Marker FOXO1 related to human synovial senescence and application of marker FOXO1 in delaying synovial senescence

Abstract

The invention discloses a human synovial aging related marker FOXO1 and application of the human synovial aging related marker FOXO1 in delaying synovial aging. By describing senescence-related transcriptome changes of different cell types and related regulatory networks thereof, it is found that genes related to cell adhesion and cartilage development are down-regulated in the senescence process along with senescence angiogenesis and senescence-related gene up-regulation. In addition, specific cell-cell communication in the senescence synovial reflects senescence-related inflammation and tissue remodeling, including vascular hyperplasia and tissue fibrosis. The invention discloses that FOXO1 is a main regulatory factor for down-regulating DEG of senescence, and verifies that FOXO1 is down-regulated in lining and sublining MSC (mesenchymal stem cells) of old synovial membranes, and further, FOXO1 is knocked out from human mesenchymal stromal cells derived from human embryonic stem cells, so that obvious senescence acceleration can be found, the understanding of people on joint degeneration is improved, and the application of FOXO1 in treating joint degeneration is realized. Therefore, information is provided for development of a new therapy for recovering the vitality of the joints of the old people.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a marker FOXO1 associated with human synovial aging and an application thereof in delaying synovial aging. Background Art

[0002] The synovium is a thin layer of tissue in the joints that secretes synovial fluid. With aging, it can cause severe shoulder pain and other joint diseases. The histological changes observed in the synovial tissue are believed to be related to synovial aging. Chronic inflammation is a characteristic of elderly joints observed in the aged synovium and may lead to the destruction of normal tissue structure and function, resulting in tissue damage and degeneration.

[0003] However, all previous studies have shown that phenotypes related to inflammation and tissue remodeling have a clear relationship with disease conditions and are mostly focused on arthritis. For example, the synovial lining layer of osteoarthritis exhibits low-grade chronic inflammation, which is mainly mediated by the innate immune system. Other phenotypic characteristics associated with inflammation have also been reported in the aged synovium, such as the accumulation of advanced glycosylation and products (AGEs) and severe oxidative stress. Other studies have explored the role of synovial fibroblasts, macrophages, and endothelial cells in maintaining joint health and destroying the integrity of articular cartilage during inflammatory joint diseases, in which various molecules that promote inflammation and tissue remodeling are secreted in diseased synovium, emphasizing the molecular mechanisms that have been shown to control the pathological activities of resident synovial cells. In addition, studies on synovium based on single-cell sequencing technology have also focused on the pathological analysis of arthritis. For example, in rheumatoid arthritis, synovial tissue undergoes significant hyperplasia, inflammation, and invasiveness, and destroys joints.

[0004] However, the above studies are all studies on human synovium with arthritis, which cannot indicate the phenotypic characteristics and molecular mechanisms of human synovial aging. The understanding of the phenotype and molecular mechanisms of synovial aging is still insufficient, and the molecular targets that mediate synovial aging still need to be further studied. It is worth noting that synovial cells are highly heterogeneous in their response to aging-related stress, so it is necessary to conduct in-depth research on each cell type of the synovium under single-cell resolution conditions, which is expected to reveal the complex physiological and pathological changes in the synovium of the elderly. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to delay aging.

[0006] In a first aspect, the present invention claims a new use of FOXO1 protein or a substance for increasing the content and / or activity of FOXO1 protein.

[0007] The present invention provides the use of FOXO1 protein or a substance for increasing the content and / or activity of FOXO1 protein in delaying aging or preparing a product for delaying aging.

[0008] In a second aspect, the present invention claims a product for delaying aging.

[0009] The anti-aging product claimed in the present invention comprises FOXO1 protein or a substance that increases the content and / or activity of FOXO1 protein.

[0010] In a third aspect, the present invention claims a new use of a substance for reducing the content and / or activity of FOXO1 protein.

[0011] The present invention claims the use of a substance for reducing the content and / or activity of FOXO1 protein in any one of the following D1)-D6):

[0012] D1) Construction of senescent cells;

[0013] D2) preparing products for constructing senescent cells;

[0014] D3) Screening or assisting in the screening of drugs that delay aging;

[0015] D4) preparing products for screening or assisting in screening of drugs for delaying aging;

[0016] D5) Research or assist in researching the aging mechanism of organisms, tissues or cells;

[0017] D6) Preparation of products for studying or assisting in studying the aging mechanism of organisms, tissues or cells.

[0018] In a fourth aspect, the present invention claims a product, the function of which is any one of the following E1)-E3):

[0019] E1) Construction of senescent cells;

[0020] E2) Screening or assisting in the screening of drugs that delay aging;

[0021] E3) Study or assist in studying the aging mechanism of organisms, tissues or cells.

[0022] The active ingredient of the product having any one of the functions E1) to E3) as claimed in the present invention is a substance that reduces the content and / or activity of FOXO1 protein.

[0023] In a fifth aspect, the present invention claims a new use of a substance for detecting the expression level of FOXO1.

[0024] The substance for detecting the expression level of FOXO1 claimed in the present invention is used in identifying or assisting in identifying the aging level of an organism, tissue or cell, or in preparing a product for identifying or assisting in identifying the aging level of an organism, tissue or cell.

[0025] In a sixth aspect, the present invention claims protection for a product for identifying or assisting in identifying the level of aging of an organism, tissue or cell.

[0026] The product for identifying or assisting in identifying the aging level of an organism, tissue or cell claimed in the present invention includes a substance for detecting the expression level of FOXO1.

[0027] Any of the following methods F1)-F7) also belongs to the protection scope of the present invention:

[0028] F1) A method for delaying aging of an organism, tissue or cell, comprising the step of contacting the organism, tissue or cell with a FOXO1 protein or a substance that increases the content and / or activity of the FOXO1 protein;

[0029] F2) A method for constructing senescent cells, comprising the step of introducing a substance that reduces the content and / or activity of FOXO1 protein into a recipient cell (ex vivo cell);

[0030] F3) A method for screening or assisting in screening a drug for delaying aging, comprising the step of screening a drug for delaying aging using senescent cells constructed by the method described in F2);

[0031] F4) A method for studying or assisting in studying the aging mechanism of an organism, tissue or cell, comprising the step of using the senescent cells constructed by the method described in F2) to study the aging mechanism of an organism, tissue or cell;

[0032] F5) A method for changing the senescence state of isolated cells, comprising the step of introducing a substance that reduces the content and / or activity of FOXO1 protein into the isolated cells;

[0033] F6) A method for promoting cell senescence, comprising the step of introducing a substance that reduces the content and / or activity of FOXO1 protein into a recipient cell (ex vivo cell);

[0034] F7) A method for identifying or assisting in identifying the level of aging of an organism, tissue or cell, comprising the step of detecting the expression level of FOXO1 in a sample from a subject.

[0035] In the above method, the senescent cells have at least one of the following characteristics: growth retardation, decreased clone formation ability, decreased Ki67-positive cells, S phase arrest, increased reactive oxygen (ROS) levels, shortened telomeres, increased P16INK4a expression, increased IL6 secretion levels, loss of heterochromatin, decreased expression of heterochromatin-associated proteins HP1α and HP1γ, and abnormal expression of pro-fibrotic and pro-inflammatory factors.

