Eimeria stigganii recombinant adeno-associated virus vaccine as well as preparation method and application thereof

Abstract

The invention discloses an Eimeria stigmas recombinant adeno-associated virus vaccine as well as a preparation method and application thereof, the Eimeria stigmas recombinant adeno-associated virus vaccine (rAAV9-ZsGreen1-HSP70) is constructed based on recombinant adeno-associated viruses, the Es-HSP70 is delivered into a host body by the vaccine through the recombinant viruses, and the Eimeria stigmas recombinant adeno-associated virus vaccine has the effects of preventing Eimeria stigmas diseases, relieving hepatic lesions, improving the immunity of a human body and the like. And the oocyst discharge amount is reduced. The E.stiedae recombinant adeno-associated virus vaccine prepared by the preparation method disclosed by the invention has good immune response, and the anticoccidial index of the E.stiedae recombinant adeno-associated virus vaccine can reach 169.48.

Description

Technical Field

[0001] The present invention discloses a recombinant adeno-associated virus vaccine for Eimeria skrjabini, a preparation method and an application thereof, and a virus vector vaccine (rAAV9-ZsGreen1-HSP70) for Eimeria skrjabini constructed based on the recombinant adeno-associated virus. The present invention belongs to the technical field of veterinary biological products. Background Art

[0002] Rabbit coccidiosis is caused by Eimeria spp. Eimeria ) parasitizes the intestines and liver of rabbits. It is a highly contagious protozoan disease caused by various coccidia of the rabbit family. It is one of the most common diseases in domestic rabbits and causes huge economic losses to the rabbit industry every year. Among the 11 currently recognized rabbit coccidiosis, Eimeria swirlingii ( Eimeria stiedae, E. stiedae ) is one of the most pathogenic and harmful coccidiosis, and is the only coccidia that parasitizes the liver and bile duct epithelial cells of rabbits. Rabbits of different ages can be infected. E. stiedae , especially young rabbits from weaning to 3 months old are more susceptible to infection, with morbidity and mortality rates as high as 90% and 60% respectively. Clinically, it often manifests as abdominal distension, diarrhea, growth retardation, weight loss and other symptoms, and young rabbits will eventually die. Adult rabbits often show subclinical symptoms, and the rabbits look healthy on the outside, but the feed conversion rate and growth performance are reduced.

[0003] At present, anticoccidial drugs are still the most effective method to control the spread and infection of rabbit coccidiosis. However, as the problems of coccidial resistance and residue of anticoccidial drugs become more and more prominent, vaccination with coccidial vaccines has become an important means of prevention and control of coccidiosis. However, the production cost of live coccidial vaccines is high, and there is a risk of virulence reversal, which limits their widespread application. Subunit vaccines are favored by researchers at home and abroad because of their high stability and low cost, but their immunogenicity is usually low and often requires adjuvants. There is currently no commercial vaccine that is effective against rabbit hepatic coccidiosis. Therefore, it is necessary to develop a new vaccine that is effective in preventing rabbit hepatic coccidiosis. Heat shock protein 70 (HSP70) is a class of molecular chaperone proteins that are relatively conservative in biological evolution and are ubiquitous in prokaryotes and eukaryotes. HSP70 has the biological function of assisting the folding of new proteins and correcting misfolded proteins. At the same time, it also has an adjuvant effect and can assist the presentation of other antigens. HSP70 has been shown to play an important role in host conversion, survival, reproduction, and virulence of a variety of parasites, such as Plasmodium falciparum, Toxoplasma gondii, Trypanosoma, Eimeria tenella, etc. In addition, rEs-HSP70 has been shown to have good reactogenicity. Summary of the invention

[0004] The present invention aims to provide a recombinant adeno-associated virus vaccine for Eimeria skrjabini and a preparation method and application thereof, which can prevent rabbits from E. stiedae Infection with the recombinant adeno-associated virus vaccine rAAV9-ZsGreen1-HSP70.

