randomly selected during the experimental cycle.

[0149] The animals’ responsiveness, fur color, diet, eyes, excrement, and mental state were closely observed throughout the experiment. The animals’ sputum-dampness status was scored one day before sacrifice on a scale of 0-3 points, which was divided into the following two categories: (1) obvious lethargy: immobility (unless stimulated) (3 points), mild decreased movement (2 points), moderate decreased movement (2 points), and normal (0 points); (2) greasy fur: severe greasy and poorly combed (3 points), mild greasy (2 points), moderate greasy (1 point), and normal (0 points). Obvious lethargy and greasy fur are similar to body heaviness and greasy skin in humans, respectively.

[0150] All experimental mice were fasted for 8 hours before being killed, and then anesthetized with sodium pentobarbital. The eyeballs were removed to collect blood, and the plasma was allowed to stand for 3-4 hours. The supernatant was obtained by centrifugation in a refrigerated centrifuge at a speed of 3000 rpm, a temperature of 4°C, and a time of 10 minutes. Before all experimental mice were killed, the feces of each mouse was collected in a sterile acrylic box into a sterile 1.5 ml centrifuge tube, and quickly placed in a liquid nitrogen bucket for quick freezing, and then transferred to a -80°C refrigerator for freezing;

[0151] After the mice died, the abdominal cavity was opened, the liver tissue was carefully peeled off on an ice box, and rinsed with pre-cooled PBS buffer. The liver lobe of 0.5×0.5 cm was cut with a blade and placed in 4% paraformaldehyde for fixation. The liver tissue was then cut into small pieces, divided into cryopreservation tubes, quickly frozen in liquid nitrogen, and then transferred to -80°C for cryopreservation. The fat tissue was separated on an ice box, weighed and recorded, and 0.5×0.5 cm of fat tissue from the same part was cut and placed in fat fixative, and the remaining fat tissue was divided and frozen;

[0152] When conducting biochemical index detection, a fully automatic biochemical analyzer was used to detect the four blood lipid items, blood sugar and uric acid levels of serum samples. According to the requirements for animal tissue homogenate in the kit used for the detection index, 100 mg of liver tissue was accurately weighed, and 900 μL of PBS buffer was added at a weight: volume = 1:9 ratio. The weight unit is gram and the volume unit is milliliter. The handheld homogenizer was used to grind the homogenate in an ice water bath at 4°C and a speed of 2500 rpm and centrifuged for 10 min. The supernatant was taken and the liver homogenate was diluted into different multiples. BCA protein was quantified, and the optimal concentration was selected to dilute each sample and detect and calculate the final protein concentration of each sample. The TG, TC, ALT, and AST contents of the liver homogenate samples were detected and calculated using the kit.

[0153] For histological analysis, the liver and adipose tissue were fixed in 4% paraformaldehyde solution for 24 h and then embedded in paraffin. The liver and adipose were sectioned with hematoxylin-eosin at a thickness of approximately 3 μm and stained. The stained samples were observed under a 400x magnifying glass. The lipid levels of the liver and adipose were analyzed using ImageJ software. The website of ImageJ software is https: / / imagej.nih.gov / ij / .

[0154] According to the above animal experimental method, the experimental results of the colonization of Flavobacterium prausnitzii in germ-free mice can be obtained. The experimental results are disclosed above and will not be repeated here.

[0155] Cell culture was performed. HepG2 cells were cultured in a high-glucose medium containing 10% fetal bovine serum and 1% penicillin or streptomycin. The culture temperature was 37°C and the culture environment had 5% CO2. The cell growth status was observed every day, and new culture medium was replaced every 2-3 days. When the cells grew to 80% of the bottom area of ​​the culture bottle, cell modeling and drug intervention were performed. A 96-well plate was divided into 10 groups. Each group used model culture medium, with 6 replicates in each group. The first group was a blank control group without cells, the second group was a model group, and the remaining 8 groups corresponding to phytosphingosine were: Phy-0.01, Phy-0.05, Phy -0.1, Phy-0.25, Phy-0.5, Phy-1, Phy-2.5, Phy-5, Phy is the abbreviation of phytosphingosine, the number is the concentration, and the concentration unit is %. HepG2 cells that have been cultured for 48 hours were used to count the seed plates. Each well of the 96-well plate was calculated based on 10,000 cells and 100 μL of model culture medium. Model culture medium and corresponding concentration of phytosphingosine were added to make the cell concentration reach 100,000 / mL. After the seed plates were cultured in an incubator for 48 hours, 10 μL of CCK-8 solution was added to each well. After incubation for another 2 hours, the absorbance at 450 nm was measured with a microplate reader;

[0156] In the phytosphingosine intervention insulin resistance cell model, HepG2 cells were first cultured with 1 μM insulin for 48 hours, then switched to non-serum medium for another 12 hours, and finally, HepG2 cells were given 1 μM insulin medium and cultured in dimethyl sulfoxide for 48 hours with high-dose phytosphingosine 2.5 μM, low-dose phytosphingosine 1 μM, and no phytosphingosine.