[0036] The changing of the aging state of the ex vivo cells is to make the ex vivo cells have at least one of the following characteristics: growth retardation, decreased clone formation ability, decreased Ki67-positive cells, S phase arrest, increased reactive oxygen (ROS) levels, shortened telomeres, increased P16INK4a expression, increased IL6 secretion levels, loss of heterochromatin, decreased expression of heterochromatin-related proteins HP1α and HP1γ, and abnormal expression of pro-fibrotic and pro-inflammatory factors.

[0037] In any of the above-mentioned uses, products or methods, the substance that increases the activity and / or content of FOXO1 protein may be a nucleic acid molecule encoding FOXO1 protein or an expression cassette, recombinant vector, recombinant microorganism or recombinant cell line containing the nucleic acid molecule.

[0038] In any of the above-mentioned uses, products or methods, the substance that reduces the activity of FOXO1 protein may be a protein, polypeptide or small molecule compound that inhibits the function of FOXO1 protein.

[0039] The substance that reduces the content of FOXO1 protein can be a substance that inhibits the synthesis of FOXO1 protein or promotes the degradation of FOXO1 protein or knocks down or knocks out the FOXO1 gene.

[0040] Furthermore, the substance for knocking down the gene encoding FOXO1 protein may be siRNA or shRNA that inhibits the expression of FOXO1 gene.

[0041] The substance for knocking out the FOXO1 protein encoding gene may be a FOXO1 gene editing system; the FOXO1 gene editing system may specifically be a FOXO1 gene editing system based on TALEN gene editing technology.

[0042] In the above F3), the FOXO1 expression level may be the FOXO1 protein expression level or the FOXO1 mRNA expression level.

[0043] The substance for detecting the expression level of FOXO1 may be a substance for detecting the expression level of FOXO1 protein or a substance for detecting the expression level of FOXO1 mRNA, specifically a substance for detecting the expression level of FOXO1 by real-time quantitative PCR, immunofluorescence tissue staining, plasma ELISA, (single cell) transcriptomics, plasma proteomics or a combination thereof, such as primers for specifically amplifying the FOXO1 gene, probes for specifically recognizing the FOXO1 gene, antibodies for specifically binding to the FOXO1 protein, etc.

[0044] The above method for identifying or assisting in identifying the aging level of an organism, tissue or cell may specifically include the following steps: determining the FOXO1 expression level in a sample from the subject; comparing the FOXO1 expression level with a reference value; and identifying or assisting in identifying the aging level of the subject.

[0045] Preferably, the sample is selected from a tissue or blood sample, such as whole blood, serum or plasma.

[0046] Preferably, the reference value is the expression level (or average expression level) of FOXO1 in samples of the same type from young healthy individuals (or groups) with normal synovial function.

[0047] Preferably, when the FOXO1 expression level in the sample from the subject is lower than the reference value, it indicates that the subject is in an aging state.

[0048] In any of the above-mentioned applications, products or methods, the delaying of aging may be delaying the aging of the body, tissue or cells.

[0049] The organism may be a mammal (eg, a human or a mouse).

[0050] The tissue or cell may be a synovial tissue or cell (eg, a human synovial tissue or cell).

[0051] Furthermore, the synovial membrane may be synovial membrane derived from human acromion.

[0052] The cells may be human mesenchymal stromal cells differentiated from human embryonic stem cells.

[0053] Furthermore, the human embryonic stem cells are human embryonic stem cells hESCs H9 cell line.

[0054] In any of the above applications, products or methods, the amino acid sequence of the FOXO1 protein is shown in Sequence 1. The nucleotide sequence of the FOXO1 gene is shown in Sequence 2.

[0055] Any of the above products may be a medicine.

[0056] The present invention selects the subacromial synovium of young and elderly people, and provides new insights from the aspects of histology, cells and molecular changes. By describing the aging-related transcriptome changes of different cell types and their related regulatory networks, it is found that angiogenesis and aging-related genes are upregulated with aging, while genes related to cell adhesion and cartilage development are downregulated during aging. In addition, specific cell-cell communication in the aged synovium reflects aging-related inflammation and tissue remodeling, including vascular hyperplasia and tissue fibrosis. The present invention reveals that FOXO1 is the main regulatory factor that downregulates aging DEGs, and verifies that it is downregulated in the lining and sublining MSC populations of the aged synovium, and further knocks out FOXO1 in human mesenchymal stromal cells (MSCs) derived from human embryonic stem cells, and finds that knocking out FOXO1 can significantly accelerate cell aging. The present invention deepens the understanding of joint degeneration, thereby providing information for the development of new therapies aimed at rejuvenating elderly joints. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 Figure 2: Changes associated with aging in the subacromial synovium of humans. a is a schematic diagram of the experimental design of the synovium of young and old people. b is H&E staining of synovial tissues of young and old groups. Scale bars, 50 μm and 10 μm (enlarged image). Young group, n=6; old group, n=6. c is immunohistochemical (IHC) staining of CD31 in synovial tissues of young and old groups. Scale bars, 50 μm and 20 μm (enlarged image). Young group, n=6; old group, n=6. d is SA-β-Gal staining of human synovial tissues of young and old groups. Scale bars, 50 μm and 10 μm (enlarged image). Young group, n=6; old group, n=6. e is P21, a cell aging-related marker in synovial tissues of young and old groups Cip1 IHC staining of . Scale bar, 50 μm and 10 μm (enlarged image). Young group, n=6; old group, n=6. f is IHC staining of HERVK in synovial tissues of young and old groups. Scale bar, 50 μm and 10 μm (enlarged image). Young group, n=6; old group, n=6. g is IHC staining of H3K9me3 in synovial tissues of young and old groups. Scale bar, 50 μm and 10 μm (enlarged image). Young group, n=6; old group, n=6. h is IHC staining of S100A8 in synovial tissues of young and old groups. Scale bar, 50 μm and 10 μm (enlarged image). Young group, n=6; old group, n=6. i is IHC staining of S100A9 in synovial tissues of young and old groups. Scale bar, 50 μm and 10 μm (enlarged image). Young group, n=6; old group, n=6.

[0058] Figure 2Figure 2 is a single-nuclear transcriptomic analysis of the synovium of the young and old groups. a is the distribution of different cell types in the synovial tissues of the young and old groups. Among them, L-MSC: lining layer mesenchymal stromal cells; SL-MSC: sub-lining layer mesenchymal stromal cells; Per: pericyte; SMC: smooth muscle cell; EC: endothelial cell; Adi: adipocyte; Mac: macrophage; TC: T cell. b is the expression of representative marker genes for each cell type in the synovium. c is the expression profile of the top 30 marker genes of different cell types in the synovial tissues of the young and old groups, and their enriched functional annotations are shown on the right. d is a heat map and bar chart of the Log2FC (left) and number (right) of aging-related DEGs. e is the enriched pathways of upregulated DEGs (left) and downregulated DEGs (right) in all cell types during aging. The point size indicates the number of DEGs enriched in the corresponding pathway. f is the gene set score of fibrosis-related genes in different cell types of synovial tissues of the young and old groups. g is IHC staining of COL1A2 in synovial tissues of young and old groups. Scale bars, 50 μm and 10 μm (enlarged image). Young group, n=6; old group, n=6. h is Masson staining of synovial tissues of young and old groups. Scale bars, 50 μm and 10 μm (enlarged image). Young group, n=6; old group, n=6. i is Oil Red O staining of synovial tissues of young and old groups. Scale bars, 50 μm and 12.5 μm (enlarged image). Young group, n=6; old group, n=6. j is a circular diagram of up-regulated and down-regulated DEGs common to at least four cell types or three cell types.