[0005] The present invention provides a method for preparing a recombinant adeno-associated virus vaccine of Eimeria skrjabini, and the technical scheme adopted is: To prepare the recombinant adeno-associated virus particle vaccine rAAV9-ZsGreen1-HSP70, the eukaryotic expression vector pAAV-ZsGreen1-HSP70 capable of expressing the Es-HSP70 protein was first constructed, and then pAAV-ZsGreen1-HSP70 was co-transfected with the auxiliary plasmid pHelper and pAAV-RC9 into HEK-293T cells for virus packaging. After packaging, the recombinant virus particles were purified by chloroform treatment-PEG / NaCl precipitation-chloroform extraction. After purification, the virus morphology was observed by transmission electron microscopy and the virus titer was detected by RT-qPCR. Finally, the in vitro activity of the recombinant virus was verified by infecting HEK-293T cells.

[0006] The method for preparing a recombinant adeno-associated virus vaccine of Eimeria skrjabini of the present invention comprises the following steps: (1) Construction of eukaryotic expression vector pAAV-ZsGreen1-HSP70 Primers were designed to amplify the Es-HSP70 gene of Eimeria skrjabini by PCR, and the sequence was as follows: F: ATTCGAACATCGATTGAATTCATGATTCAAAAGAAGTACAACAAGGATC; R: CAGGTCGACTCTAGAGGATCCTTAGTGGCTGTTGTAATCATCATCG; RNA from the sporulated oocyst stage of Eimeria skrjabini was extracted and reverse transcribed into cDNA, which was used as a template for PCR amplification of Es-HSP70. Then, Es-HSP70 was inserted between the BamH I and EcoR I restriction sites of the pAAV-IRES-ZsGreen1 vector using a seamless cloning method to construct the eukaryotic expression vector pAAV-ZsGreen1-HSP70.

[0007] (2) Packaging of recombinant adeno-associated virus rAAV9-ZsGreen1-HSP70 The eukaryotic expression vector pAAV-ZsGreen1-HSP70 and the auxiliary plasmids pHelper and pAAV-RC9 were transformed into Stable competent Escherichia coli, and then the three endotoxin-free plasmids were extracted. The three endotoxin-free plasmids (1 μg each) and the transfection reagent Lip2000 (9 μL) were co-transfected into HEK-293T cells by liposome transfection. After 6 hours of transfection, the cells were replaced with new serum-free medium and cultured for 72 hours to complete the virus packaging. The virus packaging process can be verified by observing the green fluorescence of ZsGreen1 by fluorescence microscopy and detecting the expression of Es-HSP70 by Western blot.

[0008] (3) Collection and purification of recombinant adeno-associated virus rAAV9-ZsGreen1-HSP70 After virus packaging is completed, harvest the cells, resuspend them in an appropriate amount of PBS buffer, and freeze-thaw them repeatedly three times in liquid nitrogen and a 37°C water bath. Then centrifuge them at 4°C, 5000r / min for 20min, and collect the supernatant in another new centrifuge tube. The supernatant collected at this time is the crude extract of recombinant adeno-associated virus, which needs to be further purified.

[0009] Add 1 / 10 volume of chloroform to the crude virus extract, and then purify it using the chloroform treatment-PEG / NaCl precipitation-chloroform extraction method. After chloroform extraction, the upper aqueous phase is the recombinant adeno-associated virus purified solution, which is ultrafiltered with a 100 kDa ultrafiltration tube, concentrated 10 times the virus volume, replaced with 5 times the volume of sterile PBS buffer, and packaged in 50 μL / tubes and stored in a -80°C refrigerator. Take 10 μL of the purified recombinant adeno-associated virus and dilute it, and observe the morphology of the virus particles using TEM. The titer of the purified virus was detected by RT-qPCR. The empty plasmid pAAV-IRES-ZsGreen1 was diluted as the standard plasmid, and the standard copy gradient was set to 10 7 , 10 8 , 10 9 , 10 10 , 10 11 Purified rAAV9-ZsGreen1-HSP70 was treated with BeyoZonase™ super nuclease and proteinase K, and then diluted for testing. Three replicates were set for each sample, and a blank control group was set up for RT-qPCR. The virus titer was calculated according to the standard curve in vg / mL.