[0157] In the phytosphingosine intervention high lipid cell model, HepG2 cells were intervened with palmitic acid reagent and oleic acid reagent at a concentration of 1:2 for 48 hours to form membranes, and then 1μM and 2.5μM phytosphingosine culture medium were given for 48 hours;

[0158] Freshly prepared Oil Red O working solution was used to stain HepG2 cells for 30 min, and then the cells were washed with 60% isopropanol to remove excess dye, rinsed with PBS buffer, stained with Mayer's hematoxylin for 2 min, and then rinsed with PBS buffer. The stained HepG2 cells were observed under a microscope to verify the effect of phytosphingosine on cells in the cell intervention model experiment.

[0159] From the results, if Fig.18 As shown in the results, under high-fat feeding conditions, compared with the model group gavaged with PBS, supplementation with phytosphingosine can improve the phlegm-damp phenotype of mice. Although there was no significant difference between the mice gavaged with low-dose phytosphingosine and the PBS group, supplementation with high-dose phytosphingosine reduced the greasy skin and drowsiness of mice in a dose-dependent manner.

[0160] like Fig.19 As shown, compared with the PBS-intervention model group of the phlegm-dampness-unaffected human flora transplantation model, 5 weeks of treatment with high-dose phytosphingosine can significantly reduce the body weight of mice, while there is no significant change in the low-dose phytosphingosine group. There is no significant difference in food intake among the model group, high-dose phytosphingosine group and low-dose phytosphingosine group, which indicates that high-dose phytosphingosine can effectively reduce obesity, and this effect is not caused by reduced food consumption or energy acquisition.

[0161] like Fig. 20 As shown, compared with the PBS group, the weights of white fat (epididymal fat) and beige fat (inguinal fat) in the PhyH group were significantly reduced, while the weight of brown fat (perirenal fat) did not change significantly. There were no significant differences in the weights of the three types of fat in the PhyL group.

[0162] HE staining was used to observe the morphology of white adipocytes. Compared with the PBS group, the white adipocytes in the PhyH and PhyL groups were reduced to varying degrees, and the number of cells in the field of view was significantly increased, which was more obvious in the PhyH group. ImageJ was used to calculate the volume of white adipocytes, and it was found that the volume of adipocytes in the PhyH and PhyL groups was significantly reduced, which was more obvious in the PhyH group. This suggests that phytosphingosine reduces lipid deposition in adipocytes in a dose-dependent manner.

[0163] like Fig.21As shown, after 5 weeks of treatment with phytosphingosine, the total cholesterol (TC), low-density lipoprotein (LDLC), and high-density lipoprotein (HDLC) in the PhyH and PhyL groups were significantly reduced compared with the model group intervened with PBS. Compared with the PhyL group, the lipid-lowering effect of the PhyH group was more significant. After 5 weeks of treatment with phytosphingosine, the fasting blood glucose levels in the PhyH and PhyL groups were significantly reduced compared with the PBS group. After 5 weeks of treatment with phytosphingosine, the fasting blood uric acid levels in the PhyH and PhyL groups were significantly reduced compared with the PBS group. The above results show that phytosphingosine intervention can effectively alleviate the metabolic disorders of blood lipids, blood sugar, and blood uric acid caused by phlegm-dampness.

[0164] like Fig. 22 As shown, histological analysis showed that compared with the PBS group, the size of lipid droplets in the liver tissue of the PhyH and PhyL groups was significantly reduced. The area proportion of lipid droplets was calculated using ImageJ, and compared with the PBS group, both the PhyH and PhyL groups were significantly reduced. The results of TC and TG detection in liver tissue homogenate showed that TG in the PhyH and PhyL groups was significantly reduced, and TC in the PhyH group was significantly reduced. Compared with the PBS group, there were no significant changes in liver AST and ALT in the PhyH and PhyL groups.

[0165] like Fig.23 As shown, an oleic acid-induced hyperlipidemia cell model was used to explore the effect of phytosphingosine intervention in vitro on lipid metabolism disorders. In this example, different phytosphingosine concentration gradients (Phy-0.01, Phy-0.05, Phy-0.1, Phy-0.25, Phy-0.5, Phy-1, Phy-2.5, Phy-5) were set to observe cell viability to screen safe and effective dosages. After incubation of HepG2 cells in each group for 48 hours, the cell viability of the Phy-5 group was significantly decreased compared with that of the model group (p < 0.001). The phytosphingosine concentrations in subsequent experiments were selected as the maximum concentrations of 2.5 μM and 1 μM that had no effect on cell viability.

[0166] like Fig.24 As shown in the figure, consistent with animal studies, after incubation of HepG2 cells in each group for 48 hours, the TG and TC of the model group cells were significantly higher than those of the blank group, indicating that the lipid deposition model was successfully established, and under the concentration conditions of Phy-2.5 and Phy-1, the TG and TC of the high-fat model cells could be significantly reduced. Oil red O staining showed that after treatment with high doses of Phy-2.5 and Phy-1, the number of red cells in the field of view decreased compared with the model group, indicating that the exogenous supplementation of phytosphingosine effectively reduced lipid deposition.