[0059] Figure 3Figure 2 shows the cell type-specific transcriptional changes during human synovial aging. a shows the aging-related DEGs in different cell types annotated in the aging atlas database. b shows the network diagram of the correlation between aging-related DEGs and the synovial disease gene set. Each node represents a gene, and the node size indicates the number of cell types shared by the DEGs. c shows the heat map of the number of interaction pairs between the indicated human synovial cell types in the young and old groups. d shows the changes in cell interaction pairs in different cell types during synovial aging. The node size of the pixel type indicates the number of altered cell-cell interaction pairs. The color of the line indicates the direction of change in the interaction events between different cell types. e shows the cell-cell interaction pairs during synovial aging. f shows the age-specific VCAM1-related cell interaction pairs in the indicated cell types in the young and old groups. g shows the expression levels of VCAM1-related cell-cell interaction pairs in different cell types during synovial aging. h shows the IHC staining of VCAM1 in synovial tissues of the young and old groups. Scale bars, 50 μm and 10 μm (magnified images). Young group, n = 6; old group, n = 6. i is immunofluorescence staining of CD163 in synovial tissues of the young and old groups. Scale bar, 50 μm and 20 μm (enlarged image). Young group, n=6; old group, n=6.

[0060] Figure 4 Analysis of core transcriptional regulators in human synovial aging. a shows the core regulatory transcription factors that are upregulated and downregulated in all cell types during synovial aging. b shows the distribution of core transcription factors in different cell types during aging. The point size indicates the number of target gene hits. c shows the expression level of FOXO1 in different cell types during aging. d shows IHC staining of FOXO1 in synovial tissues of young and old groups. Scale bars, 50 μm and 10 μm (magnified image). Young group, n=6; old group, n=6. e shows the gene set scores of FOXO1-targeted differentially expressed genes in synovial tissues of young and old people in each cell type. f shows the representative GO pathways of FOXO1-targeted differentially expressed genes during synovial aging.

[0061] Figure 5 FOXO1 does not affect the stemness of hESC. a FOXO1 + / + hESC and FOXO1 - / - Western blot analysis of FOXO1 in hESCs. GAPDH was used as a loading control. b Whole genome sequencing of FOXO1 + / + hESC and FOXO1 - / - hESC copy number variation analysis. c is FOXO1 - / - G-banding karyotype analysis of hESC. d is the immunofluorescence image of pluripotency markers NANOG, SOX2 and OCT4, and FOXO1 + / +hESC and FOXO1 - / - Phase contrast images of hESC. Scale bar, 25 μm. e is FOXO1 + / + hESC and FOXO1 - / - Immunofluorescence analysis of Ki67 in hESCs. Scale bar, 20 μm. Statistical analysis of Ki67-positive cells is shown in the right panel. Data are presented as SEM ± mean. n = 3. Two-tailed t-test P values ​​are indicated.

[0062] Figure 6 For FOXO1 + / + hESC and FOXO1 - / - hESC differentiation into FOXO1 + / + hMSCs and FOXO1 - / - hMSC, flow cytometric analysis of FOXO1 + / + hMSCs and FOXO1 - / - Expression of hMSC-specific markers (CD44, CD73, CD90, and CD105) and hMSC-independent markers (CD34 and CD45) in hMSCs.

[0063] Figure 7 FOXO1 accelerates the senescence of hMSC cells. a is FOXO1 + / + hMSCs and FOXO1 - / - Western blot analysis of FOXO1 in hMSCs, GAPDH was used as a control. b FOXO1 + / + MSCs and FOXO1 - / - hMSCs growth curve. Data are presented as SEM ± mean. n = 3 biological replicates. ns, not significant; P < 0.001. c is FOXO1 + / + hESCs and FOXO1 - / - Detection of monoclonal formation ability of hMSCs. Data are presented as SEM ± mean. n = 6. Representative data from one of three independent experiments. d is FOXO1 + / + hMSCs and FOXO1 - / - Immunofluorescence analysis of Ki67 in hMSCs. Scale bar, 20 μm. e is FOXO1 + / + hMSCs and FOXO1 - / - Cell cycle analysis of hMSCs. f is flow cytometry analysis of FOXO1 + / + hMSCs and FOXO1 - / - ROS levels in hMSC cells. n = 3 biological replicates. g RT-qPCR analysis of P16 INK4a , P21 Cip1 , IL6, VCAM1, and extracellular matrix-related genes in FOXO1 + / +hMSCs and FOXO1 - / - Expression in hMSCs. Data are presented as SEM±mean. n=3 biological replicates. h is FOXO1 + / + hMSCs and FOXO1 - / - SA-β-gal staining of hMSCs. Scale bar, 50 μm. Data are presented as SEM ± mean. n = 3 biological replicates. i represents FOXO1 + / + hMSCs and FOXO1 - / - Western blot analysis of P16 INK4a, HP1α, and HP1γ in hMSCs. GAPDH was used as a control. Data are presented as SEM ± mean. n = 3 biological replicates. j is DNA-FISH detection of FOXO1 + / + hMSCs and FOXO1 - / - Telomere length in hMSCs. Scale bar, 20 μm. Data are presented as SEM ± mean. n = 100. k is ELISA detection of FOXO1 + / + hMSCs and FOXO1 - / - IL6 secretion in hMSC culture medium. Data are presented as mean ± SEM. n = 3 biological replicates. l is FOXO1 + / + hMSCs and FOXO1 - / - Immunofluorescence analysis of H3K9me3 in hMSCs. Scale bar, 20 μm. Data are presented as SEM ± mean. n = 300. m is FOXO1 + / + hMSCs and FOXO1 - / - Expression profiles of overlapping DEGs between sn-RNA sequences (L-MSC & SL-MSC) and bulk RNA-seq between hMSCs. n is sn-RNAseq (L-MSC & SL-MSC) and FOXO1 + / + hMSCs and FOXO1 - / - Representative pathways of up- and down-regulated differentially expressed genes among hMSCs. DETAILED DESCRIPTION

[0064] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0065] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0066] FOXO1 in the following examples + / + hESCs are human embryonic stem cells hESCs H9 cell line (female, H9ESC), which are products of WiCell Research Institute in Madison, Wisconsin, USA.

[0067] The experimental methods involved in the following embodiments are as follows:

[0068] 1. Human synovial membrane samples

[0069] Human synovial membrane samples from young (36.6 ± 0.9 years) and elderly (71.8 ± 1.2 years) patients with partial rotator cuff tears were collected. All patients underwent arthroscopic surgery for shoulder pathology, and patients who had previous surgery were excluded from the study. This study was approved by the Ethics Committee of Beijing Jishuitan Hospital (approval number: Beijing Jishuitan Hospital 201611-03).

[0070] 2. Cell culture

[0071] FOXO1 + / + hESC and FOXO1 - / - hESCs were seeded on mouse embryonic fibroblast (MEF) feeder cells (mouse embryonic fibroblast (MEF) feeder cells are described in the literature: Tan YS, Lei YL. Generation and Culture of Mouse Embryonic Fibroblasts. Methods Mol Biol. 2019; 1960: 85-91), and these cells were inactivated with mitomycin C (MMC) and maintained in Dulbecco's modified Eagle medium / F12 (DMEM / F12) medium (Gibco, 11330057), which contains 20% knockout serum replacement (Thermo Scientific, A3181502), 5 μM β-mercaptoethanol, 2 mM glutamate MA, 10 ng / mL bFGF, 1% penicillin / streptomycin, 0.1 mM non-essential amino acids (NEA), at 37°C, 5% CO2 for further in vitro experiments. hMSCs, different from hESCs, were cultured in MEMα medium (Gibco, 32571-101) supplemented with 10% fetal bovine serum (FBS, Gibco, Cat#10091-148, Lot#22500491P), 1 ng / mL bFGF, 0.1 mM NEAA and 1% penicillin / streptomycin.