[0010] (4) In vitro activity detection of recombinant adeno-associated virus rAAV9-ZsGreen1-HSP70 According to MOI=10 5rAAV9-ZsGreen1-HSP70 was added to vg / cell to infect the cells. Fresh culture medium was replaced 12 h after infection. The expression of fluorescent protein was observed under an inverted fluorescence microscope 72 h later. Cell protein samples were collected and the expression of Es-HSP70 protein was detected by Western blot.

[0011] As a preferred embodiment of the present invention, the eukaryotic expression vector pAAV-ZsGreen1-HSP70 described in step (1) is obtained by inserting the Es-HSP70 protein encoding gene sequence between the BamH I and EcoR I restriction sites of the pAAV-IRES-ZsGreen1 vector.

[0012] As a preferred embodiment of the present invention, the virus packaging conditions in step (2) are as follows: the ratio of the three endotoxin-free plasmids is 1:1:1; the ratio of the transfection reagent to the total amount of the three plasmids is 3:1, and the packaging time is 72 hours.

[0013] As a preferred embodiment of the present invention, the virus is purified by chloroform treatment-PEG / NaCl precipitation-chloroform extraction, and the purified solution is ultrafiltered with a 100 kDa ultrafiltration tube, concentrated with 10 times the volume of the virus, and replaced with 5 times the volume of sterile PBS buffer.

[0014] As a preferred embodiment of the present invention, the recombinant adeno-associated virus particle vaccine of the present invention is in the shape of a regular icosahedron, has a uniform size of about 20 nm, and a titer higher than 1×10 12 vg / mL.

[0015] The positive effect of the present invention is that it provides a recombinant adeno-associated virus vaccine carrying rabbit Eimeria stiebensis Es-HSP70 antigen, which delivers Es-HSP70 into the host through the recombinant virus, and has the advantages of preventing Eimeria stiebensis, alleviating liver lesions, and reducing the amount of oocysts discharged. The E. stiebensis recombinant adeno-associated virus vaccine prepared by the present invention has a good immune response, and the anti-coccidial index can reach 169.48. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 PCR amplification of Es-HSP70 and double restriction enzyme digestion identification results of pAAV-ZsGreen1-HSP70; A: PCR amplification results of Es-HSP70 (M1: DL 2000 DNA Marker; 1: PCR amplification product of Es-HSP70); B: Double enzyme digestion results of pAAV-ZsGreen1-HSP70 (M2: DL 10000 DNA Marker; 2: Double enzyme digestion product); Figure 2Fluorescence images and Western blot verification after pAAV-ZsGreen1-HSP70 transfection; A: Expression of fluorescent protein 72 h after transfection; B. Expression analysis of HSP70 protein (M: protein marker; Control: HEK-293T cells); Figure 3 Transmission electron microscopy image of rAAV9-ZsGreen1-HSP70; Figure 4 Standard curve of pAAV-IRES-ZsGreen1 vector; Figure 5 In vitro activity of rAAV9-ZsGreen1-HSP70; A: Expression of fluorescent protein in infected cells 72 h; B: Expression of HSP70 protein in infected cells 72 h (C: HEK-293T cells; Z: rAAV9-ZsGreen1 infection group; H: rAAV9-ZsGreen1-HSP70 infection group); Figure 6 Antibody levels in serum after rAAV9-ZsGreen1-HSP70 vaccination; There are significant differences between data marked with different letters (P<0.05), and there are no significant differences between data marked with the same letter (P>0.05); Figure 7 Cytokine levels in serum after rAAV9-ZsGreen1-HSP70 vaccination; There are significant differences between the data marked with different letters (P<0.05), and there are no significant differences between the data marked with the same letter (P>0.05); Figure 8 Liver lesions of each group were dissected 21 days after the attack; A: blank control group; B: non-immunized group; C: vector-adjuvant control group; D: virus empty control group; E: recombinant protein rEs-HSP70 immunization group; F: recombinant adeno-associated virus vector vaccine rAAV9-ZsGreen1-HSP70 immunization group; Fig. 9 HE staining of liver tissues of each group 21 days after insect attack; A: blank control group; B: non-immunized insect-challenged group; C: vector-adjuvant control group; D: virus-free control group; E: recombinant protein rEs-HSP70 immunized group; F: recombinant adeno-associated virus vector vaccine rAAV9-ZsGreen1-HSP70 immunized group. DETAILED DESCRIPTION