[0167] like Fig.25As shown, in this example, an insulin-induced HepG2 cell insulin resistance model was used to explore the effect of phytosphingosine intervention in vitro on glucose metabolism disorders. In this example, different phytosphingosine concentration gradients (Phy-0.01, Phy-0.05, Phy-0.1, Phy-0.25, Phy-0.5, Phy-1, Phy-2.5, Phy-5) were set to observe cell viability to screen safe and effective dosages. After incubation of HepG2 cells in each group for 48 hours, the cell viability of the Phy-5 group was significantly decreased compared with that of the model group (p < 0.01). The phytosphingosine concentrations in subsequent experiments were selected as the maximum concentrations of 2.5 μM and 1 μM that had no effect on cell viability.

[0168] like Fig.26 As shown in the figure, after 48h incubation of HepG2 cells in each group, the glucose consumption of the model group cells was significantly lower than that of the blank group, indicating that the insulin resistance model was successfully established. Under the concentration conditions of Phy-2.5 and Phy-1, the glucose consumption of the model cells was significantly increased, indicating that the exogenous supplementation of phytosphingosine effectively alleviated insulin resistance.

[0169] According to the above data analysis, phytosphingosine can improve insulin sensitivity of patients with metabolic disorders and reduce blood sugar, blood lipid and blood uric acid levels by regulating sugar metabolism, lipid metabolism and protein metabolism. The Flavobacterium prausnitzii cultured in this example can change the phytosphingosine content in the human body, and can be used in the treatment of metabolic disorders and improve the phlegm-damp constitution of the human body.

[0170] The above are only preferred embodiments of the present application and are not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

[0171] Although the above describes the specific implementation methods of the present application in conjunction with the accompanying drawings, it is not intended to limit the scope of protection of the present application. Technical personnel in the relevant field should understand that on the basis of the technical solution of the present application, various modifications or deformations that can be made by technical personnel in this field without creative work are still within the scope of protection of the present application.

Claims

1. Application of Flavobacterium prausnitzii in the treatment of metabolic disorders and improvement of human physique, characterized by: Flavonifractor plauti was deposited in the General Microbiology Center of China Culture Collection Administration on November 19, 2024, and the culture collection number is CGMCC No.32703.

2. The use according to claim 1, characterized in that: Metabolic disorders include obesity, diabetes, hyperlipidemia, hypertension, hyperuricemia, and non-alcoholic fatty liver disease.

3. The use according to claim 1, characterized in that: The human body constitution includes balanced constitution, yang deficiency constitution, yin deficiency constitution, qi deficiency constitution, phlegm-damp constitution, damp-heat constitution, blood stasis constitution, special constitution, and qi stagnation constitution. Flavobacterium prausnitzii can improve the phlegm-damp constitution of the human body.

4. The use according to claim 2, characterized in that: Supplementation of Flavobacterium prausnitzii can effectively intervene in metabolic disorders. Supplementation of Flavobacterium prausnitzii alone can reduce body weight, reduce lipid deposition in adipocytes, lower blood lipids, blood sugar and blood uric acid, and intervene in liver metabolism.

5. The use according to claim 3, characterized in that: Supplementation of Flavobacterium prausnitzii can effectively improve the phlegm-damp phenotype, and supplementation of Flavobacterium prausnitzii alone can improve skin oiliness and drowsiness.

6. The use according to claim 1, characterized in that: Flavobacterium prausnitzii treats metabolic disorders and improves human physical fitness by promoting the synthesis of phytosphingosine.

7. A composition, characterized in that: The method comprises the Flavobacterium prausnitzii as described in claim 1.

8. The composition according to claim 7, characterized in that: The composition further includes a pharmaceutically acceptable excipient.

9. The composition according to claim 7 or 8, characterized in that: The oral administration amount of Flavobacterium prausnitzii in the composition is at least 10 7 CFU / d, preferably 10 9 CFU / d.

10. A verification method for verifying the application according to claim 1, characterized in that: The subjects were identified as having a peaceful constitution and a phlegm-dampness constitution, and were divided into a peaceful constitution group without disease, a peaceful constitution group with disease, a phlegm-dampness group without disease, and a phlegm-dampness group with disease. The fecal microbiome of the subjects was analyzed to obtain the characteristic bacteria of phlegm-dampness constitution that are susceptible to metabolic disorders and bacteria with the potential to produce phytosphingosine. Metagenomic sequencing and absolute quantification of intestinal bacteria were then performed, and it was verified that the characteristic bacteria used to significantly identify human constitution and early screening of metabolic disorders was Flavobacterium prausnitzii. Flavobacterium prausnitzii was then cultured in vitro and phytosphingosine and phytosphingosine were detected in a targeted manner, and experiments were conducted on colonization of Flavobacterium prausnitzii in germ-free mice to verify that Flavobacterium prausnitzii can participate in promoting the synthesis of phytosphingosine. Animal model experiments and cell intervention model experiments were then performed to verify that Flavobacterium prausnitzii that participates in promoting the synthesis of phytosphingosine can be used in the treatment of metabolic disorders and the improvement of human constitution.

Images