[0072] 3. FOXO1 knockout hESC (FOXO1 - / -Preparation of hESCs

[0073] FOXO1 gene knockout hESC cells were prepared by TALEN-mediated gene targeting technology. The specific steps are as follows: According to the literature "Liu GH, Suzuki K, Li M, Qu J, Montserrat N, Tarantino C, Gu Y, Yi F, Xu X, Zhang W, Ruiz S, Plongthongkum N, Zhang K, Masuda S, Nivet E, Tsunekawa Y, Soligalla RD, Goebl A, Aizawa E, Kim NY, Kim J, Dubova I, Li Y, Ren R, Benner C, DelSol A, Bueren J, Trujillo JP, Surralles J, Cappelli E, Dufour C, Esteban CR, Belmonte JCI. Modelling Fanconi anemia pathogenesis and therapeutics using integration-free patient-derived iPSCs. Nat Commun. 2014 Jul. 7;5:4330.doi:10.1038 / ncomms5330.PMID:24999918;PMCID:PMC4291073." The TALEN plasmids (FOXO1-TALEN_Left and FOXO1-TALEN_Right) of the human FOXO1 gene were constructed using TAL2322 (Addgene, Plasmid #36748) and TAL2323 (Addgene, Plasmid #36749). The 1.2-1.3 kb homology arms (the primer sequences of the homology arms are as follows: FOXO1 Left Arm Primer F: ATAGGGCCCCATTGGTGTTATAGGTTCTCTGTGCCTGCCTCGTC; FOXO1 Left Arm Primer R: CCGCTCGAGAATCTCCCGCTCCGTCCACTAAGTCCAG; FOXO1 RightArm Primer F: CGCGGATCCTTCCTGCCTTGCCACCCTATTCTTGAGCAT; FOXO1Right Arm Primer R: CGGGGTACCAAGGCACTCCAGCAAGTTGAAGTAGGTTGTATCCA.) was combined with a drug resistance kit (neo or puro) to create a donor plasmid. In the first round of gene knockout, H9 ESCs were digested using TrypLE (Invitrogen) and filtered through a 40 μm cell strainer to eliminate cell clumps. The cells were then resuspended in 1 mL of MEF conditioned medium (MEMα medium (Gibco, 32571-101) containing 10% fetal bovine serum (FBS, Gibco, Cat#10091-148, Lot#22500491P), 0.1 mM NEAA (Gibco, 11140076), 2 mM GlutaMAX (Gibco, 35050079) and 1% penicillin / streptomycin (Gibco, 15140-163)) supplemented with 10 mM ROCK inhibitor to obtain a cell suspension. The plasmids (including 10 μg FOXO1-TALEN_Left, 10 μg FOXO1-TALEN_Right, and 30 μg donor plasmid) were then mixed with the cell suspension and electroporated. After electroporation, the cells were seeded on a 100 mm dish containing mouse embryonic fibroblasts (MEFs, Invitrogen, USA, Catalog No.: S1520-100). 2 days after electroporation, G418 (50 mg / mL) was added to the culture medium, and after 14-21 days, G418-resistant clones were manually picked into 96-well plates and amplified for genotyping. Heterozygous knockout clones were identified and used for a subsequent round of knockout. In the second round of knockout, the same procedure was repeated using a puromycin-resistant donor and puromycin selection (1 mg / mL) to obtain FOXO1. - / - hESC cells. + / + Compared with hESC) cell genomic DNA, FOXO1 - / - The only difference between hESC cells is that the FOXO1 gene is deleted (FOXO1 genes on both homologous chromosomes are deleted).

[0074] 4. Differentiation of hMSCs

[0075] The hESC-derived embryoid bodies were seeded on six-well plates coated with matrix gel, and the cells were cultured in hMSCs differentiation medium (MEMα medium (Gibco, 32571-101) containing 10% fetal bovine serum (FBS, Gibco, Cat#10091-148, Lot#22500491P), 1% penicillin / streptomycin (Gibco, 15140-163), 1 ng / ml bFGF (JointProteinCentral, 100120), and 5 ng / ml TGFβ (StemImmune, HST-TB1-1000)) for about 14 days. The differentiation medium was changed every other day until the fibroblast-like cells were almost confluent, and then the cells were transferred to hMSC medium [MEMα medium (Gibco, 32571-101) containing 10% fetal bovine serum (FBS, Gibco, Cat#10091-148, Lot#22500491P), 1 ng / mL bFGF, 0.1 mM NEAA and 1% penicillin / streptomycin] for continued culture, and the derived hMSCs were sorted by a fluorescence activated cell sorter (FACS) system (BD FACS Influx), and CD73, CD90 and CD105 triple-positive cells were collected for further experiments. The sorted hMSCs were subjected to flow cytometry analysis using the following antibodies: CD34 (BD Biosciences, 555821), CD45 (BioLegend, 103108), CD44 (BD Biosciences, 550989), CD73 (BD ​​Biosciences, 550257), CD90 (BD Biosciences, 555595) and CD105 (BD Biosciences, 17-1057-42).

[0076] 5. CNV analysis

[0077] FOXO1 was extracted using the DNeasy blood and tissue kit (Qiagen). + / + hESC and FOXO1 - / - Genomic DNA from hESCs. The extracted genomic DNA was sonicated and the Illumina DNA Library Preparation Kit (NEB) was used to construct sequencing libraries. The genome was then divided into consecutive 500 kb windows with a read counter and then calculated. Correction for GC content and mappability was assessed using HMM copies.

[0078] 6. Monoclonal formation ability detection

[0079] 3,000 cells were cultured in 0.1% gelatin-coated 12-well plates for about 13 days until the cells were almost confluent. The cells were then fixed with 4% paraformaldehyde (PFA) for 20 minutes, washed 3 times with PBS, and then stained with 0.2% crystal violet (Biohao, C0520) for 1 hour at room temperature and washed with tap water. Before use, the solution of 0.2% crystal violet was filtered through a 0.45 μm filter. Relative cell density was quantified using ImageJ software.

[0080] 7. SA-β-gal staining

[0081] 10 μm cryosectioned human synovial tissue was returned to room temperature, and hMSCs grown in 6-well plates were directly washed once with PBS and fixed with 0.2% glutaraldehyde and 2% formaldehyde fixative for 5 minutes at room temperature. Then, the samples were stained with 1 mg / mL X-gal staining buffer at 37°C for 12 hours. Then, they were sealed with 70% glycerol. Images were collected under the Olympus VS200 system.

[0082] 8. Masson staining

[0083] Paraffin-embedded synovial sections were dewaxed with xylene and rehydrated with graded alcohol and tap water. Masson trichrome staining (Solarbio, G1340) was detected according to the manufacturer's instructions. Images were acquired under an Olympus VS200 system.