[0017] To further illustrate the technology and effects of the present invention, the present invention is further described through the following embodiments and drawings. However, the described embodiments are only part of the embodiments of the present invention, and the present invention is not limited to the described embodiments. The specific implementation methods are as follows: Base Materials: 1. Reagents and Instruments Restriction endonucleases and PrimeSTAR® Max DNA polymerase were purchased from Takara; endotoxin-free plasmid miniprep kit was purchased from Yisheng Biotechnology; Lip2000 liposome transfection reagent was purchased from Invitrogen; HRP-conjugated Affinipure Goat Anti-Mouse IgG (H+L) was purchased from Proteintech; Es-HSP70 polyclonal antibody was prepared and stored in our laboratory. Fluorescence quantitative PCR instrument was purchased from Jena Analytical Instruments (Germany) Co., Ltd.; 4°C centrifuge was purchased from Thermo Fisher Scientific, USA; vertical electrophoresis instrument was purchased from Bio-Rad Biomedical Products (Shanghai) Co., Ltd.

[0018] 2. Insect strains, bacterial strains, plasmids and cell lines Sporulated oocysts of Eimeria skrjabini were stored in our laboratory; pAAV-IRES-ZsGreen1, pHelper and pAAV-RC9 were purchased from Changsha Abiwei Biotechnology; HEK-293T cells were stored in our laboratory; Stable competent cells were purchased from Bio-Tech Biotechnology.

[0019] 3. Experimental Animals 30-day-old New Zealand rabbits were purchased from Changchun Changsheng Biotechnology Co., Ltd. They were kept in a coccidia-free environment and had free access to food and water without anticoccidial drugs during the experiment. Example 1

[0020] Construction and identification of eukaryotic expression vector pAAV-ZsGreen1-HSP70 Using SnapGene software, specific primers were designed according to the Es-HSP70 gene sequence (GenBank: OK481748.1) to amplify the Es-HSP70 gene by PCR. The sequence is as follows: F: ATTCGAACATCGATTGAATTCATGATTCAAAAGAAGTACAACAAGGATC; R: CAGGTCGACTCTAGAGGATCCTTAGTGGCTGTTGTAATCATCATCG; RNA from the sporulated oocyst stage of Eimeria skrjabini was extracted and reverse transcribed into cDNA, which was used as a template for PCR amplification of the Es-HSP70 gene. Figure 1 As shown in (A), the size is 1 167 bp, which is in line with the expected size. Then, Es-HSP70 was inserted between the BamH I and EcoR I restriction sites of the pAAV-IRES-ZsGreen1 vector using the seamless cloning method to construct the eukaryotic expression vector pAAV-ZsGreen1-HSP70. The recombinant expression vector was verified by endonuclease. The results are shown in 1 (B). After double enzyme digestion, two bands appeared, which were the pAAV-IRES-ZsGreen1 vector and the target gene Es-HSP70, indicating that the eukaryotic expression vector was successfully constructed. Example 2

[0021] Preparation of recombinant adeno-associated virus vector vaccine rAAV9-ZsGreen1-HSP70 The eukaryotic expression vector pAAV-ZsGreen1-HSP70 and the auxiliary plasmids pHelper and pAAV-RC9 were transformed into Stable competent cells, and then the three endotoxin-free plasmids were extracted. The three endotoxin-free plasmids (1 μg each) and the transfection reagent Lip2000 (9 μL) were co-transfected into a six-well plate inoculated with HEK-293T cells in advance by liposome transfection. After 6 hours of transfection, the medium was replaced with new serum-free medium and cultured for 72 hours to complete the virus packaging. Strong green fluorescence was observed 72 hours after transfection. Figure 2 (A) indicates that the pAAV-ZsGreen1-HSP70 eukaryotic expression vector has a high transfection efficiency. Western blot results show that rAAV9-ZsGreen1-HSP70 has a single band near 49 kDa, which is consistent with the expected size, indicating that the constructed recombinant plasmid can successfully express the target protein Figure 2 (B).