[0084] 9. HE staining

[0085] Human synovial histological sections were fixed with PFA, dehydrated and embedded in paraffin. Paraffin-embedded synovial sections (5 μm thick) were dewaxed with xylene and hydrated with graded concentrations of alcohol and distilled water. The sections were counterstained with hematoxylin for 5 minutes, washed with tap water for 5 minutes, then counterstained with eosin, dehydrated with 50% alcohol, 95% alcohol, and 100% alcohol for 1 minute, and then transparentized with xylene. The images after staining were captured by an Olympus microscope.

[0086] 10. Immunohistochemical staining

[0087] Paraffin sections were deparaffinized and rehydrated, microwaved for 25 min in citrate buffer (pH 6.0) for antigen retrieval, and then permeabilized with 0.3% Triton X-100 in PBS for 1 h, followed by incubation in 5% blocking buffer (donkey serum, 017-000-021; Jackson) for 1 h at room temperature. The primary antibody was incubated overnight in a humidified chamber at 4 °C. It was then incubated with 3% H2O2 for 15 min to inactivate endogenous peroxidase, washed three times with PBS, and incubated with secondary antibodies for 1 h according to the manufacturer's instructions, followed by x-development using a DAB kit (ZSGB-BIO), followed by counterstaining with hematoxylin. Finally, the sections were dehydrated and mounted with neutral resin. Images were taken using an Olympus VS200 system.

[0088] 11. Oil Red O staining

[0089] Oil Red O (Sigma-Aldrich, #O1391) stock solution was mixed with water in a ratio of 3:2 to prepare Oil Red O working solution, which was then filtered through a 0.45 μm filter to remove impurities. OCT-embedded synovium sections were stained with Oil Red O working solution at room temperature for 15 minutes. The slides were washed twice in distilled water and then counterstained with hematoxylin. Images were acquired using an Olympus VS200 system, and the area of ​​lipid droplets was quantified using ImageJ software.

[0090] 12. Immunofluorescence staining

[0091] The pretreatment of immunofluorescence samples was the same as that of immunohistochemical staining, with antigen retrieval by microwave heat treatment in citrate buffer (pH 6.0) for 25 min, followed by permeabilization with 0.3% Triton X-100 in PBS for 1 h, and further placed in 5% blocking buffer (normal donkey serum, 017-000-021; Jackson) and primary antibody applied for 1 h at room temperature. The primary antibody was incubated overnight at 4 °C. The slides were washed three times with PBS and incubated with secondary antibodies Alexa Fluor 488 or Alexa Fluor 594 for 1 h at room temperature in the dark, and cell nuclei were labeled with Hoechst 3334. Finally, images were captured using a Zeiss confocal laser scanning microscope LSM900 system.

[0092] 13. DNA fluorescence in situ hybridization (DNA FISH)

[0093] The cells were fixed with 4% paraformaldehyde for 10 minutes at room temperature and washed three times with PBS. The cells were treated with prehybridization buffer at 60°C for 2 hours. The cells were then incubated with hybridization solution containing telomere probes at 37°C overnight. The next day, the cells were incubated in fluorescent hybridization solution at 37°C for 1 hour. Finally, the cells were counterstained with Hoechst 33342 (Invitrogen, H3570). Images were captured using a Zeiss confocal LSM900 system and analyzed by ImageJ software.

[0094] 14. Enzyme-linked immunosorbent assay (ELISA)

[0095] FOXO1 was quantified using an ELISA kit (Biolegend, 430504) according to the manufacturer's instructions. + / + hMSCs and FOXO1 - / - The IL6 content in the conditioned medium of hMSCs was analyzed. The detection was performed at 450 nm using Synergy H1 (BioTek). Finally, the results were quantified by cell number for data analysis.

[0096] 15. Cell cycle analysis

[0097] Collect FOXO1 + / + hMSCs and FOXO1 - / - hMSCs were fixed in 75% ethanol overnight at -20°C. The cells were then washed with PBS and centrifuged at 3000 rpm for 5 minutes and stained in a buffer containing 0.2 mg / mL RNase A, 0.02 mg / mL propidium iodide and 0.1% Triton X-100 at 37°C for 30 minutes. Next, the samples were directly analyzed using an LSRFortessa cell analyzer (BD) and the data were analyzed using ModFit software.

[0098] 16. Measurement of active oxygen

[0099] Reactive oxygen species (ROS) levels were detected using CM-H2DCFDA (Invitrogen, #C6827) dye. Cells were incubated with 2.5 μM CM-H2DCFDA at 37°C in the dark for 20 minutes and then analyzed by BD LSRFortessa flow cytometry.

[0100] 17. Western Blot

[0101] FOXO1 + / + hMSCs and FOXO1 - / -hMSCs were lysed on ice with 120 μL of radioimmunoprecipitation assay (RIPA) buffer (Invent, IN-WB001) with protease inhibitors (Roche, 4693159001) and phosphatase inhibitors (Roche, 4906837001) for 30 min, and then centrifuged at 13,500 × g for 15 minutes at 4 ° C. The supernatant was collected in a 1.5 mL EP tube, and the protein concentration was measured using a BCA protein quantification kit (Dingguo Changsheng Biology, BCA02), and then the sample was separated by SDS-PAGE and electrotransferred to a 0.2 μm PVDF membrane (Millipore, ISEQ00010). Subsequently, the membrane was incubated with 5% (w / v) skim milk powder blocking solution at room temperature for 1 hour, and then incubated with a primary antibody at 4 ° C overnight. After multiple washings, the HRP-coupled secondary antibody was incubated at room temperature for 1 hour. Imaging was performed using the ChemiDoc XRS+ system (Bio-Rad), and protein band intensity data were analyzed using ImageJ. The following primary antibodies were used as follows: anti-P16INK4a (BD Bioscience, 550834), anti-GAPDH (Santa Cruz, sc-365062), anti-HP1α (Cell Signaling Technology, 2616), anti-HP1γ (Cell Signaling Technology, 2619), HRP-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories, 115-035-003), and HRP-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, 111-035-003).

[0102] 18. Reverse transcription quantitative PCR (RT-qPCR) assay

[0103] RT-qPCR was performed using Thunderbird SYBR qPCR Mix (TOYOBO) in QuantStudio TM 5 real-time fluorescence quantitative PCR system (Applied Biosystems). Total RNA was extracted using TRIzol, and 2 μg RNA was used for cDNA synthesis using the GoScript reverse transcription system (Promega) according to the manufacturer's instructions. qPCR was performed using a CFX384 real-time system (Bio-Rad Laboratories, Inc.). The relative expression of each gene was normalized with GAPDH transcripts.

[0104] 19. Nuclei Isolation and snRNA-seq on the 10x Genomics Platform

[0105] The frozen synovial tissue was quickly ground into powder in a mortar with liquid nitrogen, and then 1.5 mL of lysis buffer was added. The cell lysis buffer consisted of nuclease-free water and 0.1% Triton X-100, 250 mM sucrose, 5 mM MgCl2, 25 mM KCl, 10 mM Tris buffer, 0.4 U / μL RNaseIn, 1 μM dithiothreitol, 0.2 U / μL Superasin, and 1× protease inhibitor. The sample was filtered through a 40 μm cell strainer (BD Falcon), centrifuged at 500 × g for 8 minutes at 4 ° C, and then the sample was resuspended in 1× PBS supplemented with 0.1% BSA, 0.2 U / μL Superasin and 0.4 U / μL RNaseIn. The nuclei were stained with Hoechst 33342 and propidium iodide (PI), and the double-positive nuclei were sorted by FACS (BD Influx). Single nuclei were captured using the 10x Genomics Single-Cell 3' system from pooled nuclei of synovial tissues of the same sex (n=8). At least 9,000 nuclei were captured for each sample according to the standard 10x capture and library preparation protocol (10x Genomics) and then sequenced in the NovaSeq 6000 sequencing system (Illumina, 20012866).