[0022] After the virus packaging is completed, the cells are harvested and resuspended in an appropriate amount of PBS buffer, and then repeatedly frozen and thawed three times in liquid nitrogen and a 37°C water bath, and then purified by chloroform treatment-PEG / NaCl precipitation-chloroform extraction. After chloroform extraction, the upper aqueous phase is the recombinant virus particles, which are ultrafiltered using a 100 kDa ultrafiltration tube, concentrated by 10 times the virus volume, replaced by 5 times the volume, and packaged in 50 μL / tubes and stored in a -80°C refrigerator. After taking 10μL of dilution, the morphology of the virus particles was observed using a transmission electron microscope. The results are as follows Figure 3 As shown, rAAV9-ZsGreen1 and rAAV9-ZsGreen1-HSP70 virus particles with a size of about 20 nm were observed, and the size was uniform.

[0023] The packaged virus titer was detected by RT-qPCR. The empty plasmid pAAV-IRES-ZsGreen1 was used as the standard plasmid for dilution, and the standard copy gradient was set to 10 7 , 10 8 , 10 9 , 10 10 , 10 11 . Take the purified rAAV9-ZsGreen1 and rAAV9-ZsGreen1-HSP70, treat them with DNAaseI and proteinase K, and dilute them for testing. Three replicates of each sample were set up, and a blank control group was set up for RT-qPCR. The virus titer was calculated according to the standard curve, unit: vg / mL. The pAAV-IRES-ZsGreen1 genome standard curve obtained by RT-qPCR is as follows Figure 4 As shown, the formula is: y=-3.075x+52.06, R 2 =0.9987. Based on the standard curve, the rAAV9-ZsGreen1-HSP70 virus titer was higher than 1.0×10 12 vg / mL. Example 3

[0024] In vitro activity detection of recombinant adeno-associated virus vector vaccine rAAV9-ZsGreen1-HSP70 3×10 per well 5 HEK-293T cells were seeded in a six-well plate at a density of 10 μg / mL. When the cell density reached about 80%, the recombinant virus particles were used to infect the cells. 5 vg / cell was infected with rAAV9-ZsGreen1-HSP70, and fresh culture medium was replaced 12 h after infection. After 72 h, the expression of fluorescent protein was observed under an inverted fluorescence microscope. The results are shown in Figure 5 As shown in (A), the rAAV9-ZsGreen1-HSP70 group has strong green fluorescence. Western blot results show that the rAAV9-ZsGreen1-HSP70 group has a single band near 49kDa, which is consistent with the expected size 5 (B). The above results indicate that the prepared rAAV9-ZsGreen1-HSP70 has infectious activity. Example 4

[0025] Observation on the immune protection effect of recombinant adeno-associated virus particle vaccine rAAV9-ZsGreen1-HSP70 1. Experimental Design 30-day-old SPF New Zealand rabbits were raised under coccidia-free conditions until 35 days old and randomly divided into 6 groups, 6 in each group. The following immunization procedure was used for the parasite attack experiment, as shown in Table 1.

[0026] Table 1 Immunization schedule

[0027] Serum was collected before and after two immunizations to detect changes in serum cytokines and specific antibodies. After the rabbits in each group were orally infected with sporulated oocysts of Eimeria skrjabini, they were kept for 21 days, all rabbits were killed, and the weight, survival rate, liver index, feed-to-meat ratio, lesion score, oocyst excretion and other indicators of each group were counted. Finally, the anti-coccidial index (ACI) was calculated to evaluate the immune protection effect of the recombinant adeno-associated virus particle vaccine.