[0106] 20. Quality control and preprocessing of snRNA-seq data

[0107] The FASTQ files were mapped to the human reference genome (hg19), and a count matrix was generated by Cell Ranger software. Cellbender (version 0.2.0) (https: / / github.com / broadinstitute / CellBender) was then used to remove possible biases in background mRNA in each sample. The R package Seurat (V4.1.1) (Hao et al., 2021) was used to further analyze and filter low-quality cells. To ensure the reliability of the data, nuclei with a mitochondrial gene ratio greater than 2.5% or genes less than 200 were excluded. DoubletFinder (version 2.0.3 was used to remove doublets from the entire dataset. Finally, 19,892 high-quality nuclei were retained, with a median of 2,182 gene expressions detected per cell for downstream analysis.

[0108] 21. Integration, clustering and identification of cell types

[0109] Seurat (version 4.1.1) was used for linear dimensionality reduction. First, each sample dataset was normalized by the “SCTransform” function of Seurat. To identify integration anchors, the “PrepSCTIntegration” and “FindIntegrationAnchors” functions were applied. Using these anchors, the datasets of all samples were integrated by the “IntegrateData” function. The principal component analysis (PCA) dimensions were calculated using the “RunPCA” function, and the important components were determined using the “ElbowPlot” and “DimHeatmap” functions. The first 17 principal components were used for downstream analysis, and the cluster units were reduced in dimensionality using the “FindNeighbors” and “FindClusters” functions. Each cluster was identified as a different cell type by the expression of classical cell type marker genes.

[0110] 22. Identification of differentially expressed genes and analysis of gene function

[0111] The calculation of age-related c differentially expressed genes between the old and young groups of human synovial tissues of different cell types was analyzed using the “FindMarkers” function of Seurat and the Wilcoxon rank sum test. Genes with |Log2FC|2FC|>0.25 and P value <0.05 were defined as DEGs associated with aging.

[0112] 23. Gene Ontology (GO) analysis

[0113] Metascape (version 3.5) (http: / / metascape.org) was used to enrich GO terms / pathways of relevant genes. The results were visualized using the networkD3 R package or Cytoscape (version 3.7.2).

[0114] 24. Transcription factor (TF) regulatory network analysis

[0115] Core regulatory transcription factors were predicted from snRNA-seq data. Transcription factor binding gene sets were identified using the GENIE3 R package (version 1.6.0) of SCENIC (version 1.1.2.2) with default options (http: / / scenic.aertslab.org / ) and the RcisTarget database (version 1.6.0). Using the hg19RcisTarget database with genome-wide ranked genomes, RcisTarget identified and predicted enriched transcription factor binding gene sets and candidate target genes. Using DEGs from different cell types, GENIE3 (version 1.6.0) created a gene regulatory network. The transcriptional regulatory network was displayed by Cytoscape (version 3.7.2).

[0116] 25. Analysis of cell-cell interactions

[0117] Cell-cell interaction analysis was performed using CellphoneDB software (version 1.1.0). Ligands and receptors expressed in more than 10% of cells in a given cell type were evaluated in further analysis. Ligand-receptor pairs with a P value < 0.01 were used to further predict cell-cell communication in each group by comparing the average expression of each ligand-receptor pair in different cell types.

[0118] 26. Bulk RNA-seq analysis

[0119] RNA-seq raw data were trimmed using Trim Galore. Sequencing reads were then mapped to the hg19 genome using HISAT2 software (version 2.1.0). Mapping data were counted using HTSeq (version 0.13.5). DEGs were identified using DESeq2 (version 1.2.4), with Benjamini-Hochberg adjusted P value < 0.05 and Log2FoldChange > 0.5. ClusterProfiler (version 4.6.0) was used to perform gene set enrichment analysis (GSEA).

[0120] Example 1: Discovery of FOXO1, a marker associated with human synovial aging, based on single-cell nuclear sequencing technology

[0121] 1. Aging-related phenotypes of the human subacromial synovium

[0122] To investigate the age-related physiological changes of the subacromial bursa using histological analysis, we collected synovial tissue from young and elderly people from the bottom layer of the subacromial bursa near the supraspinatus tendon ( Figure 1 a). By comparing different anatomical regions of the subacromial synovium, including the lining layer (L) and sublining layer (SL), it was found that the synovium undergoes significant changes in the elderly. At the structural level, vascularization of the subsynovial layer increases with age, while intimal hyperplasia increases specifically in the lining layer ( Figure 1 b, c). By examining the aging indicators of aged synovial cells, it was found that both the lining and sublining of the aged synovium had a higher proportion of senescence-associated β-galactosidase (SA-β-Gal)-positive cells ( Figure 1 d) Similarly, the cell senescence marker p21 Cip1 and human endogenous retrovirus-K (HERV-K)-positive cells increase in aged synovium ( Figure 1e, f), indicating that senescent cells accumulate in the subacromial synovium during aging. Loss of heterochromatin and reduction of the heterochromatin-associated protein HP1γ are associated with cellular senescence and age-related diseases. It was observed that the heterochromatin mark H3K9me3 and the heterochromatin-associated protein HP1γ were both downregulated in cells within the lining and sublayer of the aged synovium ( Figure 1 g). As the accumulation of senescent cells is known to be associated with proinflammatory processes in various organs, we further investigated the expression of inflammatory factors in the aged synovium and observed an increase in the number of infiltrating immune cells in the aged synovium, such as an increase in the proportion of CD45-positive immune cells, and an increase in the expression of S100A8 and S100A9 (usually expressed in activated neutrophils or macrophages in response to inflammatory stimuli) in the aged synovium ( Figure 1 h, i). The above histological analysis results revealed multiple aging-related changes in the subacromial membrane in the elderly.

[0123] 2. Transcriptomic analysis of the subacromial membrane in young and elderly people

[0124] Many studies have reported the presence of different cell populations in the synovium, including synoviocytes, vascular cells, and immune cells. To address cell type-specific transcriptional changes in the human synovium during aging, single-nucleus RNA sequencing (snRNA-seq) was performed on human subacromial synovial samples from young and elderly people ( Figure 2 a). After stringent filtering, 18,982 high-quality single-nucleus transcriptomes were retained, with a median of 2,182 genes per cell, for subsequent analysis ( Figure 2 a). After UMAP visualization, eight cell types were annotated and characterized based on the expression of classic cell type-specific marker genes ( Figure 2 a). All major synovial cell types were identified, including lining mesenchymal stromal cells (PRG4 + , CRTAC1 + , FN1 + , L-MSC, n = 860 cells), sub-lining mesenchymal stromal cells (GSN + , VCAN + , FBLN1 + , SL-MSC, n=10,566 cells), pericytes (RGS5 + , TRPC6 + , Per, n = 1, 191 cells), smooth muscle cells (MYH11 + , ACTA2 + , SMC, n = 351 cells), endothelial cells (FLT1 + , VWF +, EC, n=2,280 cells), adipocytes (ADIPOQ+, KLB+, Adi, n=674 cells), macrophages (MSR1 + ,CD163 + ,CD86 + , Mac, n = 2,832 cells) and T cells (PTPRC + , CD69 + ,CD247 + , TC, n = 228 cells) Figure 2 b). Functional enrichment analysis of the top 50 cell-type-specific marker genes for each cluster provided insights into their unique physiological functions, as shown by transcriptional signatures associated with their unique physiological functions ( Figure 2 c). Specifically, L-MSCs and SL-MSCs represent functionally distinct mesenchymal stromal cell types. L-MSCs express genes associated with NABA core matrix bodies and O-linked glycosylation, including specific expression of PRG4, a highly glycosylated protein that functions as a lubricant in synovial fluid. In contrast, SL-MSCs express genes associated with adhesion foci and extracellular matrix organization, such as VCAN, a key component of the extracellular matrix involved in cell attachment, growth, and migration. Overall, the above analysis of young and aged synoviocytes provides a detailed cellular landscape that highlights the heterogeneity and functional diversity of different mesenchymal stromal cells in synovial joint homeostasis.