[0028] 2. Observation of immune protection effect 2.1 Weight change and feed-to-meat ratio The rabbits in each group were weighed and recorded at 35 days of age (first vaccination), 63 days of age (attack on the worms) and 84 days of age (sacrificed), and the average weight gain and relative weight gain rate were calculated.

[0029] Weight gain after immunization = body weight at challenge - body weight at first immunization; weight gain after challenge = body weight at slaughter - body weight at challenge.

[0030] Relative weight gain rate = average weight gain of each experimental group after attacking insects / average weight gain of non-immunized and non-attacked groups after attacking insects × 100%.

[0031] Feed-to-meat ratio = (total amount of feed before feeding - total amount of feed remaining after slaughtering) / weight gain after attacking insects 2.2 Oocyst count Collect the feces of rabbits in each group and mix them evenly. Weigh 2g of feces from each group, add appropriate amount of tap water, stir well, and filter through 4 layers of gauze. Transfer the filtrate to a 50mL centrifuge tube, centrifuge at 2500 r / min for 10min, and discard the supernatant. Resuspend the precipitate with a small amount of saturated saline, transfer it to a 100mL measuring cylinder, add saturated saline to 60mL and mix thoroughly. Pipette the suspension and place it in a Mesquite egg counting plate. After standing at room temperature for 5 minutes, place the Mesquite egg counting plate under a microscope for observation and counting. Oocysts per gram (OPG) = average number of oocysts in the left and right counting chambers × 200.

[0032] Oocyst reduction rate = (OPG of the attack control group - OPG of the immune group) / OPG of the attack control group × 100%.

[0033] The oocyst value was calculated according to Table 2.

[0034] Table 2 Conversion relationship between OPG and oocyst value

[0035] 2.3 Liver index and liver lesion score 21 days after the attack, the rabbits in each group were killed and their livers were taken out to record the liver weight.

[0036] Liver index = liver weight / body weight × 100%.

[0037] Liver lesion values ​​were recorded according to the liver lesion scoring standard. The scoring standard is shown in Table 3.

[0038] Table 3 Scoring criteria for liver lesions

[0039] Lesion value = average lesion score × 10 2.4 Anticoccidial index (ACI) According to the relative weight gain rate, oocyst value, lesion value and survival rate of each group, the anti-coccidial index (ACI) of each group was calculated to evaluate the protective effect of the recombinant adeno-associated virus particle vaccine rAAV9-ZsGreen1-HSP70 against Eimeria skrjabini infection. ACI = (survival rate + relative weight gain rate) - (lesion value + oocyst value). ACI ≥ 180 is an excellent protective effect, 160 ≤ ACI ≤ 179 is a good protective effect, ACI < 120-160 is a poor protective effect, and ACI < 120 is ineffective.

[0040] 2.5 Detection of cytokines and specific antibodies in serum The serum was collected before immunization and after two immunizations, and the cytokines IL-2, IL-10 and IFN-γ were measured using the corresponding ELISA kits. The indirect ELISA method based on the recombinant protein rEs-HSP70 was used to detect the specific IgG antibody level in the serum of the experimental rabbits.

[0041] 2.6 Liver autopsy lesions and histopathological changes After the animals were killed, the livers were removed, and the appearance was observed and photographed to record the lesions. The livers of each group were randomly taken to prepare pathological sections, which were stained with HE, and the lesions of each group were observed under a microscope.

[0042] 3. Analysis of immune protection effect 3.1 The graphs of the present invention were generated using GraphPad Prism 9 software. The data of the results of the present invention were subjected to one-way ANOVA and difference significance analysis using IBM SPSS Statistics 27 statistical software to determine the statistical differences between the groups. The data were expressed as "mean ± standard deviation (SD)", and P < 0.05 was considered to be significant.

[0043] 3.2 From Tables 4 and 5, it can be seen that the group immunized with the recombinant adeno-associated virus vaccine rAAV9-ZsGreen1-HSP70 was significantly better than the non-immunized group, the vector-adjuvant group and the virus empty group in terms of weight gain after attack, oocyst excretion, average lesion score, feed-to-meat ratio and liver index (P<0.05). The relative weight gain rate and oocyst reduction rate of the rAAV9-ZsGreen1-HSP70 immunization group were 85.48% and 69.8%, respectively, which were also better than the positive control group. From Table 6, it can be seen that the ACI of the recombinant protein rEs-HSP70 was 154.23, with poor protection effect, while the ACI of the recombinant adeno-associated virus vaccine rAAV9-ZsGreen1-HSP70 immunization group was as high as 169.48, which was significantly better than the immunization groups of other infection groups. These results show that the rAAV9-ZsGreen1-HSP70 vaccine has a good protective effect against Eimeria skrjabini infection.

[0044] Table 4 Body weight changes and feed-to-meat ratio of each group

[0045] Note: Different lowercase letters in the same column in the table indicate significant differences (P<0.05), and the same letters indicate no significant differences (P>0.05).

[0046] Table 5 Oocyst counts, lesion scores and liver indexes in each group

[0047] Note: Different lowercase letters in the same column in the table indicate significant differences (P<0.05), and the same letters indicate no significant differences (P>0.05).

[0048] Table 6 Anticoccidial index (ACI) of each group

[0049] 3.3 From Figure 6 It can be seen that there was no significant difference in the specific antibody IgG levels in the serum of the experimental rabbits in each group before immunization. After booster immunization, the specific IgG antibody levels in the serum of the experimental rabbits in each group continued to increase, and it can be seen that the specific IgG antibody levels in the serum of the rAAV9-ZsGreen1-HSP70 immunization group were significantly higher than those in the other control groups (P<0.05). Figure 7 The results showed that after booster immunization, the levels of INF-γ, IL-2 and IL-10 in the rAAV9-ZsGreen1-HSP70 immunization group were significantly higher than those in other control groups (P<0.05). These results indicate that rAAV9-ZsGreen1-HSP70 stimulates the body to produce a specific immune response against Es-HSP70 after entering the body.

[0050] 3.4 The autopsy revealed that the liver of the blank control group was healthy, normal in size and without lesions. Figure 8 (A) The livers of rabbits in the non-immunized challenge group, the vector-adjuvant group, and the virus-free group were highly swollen, and the surface of the liver was filled with yellow-white nodules of varying sizes, many of which were fused into large bubble-like nodules. Figure 8 (BD). In contrast, the liver lesions in the rAAV9-ZsGreen1-HSP70 immunization group were milder, the liver enlargement was not obvious, and there were a certain number of miliary nodules on the liver surface. Figure 8 (F).

[0051] HE staining results showed that the sections of the blank control group had no obvious abnormalities. The bile ducts were symmetrical in size and complete in structure. The bile duct single-layer columnar epithelial cells on the wall of the bile duct were arranged neatly and orderly. The hepatocytes were arranged radially with a clear and complete structure. Fig. 9 (A) The liver tissues of rabbits in the non-immunized worm group, the vector-adjuvant group, and the virus-free group were severely damaged, with necrosis and detachment of bile duct epithelial cells, and fragmented structures. The worms at different developmental stages, such as schizonts, merozoites, and oocysts, could also be observed. Fig. 9 (BD). Among them, the liver tissue of the rAAV9-ZsGreen1-HSP70 immunization group was also damaged to a certain extent, but compared with the other worm-challenged groups, the number of worms was less and the degree of damage to the bile duct epithelial cells was lower, as shown in Fig. 9 (F). These results indicate that rabbits immunized with rAAV9-ZsGreen1-HSP70 have a certain degree of protection against Eimeria skrjabini.