[0125] 3. Cell type-specific and common transcriptional changes during synovial aging

[0126] By calculating the differentially expressed genes (DEGs) associated with aging in different synovial cell types (Log2[fold change]>0.25, P value<0.05), it was found that among these cell types, SL-MSC and Mac had the most aging-responsive DEGs (the number of up-regulated DEGs was 293, 278, and the number of down-regulated DEGs was 204, 167, respectively) ( Figure 2 d). Gene ontology (GO) and functional enrichment analysis of these senescent DEGs showed that genes related to angiogenesis, response to TGFβ, lymphocyte activation, and collagen fibril organization were upregulated in most of the identified cell types in the aged synovium compared with young cells ( Figure 2 e). To further evaluate the fibrotic status of aged synovium, gene set scoring analysis of fibrosis-related genes was performed, and elevated gene expression levels were observed in most of the identified cell types, particularly in SL-MSCs ( Figure 2 f). In addition, expression of fibrosis marker genes such as COL1A2 was significantly enhanced in six of the eight identified cell types ( Figure 2f, g). Masson's trichrome staining and COL1A2 immunohistological staining further confirmed the increased fibrosis of the synovial sublining in the elderly ( Figure 2 g, h). Specifically, genes enriched in FCERI signaling, TNFα signaling, and lipid storage regulation were upregulated in Mac ( Figure 2 e). Fatty infiltration was observed as a histological change associated with synovial aging based on changes in gene expression ( Figure 2 i). In addition, the expression of genes related to the Wnt signaling pathway was particularly upregulated in the aged EC group, which is consistent with the angiogenesis observed in the aged synovium ( Figure 2 e). Consistent with the histological finding of accumulation of senescent cells in the aged synovium ( Figure 1 d, e), Gene set scoring analysis showed that the expression of genes associated with the senescence-associated secretory phenotype (SASP gene set) was generally increased in various cell types, especially in L-MSCs and Macs. Bulk sequencing of synovial samples further confirmed the FCERI-mediated NF-κB activation and enhanced immune response observed in snRNA-seq analysis.

[0127] In contrast, downregulated genes common to different synovial cell types were mainly involved in cell projection or junction organization, cell chemical homeostasis, and cartilage development ( Figure 2 e). Notably, RPL31, a gene encoding a ribosomal protein, was identified as a highly frequently downregulated DEG in six of the eight identified cell types ( Figure 2 j). Although RPL31 has been reported to be important in the regulation of osteogenic differentiation and identified as one of the most important dysregulated genes in the synovium of patients with rheumatoid arthritis (RA), the precise role of RPL31 in synovial aging or disease remains unexplored.

[0128] Through a joint analysis of synovial aging DEGs and the Aging Atlas Database (2021), it was found that the gene expression characteristics of the aged synovium are related to inflammation and the pathogenesis of osteoarthritis (OA) ( Figure 3 a). For example, the OA risk factor EGR1 was highly expressed in most synoviocytes of aged samples, while the circadian master gene ARNTL was downregulated in both MSC cell types. In addition, VEGF-C, a potential drug target in the inflamed synovium in osteoarthritis, was significantly downregulated in L-MSCs ( Figure 3 a). By further evaluating genetic risk variants associated with heritability of osteoarthritis ( Figure 3b), NAMPT was noted to be upregulated in synovial cells during aging. Similarly, FN1, which encodes a glycoprotein present on the cell surface or in the extracellular matrix associated with synovial osteochondromatosis and synovitis, was upregulated in different synovial cell types during aging. These data reveal a potential molecular link between aging and joint diseases.

[0129] 4. Core regulators of transcriptional changes in the aging synovium

[0130] To characterize the cellular programs that direct synovial senescence, we performed an intercellular communication analysis using CellphoneDB. This analysis enables the examination of interactions between different cell types based on paired ligand-receptor gene expression ( Figure 3 c). Overall, it was found that the intercellular interactions between different cell types within the synovial tissue were enhanced during aging, with SL-MSCs showing the most obvious changes ( Figure 3 d). When GO analysis was used to focus on the cell-cell interactions that increased with age, it was found that these interactions were mainly enriched in pathways related to chemotaxis, collagen formation, and angiogenesis, while those that decreased with age were mainly enriched in pathways related to chondrogenesis and osteoblast differentiation ( Figure 3 ). Notably, VCAM1 plays an important role in leukocyte chemotaxis and adhesion and is significantly upregulated in L-MSCs during aging ( Figure 3 At the same time, integrins (encoded by ITGA4 and ITGA9) as VCAM1 interaction partners are mainly enhanced in immune cells (such as macrophages) in the aged synovium ( Figure 3 f). It is reported that the migration of monocytes to the synovium, as the initial step of synovitis, is mainly triggered by integrin activation and chemotaxis. Therefore, this enhanced interaction between VCAM1 and integrin suggests that the adhesion and migration of monocytes to the synovial lining layer helps to initiate the inflammatory response. In addition, the present invention also detected that the number of VCAM1-positive cells in the synovial lining layer of the aged increased by about 10 times ( Figure 3 h). The number of macrophages also increases with age and appears to aggregate near L-MSCs in the aged synovial lining ( Figure 3 i).

[0131] Next, SCENIC analysis was applied to identify transcription factors responsible for transcriptional changes in different cell types in the subacromial membrane of the aged Figure 4 a, b). Core regulators upregulated in senescence DEGs included NFATC1 (in SL-MSCs and ECs), a gene known to promote osteoclast differentiation, and SOX5 (in ECs), which plays a central role in the transcription of immune response-related genes in the synovium ( Figure 4a). Notably, both NFATC1 and SOX5 were reported to be upregulated in the joints of patients with OA or RA. For the downregulated aging DEGs, the most significantly downregulated regulator was found to be FOXO1, which had decreased expression in most synovial cells, including L-MSCs and SL-MSCs ( Figure 4 ac). Downregulation of FOXO1 in the lining and sublining layers of the aged synovium was confirmed by immunostaining ( Figure 4 d). Further GO and functional enrichment analysis showed that genes related to cartilage development and hormone response, such as FOXO1 target genes, were also downregulated during synovial aging ( Figure 4 e, f). These data suggest that downregulation of FOXO1 is a mechanism contributing to dysregulation in aged synovium. Importantly, FOXO1 is known to regulate gene expression of VCAM1 as a transcriptional repressor, and upregulation of VCAM1 in synovial aged MSCs may be attributed to decreased FOXO1 expression.

[0132] Example 2: Depletion of FOXO1 accelerates cell senescence of hMSCs

[0133] 1. FOXO1 does not affect the stemness of hESCs

[0134] To explore the potential regulatory role of FOXO1 in synoviocytes, we used transcription activator-like effector nuclease (TALEN)-mediated homologous recombination (HR) gene editing to knock out FOXO1 in human embryonic stem cells (hESCs) and obtain FOXO1 - / - hESC. Western blot analysis confirmed that FOXO1 had been knocked out ( Figure 5 a), while genome-wide copy number variation (CNV) analysis showed that the genome was - / - hESCs were stable and karyotype analysis was normal ( Figure 5 b, c) In addition, the morphology and expression of pluripotency markers including NANOG, SOX2, and OCT4 were significantly increased in FOXO1 - / - hESCs are also normal ( Figure 5 d), and FOXO1 was detected by Ki67 immunofluorescence staining + / + hESC and FOXO1 - / - There was no difference in cell proliferation ability between hESCs ( Figure 5 e) Taken together, these data suggest that FOXO1 does not affect the maintenance of pluripotency in hESCs.

[0135] 2. Depletion of FOXO1 accelerates the senescence of hMSC cells

[0136] To elucidate the function of FOXO1 in synoviocytes, FOXO1 + / +hESCs and FOXO1 - / - hESCs differentiated into synoviocyte-like mesenchymal stromal cells (hMSCs), FOXO1 + / + hMSCs and FOXO1 - / - hMSCs all expressed comparable levels of mesenchymal progenitor cell markers CD73, CD90, and CD105, and lacked expression of the hMSC-independent antigens CD34 and CD45 as previously described ( Figure 6 Western blot analysis confirmed that FOXO1 was absent in hMSCs ( Figure 7 a). With FOXO1 + / + Compared with hMSCs, FOXO1 - / - hMSCs showed slow cell growth, decreased clone formation ability, fewer Ki67-positive cells, and arrest in the S phase ( Figure 7 be). Downregulation of FOXO1 significantly increased reactive oxygen species (ROS) levels ( Figure 7 f), and led to an increase in senescence-associated β-galactosidase (SA-β-gal)-positive cells ( Figure 7 h). Typical indicators of cellular senescence were also observed, including FOXO1 - / - Telomere shortening and increased P16INK4a expression in hMSCs ( Figure 7 g, i, j). Similarly, the present invention also detected the up-regulated expression of a group of SASP genes, such as IL6 ( Figure 7 g), at the same time, IL6 in FOXO1 - / - The secretion level in hMSCs was also increased ( Figure 7 k). In addition, the present invention also found that FOXO1 deficiency leads to the loss of heterochromatin in hMSCs ( Figure 7 l). Meanwhile, FOXO1 was detected by Western blot analysis. - / - The expression of heterochromatin-associated proteins HP1α and HP1γ was decreased in hMSCs ( Figure 7 i) In conclusion, the above results indicate that the lack of FOXO1 accelerates the senescence of hMSCs.

[0137] Consistent with the above observations, the present RNA-seq data showed that FOXO1 deficiency induced a transcriptome signature similar to the changes in the human synovial transcriptome during aging. 103 aging DEGs in L-MSCs or SL-MSCs were also altered in hMSCs after FOXO1 deficiency, including 62 upregulated genes and 41 downregulated genes ( Figure 7 m). In addition, the upregulated DEGs in FOXO1-deficient hMSCs and aged synovium were enriched in angiogenesis (EPAS1, ANGPTL4), chemotaxis (VCAM1, SEMA3C), and inflammatory response pathways (IL6, HIF1A) ( Figure 7 m, n), while down-regulated genes were enriched in cartilage development (BMP2, SOX6) and response to oxidative stress (ARNTL, NQO1) ( Figure 7 m, n). In addition, RNA sequencing further confirmed that FOXO1 - / - Abnormal expression of profibrotic and proinflammatory factors in hMSCs Figure 7 g).

[0138] In summary, the present study shows that downregulation of FOXO1 will become an important regulatory factor for aging-related transcriptome changes in the synovium, and FOXO1 plays an important role in synovial cells, protecting cells from aging and the secretion of inflammatory cytokines and chemokines.

[0139] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of FOXO1 protein or a substance that increases the content and / or activity of FOXO1 protein in delaying aging or preparing products that delay aging.

2. A product for delaying aging, comprising FOXO1 protein or a substance that increases the content and / or activity of FOXO1 protein.

3. The use according to claim 1 or the product according to claim 2, characterized in that: The delaying of aging refers to delaying the aging of the body, tissue or cell; Alternatively, the tissue or cell is a synovial tissue or cell.

4. Use of a substance for reducing the content and / or activity of FOXO1 protein in any of the following D1)-D6): D1) Construction of senescent cells; D2) preparing products for constructing senescent cells; D3) Screening or assisting in the screening of drugs that delay aging; D4) preparing products for screening or assisting in screening of drugs for delaying aging; D5) Research or assist in researching the aging mechanism of organisms, tissues or cells; D6) Preparation of products for studying or assisting in studying the aging mechanism of organisms, tissues or cells.

5. A product, wherein the active ingredient is a substance that reduces the content and / or activity of FOXO1 protein; the function of the product is any one of the following E1)-E3): E1) Construction of senescent cells; E2) Screening or assisting in the screening of drugs that delay aging; E3) Study or assist in studying the aging mechanism of organisms, tissues or cells.

6. The use according to claim 4 or the product according to claim 5, characterized in that: The delaying of aging refers to delaying the aging of the body, tissue or cell; Alternatively, the tissue or cell is a synovial tissue or cell.

7. A substance for detecting the expression level of FOXO1 is used in identifying or assisting in identifying the aging level of an organism, tissue or cell, or in preparing a product for identifying or assisting in identifying the aging level of an organism, tissue or cell.

8. A product for identifying or assisting in identifying the aging level of an organism, tissue or cell, comprising a substance for detecting the expression level of FOXO1.

9. The use according to claim 7 or the product according to claim 8, characterized in that: The tissue or cells are synovial tissue or cells.

10. Any of the following methods F1)-F7): F1) A method for delaying aging of an organism, tissue or cell, comprising the step of contacting the organism, tissue or cell with a FOXO1 protein or a substance that increases the content and / or activity of the FOXO1 protein; F2) A method for constructing senescent cells, comprising the step of introducing a substance that reduces the content and / or activity of FOXO1 protein into a recipient cell; F3) A method for screening or assisting in screening a drug for delaying aging, comprising the step of screening a drug for delaying aging using senescent cells constructed by the method described in F2); F4) A method for studying or assisting in studying the aging mechanism of an organism, tissue or cell, comprising the step of using the senescent cells constructed by the method described in F2) to study the aging mechanism of an organism, tissue or cell; F5) A method for changing the senescence state of isolated cells, comprising the step of introducing a substance that reduces the content and / or activity of FOXO1 protein into the isolated cells; F6) A method for promoting cell senescence, comprising the step of introducing a substance that reduces the content and / or activity of FOXO1 protein into a recipient cell; F7) A method for identifying or assisting in identifying the level of aging of an organism, tissue or cell, comprising the step of detecting the expression level of FOXO1 in a sample from a subject.

Images