Claims

1. A method for preparing a recombinant adeno-associated virus vaccine of Eimeria skrjabini, characterized in that: First, a eukaryotic expression vector pAAV-ZsGreen1-HSP70 capable of expressing Es-HSP70 protein was constructed, and then pAAV-ZsGreen1-HSP70 was co-transfected with auxiliary plasmids pHelper and pAAV-RC9 into HEK-293T cells to package the recombinant adeno-associated virus rAAV9-ZsGreen1-HSP70. The recombinant virus particles were purified by chloroform treatment-PEG / NaCl precipitation-chloroform extraction. After purification, the virus morphology was observed by transmission electron microscopy and the virus titer was detected by RT-qPCR. Finally, the in vitro activity of the recombinant virus was verified by infecting HEK-293T cells. The recombinant adeno-associated virus particle vaccine is in the shape of a regular icosahedron, with a uniform size of about 20 nm and a titer higher than 1×10 12 vg / mL.

2. The method for preparing a recombinant adeno-associated virus vaccine of Eimeria skrjabini according to claim 1, comprising the following steps: (1) Construction of eukaryotic expression vector pAAV-ZsGreen1-HSP70 Primers were designed to amplify the Es-HSP70 gene of Eimeria skrjabini by PCR, and the sequence was as follows: F: ATTCGAACATCGATTGAATTCATGATTCAAAAGAAGTACAACAAGGATC; R: CAGGTCGACTCTAGAGGATCCTTAGTGGCTGTTGTAATCATCATCG; RNA from the sporulated oocyst stage of Eimeria skrjabini was extracted and reverse transcribed into cDNA, which was used as a template for PCR amplification of Es-HSP70. Then, Es-HSP70 was inserted between the BamH I and EcoR I restriction sites of the pAAV-IRES-ZsGreen1 vector using a seamless cloning method to construct a eukaryotic expression vector pAAV-ZsGreen1-HSP70. (2) Packaging of recombinant adeno-associated virus rAAV9-ZsGreen1-HSP70 The eukaryotic expression vector pAAV-ZsGreen1-HSP70 and the auxiliary plasmid pHelper and pAAV-RC9 endotoxin-free plasmids were extracted respectively; the three were co-transfected into HEK-293T cells with the transfection reagent Lip2000 (9 μL) at a ratio of 1:1:1 (1 μg each), and the cells were replaced with new serum-free medium 6 hours after transfection and cultured for 72 hours to complete virus packaging; (3) Collection and purification of recombinant adeno-associated virus rAAV9-ZsGreen1-HSP70 After virus packaging is completed, the cells are harvested, resuspended in an appropriate amount of PBS buffer, and then repeatedly frozen and thawed three times in liquid nitrogen and a 37°C water bath, and then centrifuged at 4°C, 5000r / min for 20min, and the supernatant is collected in another new centrifuge tube. The collected supernatant is the crude extract of recombinant adeno-associated virus and purified; 1 / 10 volume of chloroform was added to the crude virus extract, and then the extract was purified by chloroform treatment-PEG / NaCl precipitation-chloroform extraction method; the upper aqueous phase after chloroform extraction was the purified recombinant adeno-associated virus solution, which was ultrafiltered with a 100 kDa ultrafiltration tube, concentrated by 10 times the virus volume, replaced with 5 times the volume of sterile PBS buffer, and packaged in 50 μL / tubes and stored in a -80°C refrigerator; 10 μL of the purified recombinant adeno-associated virus was diluted and the morphology of the virus particles was observed by transmission; the empty plasmid pAAV-IRES-ZsGreen1 was used as a standard, and the purified rAAV9-ZsGreen1-HSP70 was treated with BeyoZonase™ super nuclease and proteinase K, and its titer was detected by RT-qPCR, unit: vg / mL; (4) In vitro activity detection of recombinant adeno-associated virus rAAV9-ZsGreen1-HSP70 According to MOI=10 5 rAAV9-ZsGreen1-HSP70 was added to vg / cell to infect the cells. Fresh culture medium was replaced 12 h after infection. The expression of fluorescent protein was observed under an inverted fluorescence microscope 72 h later. Cell protein samples were collected and the expression of Es-HSP70 protein was detected by Western blot.

Images